Korean J. Pl. Taxon. 44(1): (2014) ISSN Korean Journal of Plant Taxonomy Molecular phylog
|
|
- 숙희 어금
- 5 years ago
- Views:
Transcription
1 Korean J. Pl. Taxon. 44(1): (2014) ISSN Korean Journal of Plant Taxonomy Molecular phylogenetic study of section Sabina (Genus Juniperus) in Korea based on chloroplast DNA matk and psba-trnh sequences data Jeong-Ki Hong, Jong-Cheol Yang*, Seung-Hwan Oh and You-Mi Lee Korea National Arboretum, Pocheon, Gyeonggi-do , South Korea (Received 31 December 2013; Revised 20 February 2014; Accepted 11 March 2014) 엽록체 DNA mat K와 psba-trnh 염기서열에기초한한국산향나무절 ( 향나무속 ) 식물의분자계통학적연구 홍정기 양종철 * 오승환 이유미국립수목원산림생물조사과 ABSTRACT: This study aims to define the phylogenetic relationship within Korean section sabina and find molecular markers which resolve the phylogenetic relationship in genus Juniperus and section sabina. cpdna matk and psba-trnh were used as molecular markers. The combined analyses of two genes suggested that section sabina was a clade supported by 100% BP. The relationships of [J. chinensis var. sargentii+j. davurica] clade and [J. chinensis var. chinensis+j. chinensis var. procumbens+j. chinensis var. horizontalis] clade were supported by 91% BP and 100% BP, respectively. Thus, the classification of Korean section sabina would be appropriate at follows, (1) J. chinensis var. sargentii+j. davurica, and (2) J. chinensis var. chinensis+j. chinensis var. procumbens According to the results of separate analyses, matk seems to work better resolving power to clarify the phylogenetic ambiguity in Juniperus and section sabina than psba-trnh. Keywords: Section Sabina, Molecular phylogeny, matk, psba-trnh 적요 : 한국산향나무절식물에대한계통학적유연관계를규명하고, 더불어향나무속및향나무절의계통및유연관계를잘나타낼수있는분자마커를찾아내고자분자계통학적연구를수행하였다. 엽록체 DNA matk 와 psba-trnh 를분자마커로활용하였으며, 두유전자의조합분석결과향나무절이 100% 의 BP 로지지되는분계조를이루었다. 눈향나무 + 단천향나무분계조와향나무 + 섬향나무 + 뚝향나무분계조는각각 91%, 100% 의 BP 로지지되었다. 따라서한국산향나무절은 (1) 눈향나무 + 단천향나무, (2) 향나무 + 섬향나무 + 뚝향나무두개의분계조로구분하는것이가장적합할것으로생각되고, 본연구에서이용된두개의분자마커중 matk 가 psba-trnh 보다향나무속및향나무절의계통및유연관계를규명하는데다소높은해상력을나타내었다. 주요어 : 향나무절, 분자계통, matk, psba-trnh 향나무속 (Juniperus L.) 은소나무아강 (Pinidae Cronquist, Takhtajan & Zimmermann), 측백나무과 (Cupressaceae Gray) 에포함되는식물군으로북반구에주로분포하고있으며, *Author for correspondence: yangun@forest.go.kr Copyright 2014 the Korean Society of Plant Taxonomists 전세계적으로약 60여분류군이분포하고있다 (Fu et al., 1999; Adams et al., 2002). 또한, 향나무속은구과가육질이고, 구과가성숙한후에도열개하지않거나조금만열개하며, 종자에날개가없다는특징으로다른측백나무과식물들과뚜렷하게구분되는단계통군으로알려져있다 (Fu et al., 1999; Little, 2006). 향나무절 (Section Sabina) 은북반구중에서도동쪽에주로분포한다. 바늘형과비늘형의잎을모두가지고, 밑부 51
