Microsoft Word - 04-서계원

Transcription

1 Journal of Bacteriology and Virology Vol. 46, No. 3 p Original Article The Genetic Diversity of Norovirus from Children with Diarrhea in Gwangju Metropolitan City, Korea: Hye-Young Kee 1, Min Ji Kim 1, Sun Hee Kim 1, Dong-Ryong Ha 1, Eun Sun Kim 1, Hye Sook Jeong 2, Jae Keun Chung 1 and Kye Won Seo 1 * 1 Health and Environment Institute of Gwangju; 2 Korea Centers for Disease Control & Prevection, Gwangju, Korea In order to study the characteristics of norovirus in Gwangju metropolitan city, We examined norovirus in 13,931 fecal specimens collected through five years ( ) from children admitted with a chief complain of acute diarrhea. Among a total of norovirus (NoV) was most frequently detected (3,025 cases, 21.7%). Concerning the frequency of virus detected by month, NoV tended to break out frequently from October to March in the following year. NoV was detected most highly in 0~3 year infants. Through examinations on NoV genotypes, among 3,025 cases that turned out to be positive, the genotypes of 2,652 cases were determined with various results including 13 types of GI and 17 types of GII. The results of analysis on GI genotypes were as follows: GI-4 (21.9%), GI-2 (15.2%), and GI-6 (10.5%). GII genotypes were as follows: GII-4 (63.9%), GII-3 (18.9%), GII-8 (4.2%), GII-2 (3.9%), GII-6 (3.3%), and GII-1 (1.9%). Eight types of variants for GII-4 genotype (427 cases) were identified. The majority of the GII-4 variants was GII-4_Farmington (181 cases, 42.4%), which peaked in 2012, while GII-4_2008b (173 cases, 40.5%) showed a high prevalence in Concerning the circulation of variants, as many as eight types of GII-4 variants were identified in 2012, showing more varieties than in other years. Therefore, this study can be used as fundamental data for the development of vaccine candidate for the prevention of viral diarrheal diseases with high-incidence. Key Words: Norovirus, Genotype, GII-4, Gwangju metropolitan city INTRODUCTION 급성위장관염은주로어린아이들에발생하는일반적인기능장애질환으로, 특히후진국에서는병원입원횟수를증가시켜사망을유발하는것으로알려져있고, 주로저소득국가에서는매년 140만명이급성위장관염으로사망하는것으로보고되고있어 (1, 2), 사회경제적으로많은피해를초래하고있는실정이다. 노로바이러스는 Caliciviridae에속하는 27 nm 크기의 구형바이러스로써 7.5~7.7 kb의 single-stranded RNA 바이러스로 (3, 4), 5개의 genogroups (G) 으로분류되며이중 GI, GII, GIV는주로사람에서위장관염을일으키고, GIII 와 GV는소와쥐에서검출되는것으로알려져있다 (5). 이들 genogroups은적어도 32개이상의유전자형으로분류가되며, 특히 GII-4 유전자형은전세계적으로가장우세하게출현하는유전자형으로지난 20년동안노로바이러스감염증의 70~80% 가 GII-4 유전자형이원인으로밝혀졌다 (6~9). 전파경로는매우다양하여접촉감염, 분변-경구감염, 에 Received: March 16, 2016/ Revised: June 30, 2016/ Accepted: July 7, 2016 * Corresponding author: Kye Won Seo. Health and Environment Institute of Gwangju, 149 Hwajeong-ro, Seo-gu, Gwangju 61986, Korea. Phone: , Fax: , skin6690@korea.kr ** This research as a part of the laboratory investigations of acute diarrhea, managed by the National Institute of Health, Republic of Korea and supported by Health & Environment Institute of Gwangju Metropolitan city. CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( 142

