hwp

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "hwp"

Transcription

1 일반담배 (Cigarette) 와금연보조담배 ( 금연초, 허브담배, 쑥담배 ) 의기관지상피세포에서 IL-6 유리효과비교 서울위생병원내과 1, 원광대학교의과대학내과학교실. 원광대학교의과대학산본병원 2 김명찬 1, 정재일 1, 정종훈, 김학렬, 양세훈, 정은택, 김휘정 2 The Comparison of the Effect of Cigarette and Stop Smoking-aiding Cigarette on Release of IL-6 from Bronchial Epithelial Cell Myoung Chan Kim, M.D. 1, Jeil Jung, M.D. M.D. 1, Jong Hoon Jung, M.D., Hak Ryul Kim, M.D., Sei Hoon Yang, M.D., Eun Taik Jeong, M.D., and Hui Jung Kim, M.D 2. Department of Internal Medicine, Seoul Adventist Hospital 1, and WonKwang University, School of Medicine, Sanbon Medical center, KunPo Korea 2 Background and Aims : Cigarette smoking induces an inflammatory response in the airways, which may play a key role in the pathogenesis of chronic obstructive pulmonary disease. Interleukin-6 (IL-6) is one of the cytokines that plays an important role in inducing bronchial inflammation. The aim of this study was to determine if the level of the pro-inflammatory cytokine, Interleukin-6, is increased when the bronchial epithelial cells are exposed to a cigarette smoke extract (CSE) and an extract from stop smoking-aiding cigarettes, and examined the safety of these commercially available stop smoking-aiding cigarettes. Method : Bronchial epithelial cells were exposed to CSE from cigarette and stop smoking-aiding cigarettes for 24 hours. ELISA was used to measure the IL-6 levels in the supernatant from each condition. The IL-6 mrna levels were measured by Taqman Real time RT-PCR. N acetyl L-cysteine(NAC) was added to each condition to determine if NAC can inhibit the release of IL-6 from the bronchial epithelial cells when they are exposed to CSE from cigarette and stop smoking-aiding cigarettes. Result : When bronchial epithelial cells were exposed to a CSE from cigarettes and stop smoking- aiding cigarettes, each type of CSE stimulated IL-6 production from the bronchial epithelial cells. The IL-6 mrna level in the Bronchial epithelial cells was also elevated and NAC was found to inhibit the release of IL-6 from bronchial epithelial cells when they were exposed to the CSE from cigarettes and stop smoking-aiding cigarettes. Conclusion : Commercially available stop smoking-aiding cigarette can induce bronchial inflammation and can be harmful to smokers. Therefore, the safety of these cigarettes for smoking cessation should be evaluated. (Tuberc Respir Dis 2005; 59: ) Key words : Cigarette, stop smoking-aiding cigarette, IL-6 서 담배연기에는 6000종이상의다양한화학물질이있고흡연하는경우이런다양한화학물의영향으로여러종류의폐질환을유발한다. 본연구는 2005년도원광대학교연구비지원에의하여시행되었습니다. Address for correspondence : Hui Jung Kim, M.D. Division of Pulmonary Medicine, Department of internal medicine, Wonkwang University Sanbon Medical Center, Sanbon-dong,Gunpo-city, Kyunggi-do Phone : Fax : hikim61@hotmail.com Received : Oct Accepted : Oct 론 흡연은기도에서염증반응을유발하여만성폐쇄성폐질환 (chronic obstructive pulmonary disease) 의병태생리에중요한역할을한다고알려져있다. 현재까지여러보고에서흡연이기관지상피세포의염증과연관된싸이토카인인 IL-6를유리하게한다고알려져있고, 정상흡연자에서기관지폐포세척액 (bron choalveolar lavage fluid) 에서 IL-6가증가되어있다고알려져있다 1-3. 또한만성폐쇄성폐질환환자의기관지폐포세척액검사상 IL-8, TNF-α와더불어 IL-6도증가되어있고이를환자의폐활량값과비교시 FEV 1 값과반비례한다고알려져있어흡연자에서 IL-6가증가되어있는것이만성폐쇄성폐질환의병태생리에중요 530