2 52 Jeong-Ki Hong, Jong-Cheol Yang, Seung-Hwan Oh and You-Mi Lee 분에마디가없으며, 구화수가가잔가지에달리고, 실편이 3-8장씩십자대생하거나돌려나는형태적인특징으로노간주나무절 (Section Juniperus) 과구분되며, 전세계적으로약 50여분류군이분포하고있다 (Adams, 1999; Fu et al., 1999). 한반도에는향나무 (Juniperus chinensis L. var. chinensis), 섬향나무 (J. chinensis L. var. procumbens (Siebold) Endl.), 눈향나무 (J. chinensis L. var. sargentii A. Henry), 뚝향나무 (J. chinensis L. var. horizontalis Nakai) 와북한백두산지역에단천향나무 (J. davurica Pall.) 의 5분류군이분포하는것으로알려져있다 (Korea National Arboretum and The Plant Taxonomic Society of Korea. 2007). Farjon (2005) 은전세계향나무속 52분류군을대상으로비늘잎이없는노간주나무절 ( 그룹 1) 과바늘잎이대부분인향나무절그룹 ( 그룹 2), 비늘잎이대부분인향나무절그룹 ( 그룹 3) 으로나누었다. 한국산향나무절식물들인향나무와눈향나무, 단천향나무는그룹 3에포함되었으며, 섬향나무는바늘잎이대부분인그룹 2에포함시키면서섬향나무의학명을 Juniperus procumbens를사용하여별도의종수준으로처리하였다. Adams et al.(2002) 이 RAPD에의한동아시아산향나무속의계통연구를실시한결과향나무절내에서향나무, 눈향나무, Juniperus chinensis var. tsukusiensis가하나의분계조를형성하고, 섬향나무가다른분계조를형성하는것으로보고하였다. 이후 Mao et al.(2010) 이 matk, rbcl 등 9개의엽록체 DNA와핵 DNA인 ITS를이용하여향나무속을중심으로측백나무과에대하여분자분류학적연구를수행한결과향나무절내에서향나무와섬향나무가분계조를형성하였고, 단천향나무가다른분계조에포함되었으며, 눈향나무는연구에이용되지않았다. Adams and Schwarzbach (2012) 는 trnl-f 등 4개의엽록체 DNA와핵 DNA인 ITS를이용하여향나무절의분자분류학적연구를수행한결과향나무와섬향나무가가장근연관계에있으며, 눈향나무와, 단천향나무는각각다른분계조를이루는것으로보고하였다. 또한섬향나무를향나무의변종으로처리하여 Adams et al. (2002) 의결과와차이를보였다. 국내연구로는 Kim (1988) 이단천향나무를제외한국내향나무속식물 10분류군에대하여형태형질연구를시행하였으나, 향나무절내뚜렷한분류형질은제시하지못하였다. 그외향나무절에대하여화분의특성 (Kim et al., 1997) 과염색체핵형분석연구 (Park, 1986) 가수행되었으나향나무절분류군들에대한명확한유연관계를나타내지는못하고있다. Sihn(2010) 은우리나라나자식물전반에대한 DNA barcoding 연구를수행하였으나향나무절분류군은향나무와눈향나무만이다루어져전체적인향나무절관계를파악하기에어려움이있다. 위내용과같이아직까지우리나라향나무절에대한연구는부분적이거나형태적인연구만이주로이루어져있는상황으로, 본연구에서는형태적으로유사한한국산향나무절분류군들에대하여분자계통학적연구를수행함으로써근연분류군간의유전적유연관계및지리학적분포특성을파악하고자하였다. 재료및방법 1. 지리적분포연구우리나라향나무절식물의분포를파악하기위하여국립생물표본관 (KH) 소장표본을검토하였으며, 북한지역의분포는 Chung (1943), Uykei (1926) 의문헌을통해확인하였고, 국외분포파악을위하여 Farjon (2005) 의문헌을참고하였다. 또한향나무의울릉도외추가분포파악을위하여 Shin (2013) 의문헌을검토하였다. 2. DNA 분석을위한연구재료한국산향나무절식물의분자계통학적유연관계를밝혀내기위하여향나무절식물 4 분류군 ( 향나무, 눈향나무, 섬향나무, 단천향나무 ) 에대하여 2011 년부터 2013 년까지현지조사를통하여직접확보하였으며, 단천향나무는러시아지역에서수집된표본을활용하였다. 또한 Mao et al.(2010) 의연구에서군외군으로사용되었던눈측백속 (Thuja L.) 2 분류군과노간주나무절 2 분류군을군외군으로이용하였다. 본연구에서사용한식물재료의표본정보는 Table 1 에정리하였다. 본연구를통해확보한식물재료의증거표본은국립수목원표본관 (KH) 에보관하였다. 향나무절에포함되어있는뚝향나무는아직까지식재되어진것만이확인될뿐한반도내자생지분포가확인되지않고있으며, 수형에의한생태적특성으로구분되어지는분류군으로본연구대상에서는제외하였다. 3. DNA 의추출 DNA 추출을위해확보한재료의잎을 Silica gel 로건조시켜사용하였으며, 건조표본을이용할경우가능한최근에수집된표본의어린잎을사용하였다. Total genomic DNA 는 DNeasy plant mini kit (QIAGEN, Germany) 을이용하여공급자의매뉴얼에따라추출하였다. 추출한 DNA 는 1.5% agarose gel 로전기영동하여추출여부를확인하였다. 4. 염기서열분석지역본연구에서향나무절의분자계통학적분석을위해엽록체 DNA matk 와 psba-trnh region 을이용하였다. 5. PCR 을이용한유전자증폭반응유전자증폭을위한중합효소연쇄반응은 1µL 의 template DNA 가포함된 100 µl 의 PCR reaction solution (10X