2 The Genetic Diversity of Norovirus from Children with Diarrhea in Gwangju 143 어로졸, 오염된물과음식물을통해사람간의전파가가능하며, 바이러스의전염력이매우강하여 100개미만의적은개수로도감염이될수있다 (10). 임상증상으로는어린아이에서는설사보다구토가주로발생하고, 성인은설사가주증상인경우가많으며전연령층에서발생하는특징이있다. 지역적발생양상은전세계의모든지역에서발생하며, 계절적으로는가을부터이듬해봄철까지기온이낮은시기에주로유행하는것으로알려져있다 (11). 노로바이러스의주요발생은특히레스토랑, 요양시설, 학교, 유람선등과같은서로다른환경에서대규모의급성위장관염을일으키며 (10, 12~14), 최근연구에따르면급성위장관염으로병원에입원한청소년들에서노로바이러스가원인체인경우의비중이점점높아지고있음이밝혀지고있다 (15~17). 노로바이러스의진단은유전자증폭을이용한 Reverse Transcriptase Polymerase chain Reaction법이개발되어신속하고민감도가높아위장관염의집단발병등역학조사에널리사용되고있으며 (18, 19), 식중독관련검체인물, 해산물, 생굴같은식품에서도바이러스의검출이가능하게되어환경검체에서도원인바이러스를추적할수있게되었다 (20, 21). 대체적으로 RNA 바이러스는한번복제될때마다 10 4 개의 nucleotide 당 1개씩의돌연변이가발생하여지역적으로나국가간에유전자적다양성이발생하는것으로알려져있고 (22~24), 노로바이러스도 2~3년의주기를갖고변이주가계속적으로보고 (25, 26) 되고있어이에대한근절이어려우므로지속적인연구가필요하다. 따라서본연구에서는 2008년부터 2012년까지 5년간광주광역시소재협력병원에설사증상으로내원또는입원한환자중 20세이하의소아청소년을대상으로성별, 연령별발생양상등노로바이러스의발생현황을살펴보고, 노로바이러스의유전자형분포조사를통해대규모설사질환의집단발병시신속차단및확산방지등예방대책수립의기초자료로활용하고자한다. MATERIALS AND METHODS 실험재료및시료전처리방법 2008년부터 2012년까지광주광역시종합병 의원에급성설사를증상으로입원혹은내원한 20세이하의환자분변시료 13,931건에대하여노로바이러스를검사하였다. 병원에서채취된분변은환자인적사항등을적은참여동의서와함께 4 냉장을유지하여실험실로운반한즉시바이러스검출을실시하였다. 분변시료 1 g에 PBS (phosphate buffered saline 7.2, Sigma, St, Louis, MO, USA) 를사용하여 10배희석액을만든후, 4 에서 20분간 3,000 rpm으로원심분리하여상층액을시험에사용하였다. 바이러스 RNA 추출바이러스 RNA 추출은 viral nucleic acid prep kit (Green mate, Korea) 을사용하였다. 분변부유액 150 μl에 lysis & binding 용액 300 μl를넣고진탕하여섞어준후다시 magnetic bead를 20 μl 넣고진탕하여섞어준다. 상층액을제거한후 washing solution I, II, III를순서대로각각의용량에맞게넣어준후진탕하여세척한후상층액을완벽하게제거한다. Elution solution을 200 μl 넣고섞어준후상온에서 5분간, 60 에서 10분간정체시키고상층액을수거하여실험에사용하였다. 노로바이러스유전자검사추출한 RNA를국립보건연구원에서분양받은프라이머조건 (Table 1) 으로 1st one-step RT PCR Mix-GI/GII 20 μl에각각넣어잘섞어주고반응액이완전히섞이도록한후, PCR machine (9700 Thermal cycler, Appled Biosystems, USA) 을이용하여반응을실시하였다. PCR 조건은 47 /40분간역전사반응을실시하였고, 94 /15분간변성후, 94 /60초, 50 /60초, 72 /60초의과정을 35회실시하고, 72 에서 7분간반응시켰다. 그후 RNA tube (2nd PCR Mix-GI/GII) 에멸균증류수를 18 μl씩넣고 1차 one-step RT PCR 산물 (GI/ GII) 2 μl 씩을각각취하여완전히섞이도록하였다. 간단히원심분리를실시한후 PCR 반응을실시하였고, PCR 조건은 94 /3분간변성후, 94 /30초, 56 /30초, 72 /45 초의과정을 25회실시한후, 72 에서 7분간반응시켰다. PCR 산물 5 μl을 1.5% agarose gel (Gibco, USA) 에전기영동한후, EtBr로염색하여 ultra violet (UV) 하에서관찰하여특이적인크기의유전자산물을확인하였다. 유전자형분석 PCR 산물의정제노로바이러스양성검체중유전자형이확인된 2,652건을대상으로유전자형을분석하였다. 즉, 증폭된 PCR 산물은 2% agarose gel (Gibco, USA) 로전기영동하여확인하