2 Tuberculosis and Respiratory Diseases Vol. 59. No. 5, Nov 한역할을한다고알려져있다 4. 우리나라는과거보다는흡연율이감소되고있는추세지만, 다른나라에비해서여전히높은흡연율을보이고있으며이런지속적인높은흡연율로인해향후흡연관련질환이지속적으로증가하리라예상되어진다. 흡연으로인한폐질환및기타여러질병을예방하기위해서는무엇보다도금연이가장중요한데금연하기위한방법은스스로본인의의지로금연하는방법, 금연교육에참여하여금연하는방법, 흡연대용품을이용해서흡연의오랜습관을점점줄여끊는방법, 니코틴대체요법으로니코틴중독으로인한금단증상을이겨내금연에성공하는방법등이있다. 우리나라에서는다른나라에비해한약제등을이용해만든흡연대용품으로금연을시도하려는흡연자들도많아여러다양한제품들이시중에판매되고있지만, 이들의기관지, 폐에대한안정성에관한연구는아직부족한실정이다. 특히흡연자중일부는금연보조담배를사용하는과정에서이들을상용하게되어금연보조담배의장기적사용시인체의안정성여부에대한연구는중요하리라사료된다. 이에저자등은국내에서시판되는 3가지종류의금연보조담배 ( 금연초, 허브담배, 쑥담배 ) 의기관지염증에관한효과를알아보기위해이들금연보조담배와일반담배의추출물을기관지상피세포에노출시킨후이들세포에서 IL-6의유리정도를비교하여연구하였다. 2. 담배연기추출물 (Cigarette smoke extract, CSE) 담배연기추출물 (Cigarette smoke extract, 이하 CSE) 은 Carp와Janoff 6 의방법으로만들었다. 100 mm길이의 filter가없는연구용담배를 (Research Grade Ciga rette, University of Kentucky) Speed Pump (Fisher Scientific, Pittsburgh, PA) 를통해연소시키면서담배연기를분당 50cc의속도로 25 ml의두번증류한증류수 (ddh 2 O) 에통과시킨뒤 0.22 μm pore filter (Lida Manufacturing Corp., Kenosha, WI) 에통과시켜세균과큰입자를제거하였다. 본실험에서는이용액을 100% CSE 로간주하여 LHC-D/RPMI 1640 medium 과혼합하여원하는농도를만들어사용하였다. CSE는매번실험마다새로만들어사용하였고만든후 30 분이내에사용하였다. 3. Material 본연구에사용된금연보조담배는금연초, 쑥담배, 허브담배 3종을선택해비교하였다. 금연초는두충잎을원료로하였고, 쑥담배는쑥을원료로, 허브담배는말린인동초꽃잎을사용하였고필터부위는허브를추가하여만들었다. 항산화제로사용된 NAC(N-Acetyl-L-Cysteine) 는 Sigma에서구입하였다. 4. ELISA 방법 1. 세포배양기관지상피세포 (human bronchial epithelial cell, HBEC) 는건강한공여자에의해제공된세포를 Kelsen 등의방법으로 5 LHC-9 과 RPMI 1640 을혼합한배양액에서배양하여사용하였고, 또기관지상피세포세포주인 BEAS-2B(American Type Culture Collec tion,crl-9609; Rockville, MD). 세포를함께사용하였다. 세포배양액의 IL-6 농도는 sandwich ELISA를통해서정량화하였다. 200 ml well microtiter plate를 purified goat antihil-6 antibody (R&D, Minneapolis, MN)) 로 coat한뒤 4 C에서 24 시간동안배양후 3 번 PBS 0.25% Tween-20 (washing solution) 으로세척후 ril-6 (Sigma, St. Louis) 를이용해상온에서 90분처리후다시세척하고,rabbit anti-hil-6 antibody (Calbiochem, La Jolla, CA) 를처리한다. 한시간후에 human serum absorbed peroxidase conjugated goat anti-rabbit antibody (ICN Biomedical, Costa Mesa, CA) 를첨가 531