3 Molecular phylogenetic study of section Sabina (Genus Juniperus) in Korea based on chloroplast DNA mat K and psba-trn H sequences data 53 Table 1. List of taxa, voucher information, geographic origin, and accession numbers for plant materials used in this study. Juniperus chinensis L. var. chinensis Taxa Korean name Locality Voucher No. 향나무 Ulleungdo(Is.), Ulleung-gun, Gyeongsangbuk-do, Korea Daeheuksando(Is.), Sinan-gun, J. chinensis L. var. procumbens (Siebold) Endl. (A) 섬향나무 Jeollanam-do, Korea J. chinensis L. var. procumbens (Siebold) Endl. (B) 섬향나무 Gangjin-gun, Jeollanam-do, Korea J. chinensis L. var. sargentii A. Henry (A) 눈향나무 J. chinensis L. var. sargentii A. Henry (B) 눈향나무 J. chinensis L. var. sargentii A. Henry (C) 눈향나무 Hallasan(Mt.), Jeju-si, Jeju-do, Korea Gayasan(Mt.), Hapcheon-gun, Gyeongsangnam-do, Korea Seoraksan(Mt.), Inje-gun, Gangwon-do, Korea Accesion No.* matk trnh-psba K-S Kim, K-S Kim, K-S Kim, J-K Hong, C-H Lee & C-S Jang, C-H Lee & C-S Jang, J. chinensis L. var. sargentii A. Henry (D) 눈향나무 Korea National Arboretum, Pocheon-si, Korea J-K Hong, J. davurica Pall. 단천향나무 Primorye, Russia KHB J. rigida Siebold & Zucc. 노간주나무 J. conferta Parl. 해변노간주 Thuja koraiensis Nakai 눈측백 T. occidentalis L. 서양측백 Bibongsan(Mt.), Uiseong-gun, Gyeongsangbuk-do, Korea Eocheongdo(Is.), Gunsan-si, Jeollabuk-do, Korea Seoraksan(Mt.), Inje-gun, Gangwon-do, Korea Korea National Arboretum, Pocheon-si, Korea K-S Kim, J-K Hong, K-S Kim, K-S Kim, * : indicated that the gene was analyzed in this study and not yet given the accession number of those sequences from NCBI Table 2. Sequences and reference of primers for amplifying and analyzing the sequences of the chloroplast DNA of matk, psba-trnh gene. Region Primer Sequences (5'-3') Reference matk psbatrnh matk af AATGGATGAVTTCCAWAGADAR This study matk bf ATTCATCCRGAAATTTTGGTTC This study matk ar TKCCAAATTCGTTCTCTCTC This study matk br AGATRATATCTACATTTTTTKACTW This study trnh CGCGCATGGTGGATTCACAATCC CBOL Plant Working Group(2009) psba GTTATGCATGAACGTAATGCTC CBOL Plant Working Group(2009) MG TM Taq-HF buffer 10 µl, 2 mm MG TM dntp mixture 10 µl, 10 pmol primer 5 µl(x2), MG TM Taq-HF polymerase 1 µl, 증류수 ) 을이용하였다. PCR termal cycle 과정은 94 o C 에서 45초간 denaturation, 59 o C에서 1분간 annealing, 72 o C 에서 1분간 extension을 35회반복하였다. 각각의유전자지역을증폭하기위해사용한 primer의염기서열은 Table 2에정리하였다. 6. PCR product 의정제와염기서열결정 PCR products 는 Montage PCR Cleanup Kit (Millipore, USA) 를이용하여공급자의매뉴얼에따라정제하였으며, 정제된 PCR products 를 cycle sequencing 반응의주형으로 사용하였다. Cycle sequencing 반응은 Big Dye terminator cycle sequencing kit v3.1 (Applied Biosystems, USA) 를사용하였으며, 대상유전자의길이가 1kb 를넘는 matk 의경우구간내부의 primer 를이용하여 cycle sequencing 하였다. 염기서열의결정은 3730XL automated DNA sequencing system (Applied Biosystems, USA) 을이용하였다. 7. 염기서열정렬과계통수구축각유전자의염기서열은 Sequencher (ver. 4.5, Gene Codes Co. USA) 를이용하여조합하였다. 염기서열의분석을위하여직접염기서열을정렬하였다.