3 144 H-Y Kee, et al. Table 1. RT-PCR primers for the detection of diarrheal patients in this study Virus Primers Sequences (5' 3') Target Size GI-FIM ATGGCCATGTTCCGITGGATG Norovirus (first) GI-RIM CCAACCCARCCATTRTACATYTG GII-G1M CCCTCGAGGGCGATCGCAATCT VP1 - GG-R1M CCRCCIGCATRICCRTTRTACAT Norovirus (semi-nested) GI-F1M CGGGCCCGAATTYGTAAATGATG 314 GI-R1M CCAACCCARCCATTRTACATYTG VP1 GII-F1M CACAATTGTGAATGAAGATGGCGTCGA 313 GII-R1M CCRCCIGCATRICCRTTRTACAT Table 2. Prevalence of norovirus infection detected from diarrheal patients in Gwangju metropolitan city during 5 years (2008~ 2012) Year 였고, DNA 절편을절단한후 gel purification kit (Bioneer, Korea) 를사용하여정제하였다. 절편을 1.5 ml 튜브에넣고 3배의젤용해용완충용액 (Buffer GB) 을첨가하고 50 에서젤을용해시킨뒤, spin column으로옮겨 4 에서 14,000 rpm으로 1시간원심분리한후세척용완충용액 750 μl을첨가하고 14,000 rpm에서 1분간원심분리하였다. 상층액을취해잔여세척용완충용액을제거하고 30~50 μl의증류수로 DNA를회수하여노로바이러스유전자형분포와계통유전학적분석실험에사용하였다. 염기서열분석 No. of cases No. of detected Detection rate (%) , , , , , Total 13,931 3, 염기서열분석을위하여각 PCR 산물을이용하여각각의 nested PCR에사용한프라이머를사용하여양쪽방향으로 big dye sequencing kit (Applied Biosystems) 을사용하여염기서열을결정하였고, big dye removal kit (Amer- sham Pharmacia Biotech., Little Chalfont, UK) 로정제한다음, automated DNA sequencer (Applied Biosystems, USA) 는 ABI PRISM Dye terminator (Applied Biosystems, USA) 를이용하여염기서열을분석하였다. 염기서열은 Lasergene (Copyrightc 1997 by DNASTAR, Inc., Madison, WI, USA) 의 MegAlign Program을사용한 phylogenetic analysis를통해서 prototype strain과비교하여유전자형을결정하였다. 통계분석기온이바이러스검출률에영향을미치는지를알아보기위해 SPSS 21.0 (Statistical package for the social sciences, USA) 을이용하여회귀분석을실시하였고, 다음과같은검증모형을설정하였다. NORORAT( 월별노로바이러스검출율 ) = α + β*temp + ε TEMP( 월별평균기온 ) RESULTS 노로바이러스의검출빈도 2008년 ~2012년까지 5년간광주광역시소재병 의원에입원또는내원한급성설사환자대변에서노로바이러스검사결과 21.7% (3,025/13,931) 의검출률을보였다. 연도별노로바이러스의검출률은, 2008년 21.1%, 2009년 14.5%, 2010년 27.6%, 2011년 22.0%, 2012년 25.0% 였다 (Table 2). 월별검출률은 10월에 19.8% 로바이러스검출률이증가하기시작하여 11월 46.6%, 12월 49.2% 로가장높게검출되었으며, 1월 36.7%, 2월 24.4%, 3월 22.2% 였으나, 4월에 16.2% 로감소하기시작하여 9월까지 10% 이하로낮

4 The Genetic Diversity of Norovirus from Children with Diarrhea in Gwangju 145 Figure 1. Seasonal distribution of norovirus infection from diarrheal patients in Gwangju metropolitan city during 5 years (2008~2012) Figure 2. Relationship between monthly distribution of norovirus from diarrheal patients and mean monthly temperature in Gwangju metropolitan city during 5 years (2008~2012) 게 검출되었다(Fig. 1). 이를 연도별로 살펴보면 2008년 (Fig. 2). 기온이 노로바이러스 검출률에 영향을 미치는지 10월~1월, 2009년 11월~2월, 2010년 10월~3월, 2011년 를 검증하는 회귀식의 설명력은 유의적으로 높게 나타났 11월~4월, 그리고 2012년에는 10월~1월까지가 평균 검출 으며(수정 R2, 0.575), 기온의 회귀계수도 유의적으로 나 률보다 높게 나타났으며, 기온과 바이러스 검출률과의 관 타났다(T 값 -8.99, p < 0.05). 따라서 기온이 낮을수록 노 계를 살펴본 결과, 광주광역시 월 평균기온은 매년 11월 로바이러스의 발생가능성이 높음을 알 수 있었다. 부터 10 이하로 낮아지기 시작하여 12월과 1월에 가장 연령별 검출률은 활동영역에 따른 연령대로 분류하였 낮은 기온을 보였고 매년 5 이하의 기온이 3달 정도 유 으며 분포는 0~3세 24.7% (2,543/10,290), 4~7세 14.9% 지되었으며, 노로바이러스가 가장 높은 검출률을 보인 시 (347/2,322), 8~13세 11.2% (126/1,124), 14~20세 4.6% (9/ 기인 12월의 평균기온은 0.4~4.1 의 기온분포를 보였다 195)를 보였다.