3 MC Kim et al. : The Comparison of the Effect of Cigarette and Stop Smoking-aiding Cigarette and Stop Smoking-aiding Cigarette on Release of IL-6 from Bronchial Epithelial Cell 하고, 한시간후에세척한뒤 orthophenyldiamine (Sigma, St. Louis) 을이용해 490 nm ELISA reader 로정량화하였다. 5. Qantititive real-time PCR 기관지상피세포에서일반담배및금연보조담배의추출물에의한 IL-6 mrna 의증가여부를관찰하기위해 24시간동안각각의담배추출물에노출후기관지상피세포에서 Taq real time PCR로 IL-6 mrna 를정량화하였다. 사용한 IL-6 primer 와 probe의염기서열은다음과같다. Human IL-6 primers Name : IL F Sequence : CTCCAGGAGCCCAGCTATGA Name : IL R Sequence : CCCAGGGAGAAGGCAACTG TaqMan probe : Name : IL-6--68T Sequence : CTCCTTCTCCACAAGCGCCTTCGGT 6. 실험방법 담배와금연보조담배의추출물 (CSE) 을배양액에추가하여 24시간배양후상층액을모아각각의조건에서 IL-6의농도를 ELISA를이용하여정량화하고, 처리된세포를이용해 qantititive real time PCR을시행해 IL-6 m RNA를정량화하였다. 한편 NAC(N- Acetyl-L-Cysteine) 의항산화효과에의한 IL-6의억제효과를보기위해 10mM의 NAC를함께처리후 IL-6의농도를보았다. Acrolein 과 Acetaldehyde는알려진담배의주요한유해성분으로함께처리하여비교해보았다. 7. 통계처리모든값은 3번이상의실험결과로평균 ±SEM 으로구했고, 양군간의차이는 Student s t test를이용했다. P < 0.05를통계적으로의미있는차이로보았다. 결과 1. HBEC 에관한일반담배, 허브담배및쑥담배의 IL-6 유리효과비교 24 well plate에기관지상피세포를 1X 10 5 /ml 의농도로 LHC-D/RPMI로배양후정해진농도의일반 기관지상피세포 (Human bronchial epithelial cell, HBEC) 에연구용일반담배및허브담배, 쑥담배의 Figure 1. IL-6(pg/ml) Production by HBEC with varying concentrations of CSE and component of CSE. CSE 5% : 일반담배 5%, Herb : 허브담배, AA-acrolein, ACR-acetaldehyde. *p<0.05 compared with control 532