4 54 Jeong-Ki Hong, Jong-Cheol Yang, Seung-Hwan Oh and You-Mi Lee 계통수구축은 PAUP program (ver. 4.0b10, Swofford, 2002) 을이용하였으며, 형질에있어서가중치는모두동일하게처리하였고, 전체염기서열중 gap 은모두결여형질 (missing character) 로처리하였으며, 정렬된염기서열의모든형질은 unordered, unweighted character 로설정하였다. PAUP 에의해가장짧은경로를가지는계통수를산출하기위해 exhaustive search 를통해최대절약분석 (maximum parsimony analysis) 을실시하였으며, 이에따른 option 으로는 ACTRAN, TBR branch swapping, MULPARS 로최적화하였다. 계통수에서각절에대한신뢰도를산출하기위해서 2 개이상의 tree 가도출된유전자의경우 strict consensus tree( 완전일치계통수 ) 를구한후, Bootstrap 분석 (Felsenstein, 1985) 을 1,000 회반복하여 bootstrap value 를산출하였다. 또한, matk 와 psba-trnh region 에대한계통수뿐만아니라두유전자의염기서열을조합한계통수도함께작성하였다. Maximum likelihood analysis 는 GTR+I+Γ 모델을적용하여 RA ML BlackBox( 를이용하였고, Bootstrap value 는위에제시된최대절약분석방법을통해산출하였다. 결 과 1. 지리적분포향나무절 4 분류군에대한표본및문헌검토결과향나무는중국의안후이성과관동성등남동쪽과일본그리고우리나라울릉도와동해안일대에분포하며, 섬향나무는일본오키나와일부지역과우리나라전남해안과섬지역에분포한다. 눈향나무는중국흑룡강성지역과, 러시아극동지역, 일본혼슈지역에일부분포하며, 우리나라에서는백두산지역에서백두대간능선부를따라제주한라산까지분포하는것으로확인되었다. 단천향나무는우리나라백두산지역에서부터중국흑룡강성과몽골, 러시아극동부지역에분포한다. 2. 염기서열변이양상 matk 유전자의염기서열변이 : 4 분류군의향나무절에대한 matk 유전자를분석하였으며, 1,186 bp ( 향나무, 섬향나무 )~1,198 bp ( 눈향나무, 단천향나무 ) 의길이변이를보였다. 다중정렬된염기서열의길이는 1,210 개이고, 전체염기서열중 1,134 개는일정하였고, 76 개의변이가있었으며, 그중 72 개가계통학적으로유효하였다. G+C 의함량은 32.7% 이었다 (Table 3). psba-trnh region 의염기서열변이 : 4 분류군의향나무절에대한 psba-trnh region 을분석하였으며, 387 bp ( 눈향나무 )~480 bp ( 향나무, 섬향나무 ) 의길이변이를보였다. 다중정렬된염기서열의길이는 524 개이고, 전체염기서열중 442 개는일정하였고, 82 개의변이가있었으며, 그중 Fig. 1. Distribution of 4 taxa in section Sabina. Table 3. Values and statistics of the data matrices. matk (I) psba -trnh (II) I+II Number of taxa analyzed Alligned sequences (bp) 1, ,734 Length variation (bp) section Sabina in Korea 1,186 ~1, ~480 1,585 ~1,666 J. chinensis var. chienesis 1, ,636 J. chinensis var. procumbens 1, ,666 J. chinensis var. sargentii 1, ,585 J. davurica 1, ,663 Mean of G+C (%) Number of informative site Number of constant site 1, ,576 Number of variable site Number of most parsimonious trees Tree length Consistency index (CI) of MP tree Retention index (RI) of MP tree ln L value 개가계통학적으로유효하였다. G+C 의함량은 33.6% 이었다 (Table 3).
5 Molecular phylogenetic study of section Sabina (Genus Juniperus) in Korea based on chloroplast DNA mat K and psba-trn H sequences data 분자계통학적분석결과모든염기서열분석은눈측백속 2 종을군외군으로설정하여유연관계를검토하였다. matk 유전자 : 4 분류군에대한염기서열을분석한결과 79 step 의길이를갖는 1 개의 MP tree(ci = 0.987, RI = 0.990) 를도출하였다 (Fig. 4). MP tree 에서는향나무절이 99% 의 BP 로지지되는분계조를형성하는것으로확인되었으며, 향나무절내에서두개의분계조를형성하였다. 향나무 + 섬향나무분계조는 100% 의 BP 로, 눈향나무 + 단천향나무분계조는 95% 의 BP 로지지되었다. psba-trnh region : 4 분류군에대한염기서열을분석한결과 85 step 의길이를갖는 396 개의 MP tree(ci = 0.976, RI = 0.976) 를도출하였다 (Fig. 4). MP tree 에서는향나무절이군외군인노간주나무절식물물들과함께붕괴된 node 내에서 100% 의 BP 로지지되는분계조를형성하는것으로확인되었다. 향나무절내에서는향나무 + 섬향나무분계조가 73% 의 BP 로, 눈향나무 + 단천향나무분계조는 59% 의 BP 로지지되었다. matk 유전자와 psba-trnh region 조합분석 : 4 분류군에대한염기서열을분석한결과 164 step 의 tree length 를갖는 99 개의 strict consensus tree(ci=0.982, RI=0.984) 를도출하였다 (Fig. 3). MP tree 에서는향나무절이 93% 의 BP 로, 향나무 + 섬향나무분계조와눈향나무 + 단천향나무분계조는 100% 의 BP 로지지되었다. ML tree 에서는향나무절과향나무절내의두분계조모두 100% 의 BP 에의해지지되었다 (Fig. 2). 고 찰 향나무절식물의 DNA 분석을통한계통학적유연관계본연구의결과에서는향나무절이바늘형과비늘형의잎을모두가지고, 밑부분에마디가없으며, 꽃이잔가지에달리고, 실편이 3-8 장씩십자대생하거나돌려난다는공통형질을갖는단계통군이라는것을일부지지하고있다 (Fig. 2, 3). 하지만 Fig. 2 와 3 에서제시된바와같이 matk 와 psba-trnh region 의조합분석에서얻어지는결과는최근제시되고있는향나무절에대한분자계통학적연구와다소상이한결과를나타낸다 (Adams et al., 2002; Adams and Schwarzbach, 2012). Adams et al.,(2002) 은 RAPD 분석을 Fig. 2. ML tree based on the plastid DNA [matk+psba-trnh region] sequences from the section Sabina. Bootstrap value are presented on the branches(-ln L value : ). Fig. 3. Strict consensus tree based on the plastid DNA [matk+psba-trnh region] sequences from the section Sabina. Bootstrap value are presented on the branches.