5 146 H-Y Kee, et al. 노로바이러스의유전자형 노로바이러스양성으로판정된 3,025건에서 genogroup I 85건 (2.8%), genogroup II 2,902건 (95.9%), genogroup I & II 혼합감염이 38건 (1.3%) 을차지하였다 (Table 3). 그중 2,652건 (87.7%) 에서유전자형이결정되었는데, 유전자형 Table 3. Proportion of norovirus genogroup GI and GII detected in Gwangju metropolitan city during 5 years (2008~2012) Genogroup GI GII GI & GII Year (4.3) 593 (94.7) 6 (1.0) 12 (2.6) 438 (96.3) 5 (1.1) 23 (2.9) 750 (95.6) 12 (1.5) 16 (2.6) 591 (95.5) 12 (1.9) 7 (1.3) 530 (98.1) 3 (0.6) Total 85 (2.8) 2,902 (95.9) 38 (1.3) Total ,025 분석결과 genogroup I 13종, genogroup II 17종으로 30종의유전자형이검출되어다양한유전자형의노로바이러스들이존재함을알수있었다. Genogroup I 유전자형분석결과 GI-4 23건 (21.9%), GI-2 16건 (15.2%), GI-6와 GI-1이 11건 (10.5%) 순으로검출되었으며, 연도별로는 2008년에 GI-4형이 15건 (46.9%), GI-5 형 4건 (12.5%) 으로가장높은분포를보였다. 2009년에는 GI- 3, GI-4, GI-7, GI-9 유전자형이모두 3건 (21.4%) 으로동일하게검출되었고, 2010년에는 GI-2 8건 (29.6%), GI-6 6건 (22.2%) 이검출되었다. 또한 2011년에는 GI-1, GI-3 유전자형이 4건 (16.7%), GI-2, GI-12 유전자형이 3건 (12.5%) 이었으며, 2012년에는 GI-4형이 3건 (37.5%) 으로가장많이검출되었다 (Table 4). Genogroup II 유전자형은 GII-4 1,628건 (63.9%), GII-3 482건 (18.9%), GII-8 106건 (4.2%), GII-2 100건 (3.9%), GII-6 85건 (3.3%), GII-1 48건 (1.9%) 순으로검출되었다. 연도별분포현황으로는매년 GII-4 유전자형이가장높게검출되었고, GII-4를제외한주요유전자형은 2008년 GII 건 (17.2%), GII-7 11건 (1.9%), 2009년 GII-8 61건 (16.3%), Year genotype Table 4. Annual genotypic distribution of norovirus GI in Gwangju metropolitan city during 5 years (2008~2012) No. of samples (%) GI-1 2 (6.3) 3 (11.1) 4 (16.7) 2 (25.0) 11 (10.5) GI-2 3 (9.4) 1 (7.1) 8 (29.6) 3 (12.5) 1 (12.5) 16 (15.2) GI-3 1 (3.1) 3 (21.4) 2 (7.4) 4 (16.7) 10 (9.5) GI-4 15 (46.9) 3 (21.4) 2 (8.3) 3 (37.5) 23 (21.9) GI-5 4 (12.5) 1 (3.7) 5 (4.8) GI-6 3 (9.4) 6 (22.2) 2 (8.3) 11 (10.5) GI-7 3 (21.4) 1 (3.7) 1 (4.2) 5 (4.8) GI-8 1 (4.2) 1 (1.0) GI-9 2 (6.3) 3 (21.4) 1 (3.7) 2 (8.3) 8 (7.6) GI-10 1 (3.7) 1 (1.7) GI-12 3 (11.1) 3 (12.5) 6 (5.7) GI-13 1 (12.5) 1 (1.0) GI-14 2 (6.3) 1 (7.1) 1 (3.7) 2 (8.3) 1 (12.5) 7 (6.7) Total Total

6 The Genetic Diversity of Norovirus from Children with Diarrhea in Gwangju 147 Year genotype Table 5. Annual genotypic distribution of norovirus GII in Gwangju metropolitan city during 5 years (2008~2012) No. of samples (%) GII-1 5 (1.3) 23 (3.6) 3 (0.7) 17 (3.4) 48 (1.9) GII-2 7 (1.2) 30 (8.0) 2 (0.3) 38 (8.4) 23 (4.6) 100 (3.9) GII (17.2) 21 (5.6) 140 (22.1) 93 (20.6) 127 (25.3) 482 (18.9) GII (77.6) 226 (60.4) 405 (64.0) 256 (56.8) 285 (56.9) 1,628 (63.9) GII-5 5 (1.1) 4 (0.8) 9 (0.4) GII-6 3 (0.5) 6 (1.6) 25 (3.9) 22 (4.9) 29 (5.8) 85 (3.3) GII-7 1 1(1.9) 17 (4.5) 10 (1.6) 3 (0.7) 2 (0.4) 43 (1.7) GII-8 3 (0.5) 61 (16.3) 19 (3.0) 21 (4.7) 2 (0.4) 106 (4.2) GII-9 1 (0.2) 1 (0.0) GII-10 1 (0.3) 1 (0.0) GII-11 1 (0.2) 8 (1.6) 9 (0.4) GII-12 2 (0.3) 4 (1.1) 5 (0.8) 2 (0.4) 2 (0.4) 15 (0.6) GII-13 1 (0.2) 1 (0.2) 1 (0.2) 3 (0.1) GII-15 1 (0.2) 1 (0.0) GII-16 2 (0.3) 3 (0.8) 1 (0.2) 4 (0.9) 2 (0.4) 12 (0.5) GII-17 1 (0.2) 2 (0.3) 3 (0.1) GII-18 1 (0.2) 1 (0.0) Total ,547 Total GII-2 30건 (8.0%), 2010년 GII-3 140건 (22.1%), GII-6 25건 (3.9%), 2011년 GII-3 93건 (20.6%), GII-2 38건 (8.4%), 2012년 GII-3 127건 (25.3%), GII-6 29건 (5.8%) 의순으로분포하였다 (Table 5). GII-4 유전자형의변이주는 8종 427건 (26.2%) 이확인되었으며가장많이검출된 GII-4 변이주는 GII-4_Farmington 으로 181건 (42.4%), GII-4_2008b 173건 (40.5%), GII-4_2006b 54건 (12.6%), GII-4_2006a 6건 (1.4%), GII-4_Bristol 과 GII-4_ Outlier 4건 (0.9%), GII-4_Hunter 3건 (0.7%), GII-4_Sakai 2건 (0.5%) 순으로나타났고, 변이주는 2009년과 2010년 2종이검출되었으나 2011년 6종으로다양해졌으며, 2012년에는 8종의변이주가검출되었다 (Table 6). DISCUSSION 본연구에서광주광역시의소아청소년설사환자를대상으로노로바이러스감염현황조사결과 21.7% (3,025/ 13,931) 의검출률을보였는데, 연도별로는 2008년 21.1%, 2009년 14.5% 로감소하였다가 2010년 27.6%, 2011 년 22.0% 그리고 2012년에는 25.0% 의검출률을보였다. 이는 2007년 ~2011년의서울지역 16.6% (27), 2006년 ~2013년의경기지역 12.0% (28) 보다는높은검출률을보였고, 2008년 ~ 2010년제주지역 30.7% (29) 보다는낮게나타났다. 다른연도에비해 2009년에노로바이러스검출률이낮은것은신종플루의전국적인유행으로손씻기의중요성이강화되어소화기바이러스감염증의발병률이낮아진때문으로생각된다 (30). 노로바이러스의월별검출률은 10월에