4 Tuberculosis and Respiratory Diseases Vol. 59. No. 5, Nov 추출물을배양액에혼합하여농도별로 24 시간동안노출후배양액을이용해 ELISA 방법으로 IL-6농도를구했다. 본연구에서사용한일반담배, 허브담배 (Herb) 및쑥담배모두대조군에비해의미있는 IL-6의증가를보였고, 두종류의금연보조담배에서도농도에따라의미있는 IL-6값의차이를보였다. 일반담배, 허브담배및쑥담배에서각기 5% 농도의담배추출물로 IL-6 유리정도를비교시쑥담배에서의미있게가장높았고허브담배는일반담배보다의미있게적은정도의 IL-6 유리를보였다 (Fig. 1.). 담배의알려진유해물질인 Acroleine 과 Acetaldehyde 를배양액에함께넣어배양시 acroleine 5mM은대조군에비해의미있는 IL-6의증가를보였으나 acet aldehyde 5uM은차이가없었다. 2. HBEC 에대한일반담배및금연보조담배의 IL-6 m RNA 발현담배및금연보조담배의기관지상피세포에서 IL- 6 mrna를비교해보았다. 대조군에비해서담배및금연보조담배에서모두의미있는 IL-6 m RNA유리를보였고특히쑥담배의경우많은증가를보여다른종류의담배보다 IL-6 값의의미있는증가를보였던 ELISA결과와부합되었다 (Fig. 2.). 3. 담배및금연보조담배의기관지상피세포 (BEAS- 2B) 에서 IL-6 유리에대한 NAC (N-Acetyl-L- Cysteine) 의효과기관지상피세포종인 BEAS-2B 세포에서담배및금연보조담배추출물노출에의한 IL-6 유리효과를다시측정했고, NAC의항산화효과가이들의 IL-6 유리효과에미치는영향을보기위해담배추출물노출시에함께배양액넣어효과를비교해보았다. 이들담배들은 BEAS-2B 세포에서도의미있게 IL-6를증가시켰고항산화효과를가진 NAC는일반담배및허브담배에서는이들의증가를의미있게억제하였지만쑥담배에서는이를억제하지못했다 (*p>0.05) (Fig. 3.). 4. 금연초의 BEAS-2B 세포에대한 IL-6 유리효과및 NAC의 IL-6 유리에대한효과우리나라에서금연보조담배로비교적잘알려진금연초를대조군및일반담배와 IL-6 유리효과및 NAC의 IL-6유리에대한억제효과를비교하였다. 금연초에서도의미있는 IL-6증가를보였고항산화효과를가진 NAC는 5% 일반담배및 5% 금연초 Figure 2. IL-6mRNA expression of HBEC with varying component of 5%CSE. Herb : 허브담배, Non-Herb : 쑥담배. *p<0.05 compared with control. #p<0.01 compared with control and other component of 5% CSE. Figure 3. IL-6 release of BEAS-2B cells by expose of CSE and inhibitory effect of NAC on IL-6 release by CSE. Control : each condition without adding NAC, NAC : each condition with NAC: the release of IL-6 was significantly inhibited with NAC except 5% nonherb CSE. (* p<0.05). non-herb CSE : 쑥담배. 533