6 56 Jeong-Ki Hong, Jong-Cheol Yang, Seung-Hwan Oh and You-Mi Lee Fig. 4. One of the MP tree (A) and strict consensus tree (B) based on the plastid DNA matk (A) and psba-trnh region (B) sequences from the section Sabina. Bootstrap value are presented on the branches. 통해향나무와눈향나무가근연관계로같은분계조를형성하고있으며, 이에비해섬향나무는다른분계조를이루는것으로보고하면서섬향나무를별개의종수준으로처리하였다. 그후 Adams and Schwarzbach (2012) 은향나무절식물의 nrdna 와 cpdna 분석을통해향나무와섬향나무, 눈향나무가같은분계조를형성하나섬향나무가눈향나무에비해향나무와더욱근연관계인것으로보고하였으며, 단천향나무는향나무, 섬향나무, 눈향나무와는다른분계조를이루는것으로보고하였다. 본연구결과에서는기존연구에서 (Adams and Schwarzbach, 2012) 향나무, 섬향나무와가깝게유집되었던눈향나무가향나무, 섬향나무와같은분계조를형성하지않고, 단천향나무와 100% 의 BP 에의해지지되며같은분계조를형성하였다는점이다 (Figs. 2, 3, 4). Adams and Schwarzbach (2012) 의연구와본연구의결과차이가 Adams and Schwarzbach (2012) 에서사용된향나무, 섬향나무, 눈향나무가일본에서수집되었고, 단천향나무가몽골에서수집되었다는지리적인요인인지, 사용된분자마커에서비롯된것인지는정확히알수없으나본연구의결과를보았을때눈향나무는향나무, 섬향나무와는뚜렷하게구분된다. 본연구에서계통수분석에이용된두유전자의분석결과는서로차이를보였다. matk 유전자를이용한결과에서는향나무절내의식물들간분계조가 psba-trnh region 에비하여다소잘형성된반면 psba-trnh region 에서는향나무절식물들과노간주나무절식물들이붕괴된 node 내 에위치하는결과를나타냈다 (Fig. 4). matk 유전자는 coding gene 이고, 향나무절내에서염기의 length variation 이뚜렷하게나타나는것을보아향나무절및향나무속의계통을규명하는데있어다소높은해상력을제공할수있을것으로생각된다. 반면 psba-trnh region 은 non-coding gene 이고, 6 bp 길이의 indel 이두개, 29 bp 길이의 indel 과 47 bp 길이의 indel 이각각하나씩관찰되었으나 indel 을제외한나머지염기에서큰차이를보이지않았다. 따라서향후이루어질연구에서는 matk 유전자를포함하여다른유전자를이용하는연구가수행되어야할것으로생각된다. 본연구결과향나무절이단계통군이라는기존의연구결과를일부지지할수있을것으로판단되고, matk 유전자가향나무절및향나무속의계통을규명함에있어서 psba-trnh region 에비하여다소높은해상력을제공할수있을것으로생각된다. 한국산향나무절은 (1) 향나무 + 섬향나무분계조 (2) 눈향나무 + 단천향나무분계조의두분계조로구분하는것이적합할것으로생각된다. 향나무절식물의지리적분포특성우리나라에분포하는향나무절은동아시아지역 ( 중국, 일본, 러시아, 몽골 ) 에한정되어분포하지만분류학적특성이명확하지않아정확한분포를파악하기는힘든상황이다. 예를들어 Ohwi (1965) 는일본 Kyushu 의해안가에섬향나무가분포하는것으로보고하였으나 Farjon (2005) 은 Ohwi (1965) 가해변노간주 (Juniperus conferta) 를섬향나
7 Molecular phylogenetic study of section Sabina (Genus Juniperus) in Korea based on chloroplast DNA mat K and psba-trn H sequences data 57 무로오동정한것으로판단하였고, 일본내섬향나무는 Okinawa 지역에한정되어분포하는것으로보고하였다. 또한우리나라향나무의분포에대하여 Chung (1943) 과 Uyeki (1926) 는울릉도를비롯하여북한의황해도지역에분포하는것으로보고하였으나지리적제한으로인해확인이어려운상황이다. 향나무의주요분포지는중국, 일본, 몽골, 한국으로중국은안후이성과관동성등의남동쪽과우리나라서해안에인접하는지역에주로분포하며, 일본은 Honshu 지역에분포하고 (Farjon, 2005), 우리나라는울릉도와동해안일대에분포한다. 향나무가중국과인접한우리나라서해안지역에는분포하지않고동해안지역에분포하는것은지리적으로특이한일이다. 본연구에서향나무와유전적으로유사한섬향나무가서남해안섬지역 ( 대흑산도등 ) 에분포하는것으로미루어볼때서해안지역에분포하던향나무가환경의변화에적응하여섬향나무로분화된것으로판단된다. Huh et al.(2000) 은우리나라향나무속노간주나무절 (sect. Juniperus) 의노간주나무 (J. rigida) 와해변노간주 (J. conferta) 의유전다양성연구를수행하였다. 분석결과서해안일대에제한적으로분포하는해변노간주는전국적으로널리분포하는노간주나무와비교하여유전적다양성이낮은것으로보고하였으며, 진화경향성에대하여유전다양성이높은노간주나무로부터유전다양성이낮은해변노간주가분화하였을것으로추측하고있다. 해변노간주와생육분포와형태적특성 ( 누워서자라는형질 ) 이유사한섬향나무도유전적근연관계인향나무로부터생육환경차이로인해분화되어진화되었을것으로판단된다. 눈향나무는중국흑룡강성지역과, 러시아극동지역, 일본 Honshu 지역에일부분포하며, 우리나라는백두대간을따라제주도한라산까지분포한다. 우리나라에서는지리적으로해발 1,500 m 이상의산지능선부에주로분포하며, 본연구결과북부지방에분포하는단천향나무와근연관계인것으로확인되었다 (Fig 2,3). 눈향나무가고산지역에제한되어분포하고, 북방계식물인단천향나무와근연관계인것으로볼때신생대빙하기에남하한개체군들이빙하기이후고산지역에제한적으로남아있게된것으로추측된다 (Chung et al., 2013a; Chung et al., 2013b). 본연구결과를통해그동안분류학적유연관계가불분명하였던우리나라향나무절분류군들에대해유전적근연관계를파악하였으며, 앞으로각분류군들에대한정확한진화경향성파악을위해서는집단별유전다양성분석등을통한세부조사가필요할것으로판단된다. 인용문헌 Adams, R. P Systematics of multi-seeded eastern hemisphere Juniperus based on leaf essential oils and RAPD DNA fingerprinting. Biochemical Systematics and Ecology 27: Adams, R. P., C.