7 148 H-Y Kee, et al. Table 6. Change in relative frequencies of GII-4 variants in Gwangju metropolitan city during 5 years (2008~2012) No. of samples (%) Year Total GII ,628 GII-4 variant (%) 10 (4.4) 5 (1.2) 128 (50.0) 284 (99.7) 427 (26.2) GII-4_Bristol 4 (1.4) 4 (0.9) GII-4_Farmington 1 (10) 3 (2.3) 177 (62.3) 181 (42.4) GII-4_Hunter 1 (10) 1 (0.8) 1 (0.4) 3 (0.7) GII-4_Sakai 1 (0.8) 1 (0.4) 2 (0.5) GII-4_2006a 4 (3.1) 2 (0.7) 6 (1.4) GII-4_2006b 4 (3.1) 50 (17.6) 54 (12.6) GII-4_2008b 9 (90) 4 (90) 115 (89.8) 45 (15.8) 173 (40.5) GII-4_Outlier 4 (1.4) 4 (0.9) 19.8% 로증가하기시작하여, 11월 46.6% 로높아졌다가, 12월에 49.2% 로가장높게검출되었으며, 1월 36.7%, 2월 24.2%, 3월 22.2% 로감소하기시작하여, 4월에 16.2% 로큰폭으로감소하여 5월부터는 10% 미만의검출률을보였다. 이와같은결과는제주지역이 12월에 18.8% 로가장높았다는결과 (29) 와유사한반면, Lee 등 (31) 이 2004년 ~2007년까지서울지역에서조사한결과인 11월에 57.2% 로가장높았다는결과에비해 1달정도늦은경향을보였으나, Ham 등 (27) 은 2007년 ~2011 년의보고에서 1월에 35.6% 로가장높았음을보고하여노로바이러스는주로한겨울에유행한다는결과와동일하였다. 연도별로노로바이러스의검출률이높은시기로는 2008년에는 10월 ~1월, 2009년은 11월 ~2월, 2010년에는 10월 ~3월, 2011년 11월 ~4월까지였고, 2012년에는 10월 ~1월까지높은검출률을보여노로바이러스유행은주로 10월 ~3월까지인것으로나타났다. 연령별검출빈도는 0~3세에서 24.7% 로가장높은검출률을보여서울지역 (31) 의연구결과와동일한결과를보였으며, 어린이집이나유치원에다니는시기인 4~7세에서도 14.9% 의검출률을보여노로바이러스감염에대한주의가필요하다고판단되었다. 노로바이러스가영 유아에서높은검출률을보이는경우가특히많았는데이는선천적면역이낮고질병발생시병원출입이빈번한것과도연관성이있을것으로보고 (32) 된경우가있어감염예방을위해홍보실시등적극적인노력을기울여야 한다. 노로바이러스유전자형조사결과 genogroup I 85건 (2.8%), genogroup II 2,902건 (95.9%), genogroup I & II 혼합감염 38건 (1.3%) 으로 genogroup II가대부분을차지하였다. 이는 1999년 ~2004년일본 (33), 1999년 ~2005년중국 (34), 2000년 ~2004년미국 (35), 2010년중국 (36) 의경우와동일하였고, 국내다른지역의발생현황인 2008년 ~2010년부산지역 (37), 제주지역 (29) 과 2005년 ~2007년의인천지역 (38) 등의결과와도유사하였다. 유전자형분석결과 genogroup I은 GI %, GI %, GI-6와 GI % 였고, genogroup II는 GII-4 유전자형이 63.9% 로가장높은분포를보였고다음은 GII-3 유전자형이 18.9% 로광주광역시에서가장우세하게나타난주요유전자형임을알수있었다. 또한검출된유전자형은 30종으로 2008년 ~2011 년제주지역 (29) 에서보고된유전자형 21종과비교하여다양한유전자형이존재하였고, 유전자형의다양성이증가추세에있음을보고하여이에대한지속적인연구가수행되어야할것으로생각되었다. 연도별분포는매년 GII-4 유전자형이가장높게검출되었고, GII-4를제외한주요유전자형은 2008년 GII %, GII-7 1.9%, 2009년 GII %, GII-2 8.0%, 2010년 GII %, GII-6 3.9%, 2011년 GII %, GII-2 8.4%, 2012년 GII %, GII-6 5.8% 의순으로분포하였다. 즉, 주요유전자형인 GII-4를제외한주요유전자형은 2009년에 GII-8 유전자형이 16.3% 인것을제외하고매년 GII_3

8 The Genetic Diversity of Norovirus from Children with Diarrhea in Gwangju 149 유전자형이 17~21% 의분포를보여 GII_4 유전자형다음으로많이분포함을확인하였다. 또한기타유전자형으로 GII-2와 GII-6 유전자형이 10% 미만으로분포하였고, 나머지유전자형들은낮은수준으로검출되었다. 이와같은결과는국내보고 (37~39) 뿐만아니라세계여러나라에서도유행하는주요유전자형이 GII-4형이라는보고와일치하였다 (34, 40~43). 그리고 2010년중국 Chongqing 지역의연구 (36) 에서는 GII %, GII %, GII-2 9.1%, GII-3 9.1%, GII-7 4.6% 의분포결과와 2011년 ~2012년의중국 (44) 에서도주요유전자형이 GII %, GII %, GII-6 5.0% 의결과를보여본연구와일치하였다. 또한 GII-4 유전자형이외에많은분포를보인유전자형으로는부산지역 (37) 은 2008년 GII %, 2009 년 GII-8 4.8%, 2010년 GII % 형이었고, 서울지역 (39) 은 2004년 GII %, 2005년 GII %, 2006년 GII-2 1.3%, 2007년 GII-3 1.7% 가검출됨을보고하여본연구결과와유사하였다. 세계적발생현황조사결과 GII-4 유전자형이월등히유행양상을보이는기전에대해서 GII-4 유전자형의빠른진화속도, 재조합등의방법을통해집단면역을피할수있는새로운변이주가만들어지는데유리하다는점등이보고된바있다 (45, 46). GII-4 유전자형은노로바이러스의집단발병과산발적발생에관여하는것으로알려져있으며, 급성위장관염의발생에 GII-4 변이주가주요원인으로작용하고있음을보고하였다. 