5 MC Kim et al. : The Comparison of the Effect of Cigarette and Stop Smoking-aiding Cigarette and Stop Smoking-aiding Cigarette on Release of IL-6 from Bronchial Epithelial Cell Figure 4. IL-6 release of BEAS-2B cells by expose of CSE and 5%/10% 금연초 and inhibitory effect of NAC on IL-6 release by CSE and 5%/10% 금연초. Control : each condition without adding NAC, NAC : each condition with NAC. The release of IL-6 on each condition was significantly inhibited with NAC except 10% 금연초 (* p<0.05) 에서는이들의증가를의미있게억제하였으나 10% 금연초에서는억제하지못했다 (Fig. 4.). 고 본연구는시중에판매되고있는금연보조담배 3 종 ( 금연초, 허브담배, 쑥담배 ) 의기관지상피세포에염증에대한효과를알아보기위해일반담배와이들담배의 IL-6의유리효과를비교하였다. 일반담배및금연보조담배 3종은대조군에비해의미있게기관지상피세포에서 IL-6를증가시켰고특히쑥담배에서가장많은증가를보였고이는 m RNA 검사에서도같은경향을보였다. 항산화효과를가진 NAC는일반담배, 허브담배, 금연초추출물에함께 NAC 를함께투여한경우 IL-6 의증가를억제할수있었지만, 쑥담배에서는의미있는억제효과를관찰할수없었다. IL-6는기도의기관지상피세포및대식세포등에서생산되는싸이토카인으로흡연자에서기관지폐포세척액및유도객담에서 IL-6가증가되어있음이보고되어져있다. 흡연자의기관지폐포세척액검사상 IL-8, TNF-α와더불어 IL-6도증가되어있고, 이를환자의 FEV 1 예측치와비교시 IL-8 및 IL-6값은 FEV 1 예측치값과 찰 역비례해 IL-6값이높을수록 FEV 1 예측치값은낮은것으로알려져있다 1-3. 만성폐쇄성폐질환환자의급성악화빈도는평상시객담내 IL-6 및 IL-8값이높을수록증가된다고알려져있어이들싸이토카인이급성악화의빈도를예측할수있는지표로이용될수있음을보고하였고, 이때 IL-8과는달리 IL-6는급성악화후에도지속적으로상승되는것으로알려져있다 7,8. 본연구에서는흡연에의해기관지상피세포에서증가되는여러염증지표중에서 IL-6 유리정도를일반담배와금연보조담배를이용해비교하였다. 기관지상피세포에서일반담배 5% 에서의미있는 IL-6증가를보였고허브담배, 쑥담배, 금연초등도의미있는증가를보였고 5%, 2.5%, 1.25% 등각각의농도에따른차이를보였다. 본연구에서는일반담배와각기다른성분으로제조된금연보조담배의기관지상피세포에서 IL-6유리정도를비교함에있어, 시간대별유리정도를비교하여이들의특성을비교하기보다는, 24시간동안담배연기추출물에의해기관지상피세포에서유리된 IL-6의총량을 ELISA 방법으로정량화하여비교하였다. IL-6 mrna를측정한경우에도같은경향을보여일반담배및허브담배, 쑥담배에서의미있는증가를보였고특히쑥담배에서증가되었다. 기관지상피세포에관한이들담배들의 IL-6유리효과가산화제와연관되어있는지여부를관찰하기위해, 이전의보고등에서 9-11 담배추출물에의한세포의 DNA 손상을억제해흡연으로인한폐손상으로부터세포를보호하는것으로알려져있는 NAC를항산화제로사용하여함께처리하였을때, 쑥담배에서는의미있는억제를보이지않았지만일반담배및허브담배, 5% 금연초 CSE 에서는의미있게억제되었다. 이들 3 종류의금연보조담배중에서쑥담배가 IL-6에대해단백질및 m RNA 검사에서비교적높은증가를보이고상대적으로 NAC의항산화효과에억제되지않았는데, 이런차이를보이는이유로는금연보조담배가각각원료가다르고이에따라연소시발생되는화학물질및산화제등의농도의차이를보이기때문인것으로사료되며, 기관지염증의측면 534