-F. Hsieh, J. Murata and R. N. Pandey Systematics of Juniperus from eastern Asia based on Random Amplified Polymorphic DNAs (RAPDs). Biochemical Systematics and Ecology 30: Adams, R. P. and A. E. Schwarzbach Taxonomy of the multi-seeded, entire leaf taxa of the Juniperus, section Sabina: sequence analysis of nrdna and four cp DNA regions. Phytologia 94: CBOL Plant Working Group A DNA barcode for land plants. PNAS 106: Chung, J. M., S. W. Son, S. Y. Kim, G. W. Park and S. S. Kim. 2013a. Genetic diversity and geographic differentiation in the endangered Primula farinosa subsp. modesta, a subalpine endemic to Korea. Korean Journal of Plant Taxonomy 43: Chung, M. Y., J. M. Chung, J. Lopez-Pujol, S. J. Park and M. G. Chung. 2013b. Genetic diversity in three species of Forythia(Oleaceae) endemic to Korea: Implications for population history. taxonomy and conservation. Biochemical Systematics and Ecology 47: Chung, T. H Illustrated manual of Korean trees and shrubs. Chosen Natural History Museum Society, Seoul, Korea. Pp Farjon, A A Monograph of Cupressaceae and Sciadopitys. Royal Botanic Gardens, Kew, Richmond, Surrey, UK. Pp Fu, L., Y. Yu. and A. Farjon Flora of China. Vol. 4. Science Press, Beijing, and Missouri Botanical Garden Press, St. Louis. Pp Huh, M. K. and H. W. Huh Genetic diversity and population structure of Juniperus rigida (Cupressaceae) and Juniperus coreana. Evolutionary Ecology 14: Kim, S. I Taxonomic studies of Genus Juniperus. Journal of Korean Forest Society 77: Kim, Y. D., H. S. Cho, and G. C. Choo A Palynotaxonomic Study of the Family Cupressaceae in Korea. Journal of Agricultural Technology Research Institute. Chinju National University 10: Korea National Arboretum and The Plant Taxonomic Society of Korea A Synonymic List of Vascular Plants in Korea. Korea National Arboretum. Pocheon. Pp. 26. (in Korean) Lee, T. B Illustrated flora of Korea. Hyangmoonsa. Seoul. Pp (in Korean) Little, D. P Evolution and circumscription of the true Cypresses (Cupressaceae: Cupressus). Systematic Botany 31: Mao, K., G. Hao, J. Liu, R. P. Adams and R. I. Milne Diversification and biogeography of Juniperus (Cupressaceae):
8 58 Jeong-Ki Hong, Jong-Cheol Yang, Seung-Hwan Oh and You-Mi Lee variable diversification rates and multiple intercontinental dispersals. New Phytologist 188: Ohwi J Flora of Japan. Washington, DC: Smithsonian Institution. Pp Park, W. J Study on Karyotype of Genus Juniperus. MS Thesis. Konkuk University. (in Korean) Shin, H. U The DNA barcoding study of Korean gymnosperms. MS Thesis. Korea University. (in Korean) Shin, J. G Population distribution, community ecology and genetic diversity of nature Juniperus chinensis forest in South Korea. PhD Thesis. Kongju University. (in Korean) Swofford, D. L PAUP*. Phylogenetic analysis using parsimony(* and other methods). Version 4.0b10. Sinauer Associates, Sunderland, Mass. Uyeki, H Corean timber trees vol.1. Ginkgoales and Coniferae. The Forestry Experiment Station, Government General of Chosen 4: (in Japanese)
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information<B8F1C2F72E666D>
Korean J. Pl. Taxon. 44(2): 111-118 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.2.111 ISSN 1225-8318 Korean Journal of Plant Taxonomy Molecular phylogenetic study of Pinus in Korea based on chloroplast
More information42(3) 표2-영문( ).fm
Korean J. Pl. Taxon. 43(1): 46-55 (2013) http://dx.doi.org/10.11110/kjpt.2013.43.1.46 ISSN 1225-8318 Korean Journal of Plant Taxonomy Taxonomic position of Taxus cuspidata var. latifolia endemic to Ulleung