본연구에서 GII-4 변이주는연도별로건수와변이주의종류가점차증가하는양상을보였는데, 이는 2006년 ~2013년경기지역 (28) 과비교하여 GII-4 변이주 5종 461건보다변이주의종류가다양한것을확인하였다. 또한경기지역의주요변이주는 GII-4_2006b 67.5%, GII-4_ %, GII-4_ %, GII-4_ %, GII-4_2006a 1.3% 이었으며, 시기적으로도 GII-4_2006b 변이주가 2007년 ~2009년에가장많이검출되었다고보고하여본연구에서확인된주요변이주와상이한결과를보였다. 또한베트남 (47) 의연구결과 2009년 5월 ~11월까지는 GII-4_2006b 변이주가유행하였고, 2009년 12월부터는 GII-4_2010 변이주가출현하였으며, GII-4_2006b 변이주의분포가감소하였다고보고하였으나, 본연구에서는 GII-4_2006b 변이주가 2011년에검출되기시작하여 2012년에 17.6% 로크게증가한양상을보여유행시기가차이가있음을확인하였다. 따라서 GII-4 변이주출현양상이다른지역과상이하므로지속적인연구를통하여 GII-4 변이주의변화양상을확인함으로써노로이러스에의한집단발병을예방할수있을것으로생각한다. 이상과같이광주광역시설사환자를대상으로노로바이러스유전자형에대한조사결과세계적으로유행하고있는 GII-4 유전자형이가장우세하게유행하였으며, GII-4_Farmington 변이주 (48) 를비롯한여러변이주들이유행함을확인하였다. 그러나본연구에서는최신변이주로보고되고있는 GII-4_Sydney 변이주 (46, 49, 50) 에대한조사가시행되지못한것이미흡한점으로생각되며향후추가적인연구를통하여보완해야할것으로생각된다. 또한인플루엔자바이러스와유사하게노로바이러스는유전자재조합에의한새로운유전자형이출현할경우학교와병원등집단생활을하는곳에서폭발적유행을보일가능성도고려해야한다. 따라서이상의연구결과를통해새롭게출현하는노로바이러스유전자형과변이주에대한신속한규명과차단이기대되며더나아가백신개발을위한자료로활용할수있을것으로생각된다. REFERENCES 1) Black RE, Cousens S, Johnson HL, Lawn JE, Rudan I, Bassani DG, et al. Global, regional, and national causes of child mortality in 2008: a systematic analysis. Lancet 2010; 375: ) Wardlaw T, Salama P, Brocklehurst C, Chopra M, Mason E. Diarrhoea: why children are still dying and what can be done. Lancet 2010;375: ) Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, et al. Taxonomy of the Caliciviruses. J Infect Dis 2000;181: ) Koopmans M. Food-borne norovirus outbreaks:a nuisance or more than that?. Wien Klin Wochenschr, 2005;117: ) Vinje J, Hamidjaja RA, Sobsey MD. Development and application of a capsid VP1 (region D) based reverse transcription PCR assay for genotyping of genogroup I and II noroviruses. J Virol Methods 2004;116: ) Green KY. Caliciviridae: the noroviruses. In: Knipe DM, Howley PM, editors. Fields Virology. Philadelphia: Lippincott Williams & Wilkins; pp ) Siebenga JJ, Vennema H, Zheng DP, Vinjé J, Lee BE, Pang XL, et al. Norovirus illness is a global problem: emergence

9 150 H-Y Kee, et al. and spread of Norovirus GII.4 Variants, J Infect Dis 2009;200: ) Donaldson EF, Lindesmith LC, Lobue AD, Baric RS. Viral shape-shifting: norovirus evasion of the human immune system. Nat Rev Microbiol 2010;8: ) Zheng DP, Widdowson MA, Glass RI, Vinjé J. Molecular epidemiology of genogroup II-genotype 4 noroviruses in the United States between 1994 and J Clin Microbiol 2010;48: ) Karst SM. Pathogenesis of noroviruses, emerging RNA viruses. Viruses 2010;2: ) Marshall JA, Hellard ME, Sinclair MI, Fairley CK, Cox BJ, Catton MG, et al. Incidence and characteristics of endemic Norwalk-like virus-associated gastroenteritis. J Med Virol 2003;69: ) Blanton LH, Adams SM, Beard RS, Wei G, Bulens SN, Widdowson MA, et al. Molecular and epidemiologic trends of caliciviruses associated with outbreaks of acute gastroenteritis in the United States, J Infect Dis 2006; 193: ) Svraka S, Duizer E, Vennema H, de Bruin E, van der Veer B, Dorresteijn B, et al. Etiological role of viruses in outbreaks of acute gastroenteritis in the Netherlands from 1994 through J Clin Microbiol 2007;45: ) Bruggink L, Sameer R, Marshall J. Molecular and epidemiological characteristics of norovirus associated with community-based sporadic gastroenteritis incidents and norovirus outbreaks in Victoria, Australia, Intervirology 2010;53: ) Gonzalez-Galan V, Sánchez-Fauqier A, Obando I, Montero V, Fernandez M, Torres MJ, et al. High