6 Tuberculosis and Respiratory Diseases Vol. 59. No. 5, Nov 에서본다면다른금연보조제보다많은 IL-6유리를보이고, 반대로항산화물질에대해억제가적은쑥담배가인체에더유해하리라사료된다. 요약연구배경 : 우리나라에서는다른나라에비해약초등을이용해만든흡연대용품으로금연을시도하려는흡연자들도많고이에따라여러가지다양한제품등이판매되고있는데이들의기관지, 폐에대한안정성에관한연구는아직부족한상황이다. 특히흡연자중일부는이런금연보조제를사용하는과정에서이들을상용하게되어시판되는금연보조담배의장기적사용시인체의안정성여부에대한연구는중요하리라사료된다. 방법 : 일반담배및금연보조담배 3종의담배연기추출물 (cigarette smoke extract, CSE) 을기관지상피세포에 24시간노출후배양액에서 IL-6를측정하였고일반담배및허브담배, 쑥담배노출후세포에서 IL-6 m RNA를측정하여비교하였다. 항산화효과를가진 N acetyl L-cysteine(NAC) 를일반담배및금연보조담배추출물에함께투여해 IL-6의증가억제여부를보았다. 결과 : 대조군에비해일반담배및금연보조담배3종에서기관지상피세포에노출시에모두의미있는 IL-6증가를관찰할수있었고, IL-6 m RNA도같은경향으로증가하였다. NAC를함께투여시일반담배및허브담배금연초에서는 IL-6의증가를의미있게억제하였지만쑥담배에서는억제하지못하였다. 결론 : 현재우리나라에서시판되고있는금연보조담배 3 종 ( 허브담배, 쑥담배, 금연초 ) 은일반담배처럼기관지상피세포에염증을유발할수있어장기적사용시인체의안정성여부에대한연구는중요하리라사료된다. 참고문헌 1. Carpagnano GE, Kharitonov SA, Foschino-Barbaro MP, Resta O, Gramiccioni E, Barnes PJ. Increased inflammatory markers in the exhaled breath conden sate ofcigarette smokers. Eur Respir J 2003;21: Patel IS, Roberts NJ, Lloyd-Owen SJ, Sapsford RJ, Wedzicha JA. Airway epithelial inflammatory responses and clinical parameters in COPD. Eur Respir J 2003; 22: Kuschner WG, D Alessandro A, Wong H, Blanc PD. Dose-dependent cigarette smoking-related inflammatory responses in healthy adults. Eur Respir J 1996;9: Barnes PJ, Stockley RA. COPD: current therapeutic interventions and future approaches. Eur Respir J 2005;25: Kelsen SG, Mardini IA, Zhou S, Benovic JL, Higgins NC. A technique to harvest viable tracheobronchial epithelial cells from living human donors. Am J Res pir Cell Mol Biol 1992;7: Carp H, Janoff A. Possible mechanisms of emphysema in smokers: in vitro suppression of serum elastaseinhibitory capacity by fresh cigarette smoke and its prevention by antioxidants. Am Rev Respir Dis 1978; 118: Sauty A, Manuel J, Philippeaux M, Leuenberg P. Cy tostatic activity of alveolar macrophages from smokers and non-smokers: role of interleukin-1ß, interleukin-6 and tumor necrosis factor-α. Am J Respir Cell Mol Biol 1994;11: McCrea KA, Ensor JE, Nall K, Bleecker ER, Hasday JD. Altered cytokine regulation in the lungs of cigarette smokers. Am J Respir Crit Care Med 1994;150: Kim HJ, Liu XI, Wang H, Kohyama T, Kobayashi T, Rennard SI, et al. Glutathione prevents inhibition of fibroblast-mediated collagen gel contraction by cigarette smoke. Am J Physiol Lung Cell Mol Physiol 2002;283: L Kim HJ, Liu XI, Kohyama T, Conner H, Kohyama T, Rennard SI, et al. Reversible cigarette smoke extractinduced DNA damage in human lung fibroblasts. Am J Respir Cell Mol Biol 2004;31: Carnevali S, Nakamura Y, Mio T, Liu XI, Takigawa K, Rennard SI, et al. Cigarette smoke extract inhibits fibroblast-mediated collagen gel contraction. Am J Physiol 1998;274:L

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -

농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 - 농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,

More information

hwp

hwp 서울위생병원 5 일금연학교를방문한우리나라흡연자의특성및입원금연교육프로그램의효과 서울위생병원내과, 서울위생병원부설 5 일금연학교 1, 원광대학교의과대학산본병원내과 2 이병수, 강기훈, 채은하, 김명찬, 정재일, 장희종, 이상훈, 조동식, 신재규 1, 김휘정 2. The Characteristics of Korean Smoker, Enrolled in 5 day

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

........

........ Investigation of the Korean Traditional Hobun Manufacturing Technique NATIONAL RESEARCH INSTITUTE OF CULTURAL HERITAGE 2008 Investigation of the Korean Traditional Hobun Manufacturing Technique - Centering

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>

<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770> 醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의

More information

untitled

untitled 대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea

More information

대한한의학원전학회지26권4호-교정본(1125).hwp

대한한의학원전학회지26권4호-교정본(1125).hwp http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

歯채민병.PDF

歯채민병.PDF Patient number Sex Age Animal contact 1 F 36 No 2 F 31 Cat scratch Result of biopsy/aspiration cytology of lymph nodes Chronic granulomatous inflammation with caseation necrosis, compatible with tuberculous