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationMicrosoft Word - eco1201.doc
분지론의 과거, 현재, 미래 Past, present and future of the Cladistics 최 세 웅 목포대학교 환경교육학과 1. 서론 2. 본론 2-1. 과거 - 계통학의 역사 및 분지론의 탄생 2-2. 현재 - 분지론 2-3. 미래 및 결론 3. 참고문헌 1 1. 서론 우리나라에서는 매년 여름 비무장지대를 중심으로 말라리아가 말썽을
More information¼Ò³ª¹«Àç¼±-³»Áö1~41
KOREA FOREST RESEARCH INSTITUTE C o n t e n t s 3 5 8 11 13 25 31 43 61 67 69 74 78 Ⅰ 소나무재선충병 3 4 KOREA FOREST RESEARCH INSTITUTE 5 6 KOREA FOREST RESEARCH INSTITUTE 7 8 KOREA FOREST RESEARCH INSTITUTE
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationMicrosoft PowerPoint - Week1-basics
과목소개및주의사항 주교재식물분류학 계통적접근제 3판박기룡외 8인역도서출판신일사이언스 - Plant Systematics-A Phylogenetic Approach (3rd ed.) Judd et al., Sinauer ( 원서 ) 수업에관련된모든자료는다음웹사이트에게시됨 http://210.125.94.63/~apple/ 게시되어있는 ppt 자료들은항상수업전업데이트되니수업후다시다운받아공부할것.
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information<B9D9C0CCBFC0BBFDB8EDB0F8C7D02DB1E2C3CABBFDB9B0C1A4BAB8C7D DC3D6C1BE2D2D2D2D2D2D2D2D2D2D2D2D2D2D2E687770>
110 PRIME 산업연계교육활성화선도대학사업 그림 7.5. 계통수를뉴윅형식으로표현하기. 그림 7.6. 가지의길이또는절의통계적지지도를포함한계통수와이에대한기본적뉴윅형식. 그림 7.6 의계통수에서제시된기본적뉴윅형식에절의길이에대한정보 ( 붉은색숫자 ) 를추가하려면다음과같이나타낼수있다. (((A:1,B:1):1,C:2):2,(D:1,E:1):3) 또한부트스트랩값 (bootstrap
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park
이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationMicrosoft PowerPoint - Week13-Chap4-2.pptx
One of examples for comparing haracter-based Method and Distance-based Method 순서가있는형질에있어서의계통추론을위한두방법의비교참조 : Rordford et al. (1986) 의 Phenetics vs. Phylogenetics 에잘설명되어있음 ( 웹사이트에올려져있음 ) When the character
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationResearch subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The obje
Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The objectives of this study are analyzing research trends
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
More informationMicrosoft PowerPoint - Week13-Chap4-2.pptx
One of examples for comparing haracter-based Method and Distance-based Method 순서가있는형질에있어서의계통추론을위한두방법의비교참조 : Rordford et al. (1986) 의 Phenetics vs. Phylogenetics 에잘설명되어있음 ( 웹사이트에올려져있음 ) When the character
More information<30302E20B8F1C2F72E666D>
Korean J. Pl. Taxon. 44(3): 202-207 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.3.202 ISSN 1225-8318 Korean Journal of Plant Taxonomy Intraspecific variation and geographic study of Lonicera insularis
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연
越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그
More information<B1A4B0EDC8ABBAB8C7D0BAB8392D345F33C2F75F313032362E687770>
광고에 나타난 가족가치관의 변화 : 97년부터 26년까지의 텔레비전 광고 내용분석* 2) 정기현 한신대학교 광고홍보학과 교수 가족주의적 가치관을 사회통합의 핵심 중의 핵심으로 올려놓았던 전통이 현대사회에서 아직 영향력을 미치는 점을 감안할 때, 한국에서의 가족변동은 사회전반의 변동으로 직결된다고 해도 크게 틀리지 않을 것이다. 97년부터 26년까지 텔레비전에서
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information2014_........pdf
1, 1, 2, 1 (1, 2 ) Jin Suk Suh 1, Jong In Kim 1, Ryeong Jae Park 2, Sang Bum Park 1 (1 Korea Forest Research Institute, 2 Korea Traditional Dye Institute) Introduction (2011-2013), (VOCs)., (7 ),,. Materials
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information<C1A4BAB8B9FDC7D031362D335F3133303130322E687770>
권리범위확인심판에서는 법원이 진보성 판단을 할 수 없는가? Can a Court Test the Inventive Step in a Trial to Confirm the Scope of a Patent? 구대환(Koo, Dae-Hwan) * 41) 목 차 Ⅰ. 서론 Ⅱ. 전원합의체판결의 진보성 판단 관련 판시사항 1. 이 사건 특허발명 2. 피고 제품 3.