prevalence of community-acquired norovirus gastroenteritis among hospitalized children: a prospective study. Clin Microbiol Infect 2011;17: ) Lopman BA, Hall AJ, Curns AT, Parashar UD. Increasing rates of gastroenteritis hospital discharges in US adults and the contribution of norovirus, Clin Infect Dis 2011;52: ) Wiegering V, Kaiser J, Tappe D, Weissbrich B, Morbach H, Girschick HJ. Gastroenteritis in childhood: a retrospective study of 650 hospitalized pediatric patients. Int J Infect Dis 2011;15: ) De Leon R, Matsui SM, Baric RS, Herrmann JE, Blacklow NR, Greenberg HB, et al. Detection of Norwalk virus in stool specimens by reverse transcriptase-polymerase chain reaction and nonradioactive oligoprobes. Clin Microbiol 1992;30: ) Burton-MacLeod JA, Kane EM, Beard RS, Hadley LA, Glass RI, Ando T. Evaluation and comparison of two commercial enzyme linked immunosorbent assay kits for detection of antigenically diverse human noroviruses in stool samples. J Clin Microbiol 2004;42: ) Schwab KJ, Neill FH, Le Guyader F, Estes MK. Atmar RL. Development of a reverse transcription-pcr-dna enzyme immunoassay for detection of Norwalk-like viruses and hepatitis A virus in stool and shellfish. Appl Environ Microbiol 2001;67: ) Yoda T, Suzuki Y, Terano Y, Yamazaki K, Sakon N, Kuzuguchi T, et al. Precise characterization of norovirus (Norwalk-like virus)-specific monoclonal antibodies with broad reactivity. J Clin Microbiol 2003;41: ) Nilsson M, Hedlund KO, Thorhagen M, Larson G, Johansen K, Ekspong A, et al. Evolution of human calicivirus RNA in vivo: accumulation of mutations in the protruding P2 domain of the capsid leads to structural changes and possibly a new phenotype. J Virol 2003;77: ) Gallimore CI, Green J, Lewis D, Richards AF, Lopman BA, Hale AD, et al. Diversity of noroviruses cocirculating in the north of England from 1998 to J Clin Microbiol 2004;42: ) Dingle KE. Mutation in a Lordsdale norovirus epidemic strain as a potential indicator of transmission routes. J Clin Microbiol 2004;42: ) Siebenga JJ, Vennema H, Zheng DP, Vinjé J, Lee BE, Pang XL, et al. Norovirus illness is a global problem: emergence and spread of norovirus GII.4 variants, J Infect Dis 2009;200: ) Zheng DP, Widdowson MA, Glass RI, Vinjé J. Molecular epidemiology of genogroup II-genotype 4 noroviruses in the United States between 1994 and J Clin Microbiol 2010;48: ) Ham HJ, Oh SA, Kim CK, Jang JI, Jo SJ, Choi SM. Molecular Characteristics of Human Noroviruses Genogroup I and Genogroup II Detected in Acute Gastroenteritis Patients in Seoul. J Environ Health Sci 2012;38: ) Cho HG, Lee SG, Kim JE, Yu KS, Lee DY, Park PH, et al. Molecular Epidemiology of norovirus GII.4 variants in children under 5 years with sporadic acute gastroenteritis

10 The Genetic Diversity of Norovirus from Children with Diarrhea in Gwangju 151 in South Korea during J Clin Virol 2014;61: ) Kim YJ, Lee MG, Kam SK. Characteristics of norovirus occurrence in Jeju. J of Environ Sci Inter 2014;23: ) Curtis V, Cairncross S. Effect of washing hands with soap on diarrhoea risk in the community: A systematic review. Lancet Infect Dis 2003;3: ) Lee JI, Park SH, Kim MS, Oh YH, Yu IS, Choi BH, et al. Surveillance of acute gastroenteritis in Seoul, Korea, During May 2004 and June J Bacteriol Virol 2009;39: ) Vantarakis A, Mellou K, Spala G, Kokkinos P, Alamanos Y. A gastroenteritis outbreak caused by noroviruses in Greece. Int J Environ Res Public Health 2011;8: ) Okada M, Ogawa T, Kaiho I, Shinozaki K. Genetic analysis of noroviruses in Chiba Prefecture, Japan, between 1999 and J Clin Microbiol 2005;43: ) Fang ZY, Xie HP, Lv HX, Zhang Q, Duan ZJ, Steele D, et al. Investigation of human calicivirus (HuCV) diarrhea among infantile and young children in China, 1999~2005. Bing Du Xue Bao 2007;23: ) Blanton LH, Adams SM, Beard RS, Wei G, Bulens SN, Widdowson MA, et al. Molecular and epidemiologic trends of caliciviruses associated with outbreaks of acute gastroenteritis in the United States, J Infet Dis 2006; 193: ) Ren Z, kong Y, Wang J, Wang Q, Huang A, Xu H. Etiological study of enteric viruses and the genetic diversity of norovirus, sapovirus, adenovirus and astrovirus in children with diarrhea in Chongqing, China. BMC Infect Dis 2013; 13: ) Kim NH, Park EH, Park YK, Min SK, Jin SH, Park SH. Study on norovirus genotypes in Busan, Korea. J life Sci 2011;21: ) Gong YW, Oh BY, Kim HY, Lee MY, Kim YH, Go JM, et al. Molecular epidemiologic investigation of norovirus infections in Incheon city, Korea, from 2005 to J Bacteriol Virol 2008;38: ) Kim EJ, Park SH, Song MO, Kim MS, Kim MS, Kim MY, et al. Genetic distribution of human noroviruses detected from acute gastroenteritis patients in Seoul. Kor J Microbiol 2008;44: ) Hansman GS, Doan LT, Kguyen TA, Okitsu S, Katayama K, Ogawa S, et al. Detection of norovirus and sapovirus infection among children with gastroenteritis in Ho Chi Minh City, Vietnam. Arch Virol 2004;149: ) Hansman GS, Katayama K, Maneekarn N, Peerakome S, Khamrin P, Tonusin S, et al. Genetic diversity of norovirus and sapovirus in hospitalized infants with sporadic cases of acute gastroenteritis in Chiang Mai, Thailand. J Clin Microbiol 2004;42: ) Wu FT, Oka T, Katayama K, Wu HS, Donald Jiang DS, Miyamura T, et al. Genetic diversity of noroviruses in Taiwan between November 2004 March Arch Virol 2006;151: ) Dey SK, Nguyen TA, Phan TG, Nishio O, Salim AF, Rahman M, et al. Molecular and epidemiological trend of norovirus associated gastroenteritis in Dhaka Ciry, Bangladesh. J Clin Virol 2007;40: ) Sai L, Sun J, Shao L, Chen S, Liu H, Ma L. Epidemiology and clinical features of rotavirus and norovirus infection among children in Ji'nan, China. Virol J 2013;10: ) Patel MM, Hall AJ, Vinjé J, Parashar UD. Noroviruses: a comprehensive review. J Clin Virol 2009;44: ) van Beek J, Ambert-balay K, Botteldoorn N, Eden JS, Fonager J, Hewitt J, et al. Indications for worldwide increased norovius activity associated with emergence of a new variant of genotype II.4, late Euro Surveill 2013; 18: ) Tra My PV, Lam HM, Thompson CN, Phuc HL, Tuyet PT, Vinh H, et al. The dynamics of GII. 4 Norovirus in Ho Chi Mihn City, Vietnam. Infect Genet Evol 2013;18: ) Widdowson MA, Cramer EH, Hadley L, Bresee JS, Beard RS, Bulens SN, et al. Outbreaks of acute gastroenteritis on cruise ships and on land: identification of a predominant circulating strain of norovirus United States, J Infect Dis 2004;190: ) Bennett S, MacLean A, Miller RS, Aitken C, Gunson RN. Increased norovirus activity in Scotland in 2012 is associated with the emergence of a new norovirus GII.4 variant. Euro Surveill 2013;18. 50) Fonager J, Hindbaek LS, Fischer TK. Rapid emergence and antigenic diversification of the norovirus 2012 Sydney variant in Denmark, October to December, Euro Surveill 2013;18.