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationuntitled
11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information07_Àü¼ºÅÂ_0922
176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More information, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *
, 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: : * Research Subject
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.91-116 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.91 : * Research Subject Trend Analysis on Educational Innovation with Network
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information¨ë Áö¸®ÇÐȸÁö-¼Û°æ¾ðOK
Industrial and Innovation Networks of the Long-live Area of Honam Region* Sam Ock Park**Kyung Un Song***Eun Jin Jeong**** AbstractThe purpose of this paper is to analyze industrial and innovation networks
More informationMicrosoft Word - KSR2013A320
k ƒ! YWXZ º º t rzyywxzhzyw k ep k Dynamic Behavior of Bridge considering Various Light Weight Rail Vehicles Õ äø ÐãäÕò ãã Sang-Su Kim, Yong-ul Park *, Man-Cheol Kim ** Abstract The purpose of this paper
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More information2011ÄÁº¥³»Áö3
MICE CALENDAR 2011 to 2020 Contents 05-54 International Meetings & Conventions 2011 to 2020 55-84 2011 International Exhibitions 85-98 2011 International Events Appendix 101-109 Professional Convention
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information20(53?)_???_O2O(Online to Offline)??? ???? ??.hwp
O2O(Online to Offline)서비스 전략방향 연구 - 모바일 사용자 경험 디자인(UX Design)을 중심으로 - O2O(Online to Offline) Service Strategy Research -Focusing on Mobile UX Design- 주저자 김 형 모 Kim, Hyung-mo BK21플러스 다빈치 창의융합인재양성사업단 BK21Plus
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More information264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부
大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information<C7A5C1F620BEE7BDC4>
연세대학교 상경대학 경제연구소 Economic Research Institute Yonsei Universit 서울시 서대문구 연세로 50 50 Yonsei-ro, Seodaemun-gS gu, Seoul, Korea TEL: (+82-2) 2123-4065 FAX: (+82- -2) 364-9149 E-mail: yeri4065@yonsei.ac. kr http://yeri.yonsei.ac.kr/new
More information학습영역의 Taxonomy에 기초한 CD-ROM Title의 효과분석
,, Even the short history of the Web system, the techniques related to the Web system have b een developed rapidly. Yet, the quality of the Webbased application software has not improved. For this reason,
More information변화근 Fish Fauna of Mt. Juheul Department of Biology Education, Seowon University, Cheongju , Korea To clarify the structures and functions of ec
변화근 Fish Fauna of Mt. Juheul Department of Biology Education, Seowon University, Cheongju 361-742, Korea To clarify the structures and functions of ecosystem and to establish the methods for the conservation
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information07-1960(JH)
한국두피모발미용학회지 제5권 제1호 2009 The Journal of Beauty & Trichology 5(1), 00~00(2008) 1960년대 뷰티 및 패션트렌드 분석 - 모델 트위기 (Twiggy) 를 중심으로 - 김희선* 안양과학대학 뷰티디자인학부 Analysis of Beauty and Fashion trends in the 1960 s - Focusing
More informationDBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
More information12È«±â¼±¿Ü339~370
http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,
More information<352E20BAAFBCF6BCB1C5C320B1E2B9FDC0BB20C0CCBFEBC7D120C7D1B1B920C7C1B7CEBEDFB1B8C0C720B5E6C1A1B0FA20BDC7C1A120BCB3B8ED28313531323231292D2DB1E8C7F5C1D62E687770>
통계연구(2015), 제20권 제3호, 71-92 변수선택 기법을 이용한 한국 프로야구의 득점과 실점 설명 1) 김혁주 2) 김예형 3) 요약 한국 프로야구에서 팀들의 득점과 실점에 영향을 미치는 요인들을 규명하기 위한 연구를 하였 다. 2007년부터 2014년까지의 정규리그 전 경기 자료를 대상으로 분석하였다. 전방선택법, 후방 소거법, 단계별 회귀법, 선택법,
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI: * A Study on Good School
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.1 * A Study on Good School and School Evaluation Purpose: This study was to examine
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More information