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

Microsoft Word doc

Microsoft Word doc KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

4 5 6 7 8 9 10 11 12 13 14 15 조 희 영 선 생 님 고 맙 습 니 다 16 17 18 19 가정간호 장선미 간호사님 감사합니다 20 21 22 23 24 25 U l 26 27 p SEOUL MEDICAL CENTER NEWS 28 29 30 31 32 33 34 35 36 37 홍보실장이란 신동규 원고를 기다립니다

More information

<B1E8C8A3C3B62E687770>

<B1E8C8A3C3B62E687770> 안정된만성폐쇄성폐질환환자에서신체질량지수와전신염증인자, 산화스트레스와의관련성 경상대학교의과대학 1 내과학교실, 2 소아과학교실, 3 건강과학연구원, 4 충북대학교의과대학해부학교실함현석 1, 이해영 1, 이승준 1, 조유지 1, 정이영 1,3, 김호철 1,3, 함종렬 1,3, 박찬후 2,3, 이종덕 1,3, 손현준 4, 윤희상 2,3, 황영실 1,3 Relationship

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI:   Awareness, Supports Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

untitled

untitled http://dx.doi.org/10.4046/trd.2011.71.6.431 ISSN: 1738-3536(Print)/2005-6184(Online) Tuberc Respir Dis 2011;71:431-437 CopyrightC2011. The Korean Academy of Tuberculosis and Respiratory Diseases. All rights

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

KISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants

KISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants KISEP Otology Korean J Otolaryngol 2000;43:136-42 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants and Dexamethasone on inducible Nitric Oxide Synthase

More information

May 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr

May 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22

More information

Treatment and Role of Hormaonal Replaement Therapy

Treatment and Role of Hormaonal Replaement Therapy Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

황지웅

황지웅 Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

0926-...._0910....-......40p

0926-...._0910....-......40p 2012 0910 Vol. 95 Smart choice Best care Sept + Oct 04 / 05 그릇된 의심까지 담는, 베푸는 신뢰 쌓기 가끔사람들에게서 가장기억나는환자가누구냐? 또는 가장가슴아팠던환자는누구냐? 라는 질문을 받는다. 이럴 때 떠오르는 환자는 선물을 주거나 의학적으로 관심이 있는 질병을 가진 환자 가아니고, 의사인나의치료를가장잘믿고따라주었던환자와,

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

<392E5FB8B8BCBAC6F3BCE2BCBAC6F3C1FAC8AF5FC4A1B7E1C1A65FB0B3B9DFC0C75FC7F6C8B25FB9D75FB1D8BAB9B9E6BEC85F F332E302E687770>

<392E5FB8B8BCBAC6F3BCE2BCBAC6F3C1FAC8AF5FC4A1B7E1C1A65FB0B3B9DFC0C75FC7F6C8B25FB9D75FB1D8BAB9B9E6BEC85F F332E302E687770> 만성폐쇄성기도질환혁신신약개발전략 포항공과대학교생명과학과김윤근 1. 서론 최근 WHO에서는 2020년에인간의수명과삶의질을결정하는 4대질환군을지정하였는데, 이중에하나가기도폐색에의한호흡곤란을특징으로하는만성폐쇄성기도질환 (chronic obstructive airway disease) 이다. 만성폐쇄성기도질환은가역적인기도폐색을특징으로하는천식 (asthma) 과비가역적인기도폐색을특징으로하는만성폐쇄성폐질환

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, ) Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

PHI Report 시민건강이슈 Ⅱ 모두가건강한사회를만들어가는시민건강증진연구소 People's Health Institute

PHI Report 시민건강이슈 Ⅱ 모두가건강한사회를만들어가는시민건강증진연구소 People's Health Institute PHI Report 2011-01 모두가건강한사회를만들어가는 People's Health Institute i 차례 1. 1 1.1. 1 1.2. 5 2. 7 2.1.? 7 2.1.1. OECD 7 2.1.2. 8 2.1.3. 9 2.1.4. 10 2.1.5. 12 2.2.? 13 2.2.1. 13 2.2.2. 13 2.2.3. 14 2.2.4. 14 2.2.5.

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

<31322EB1E8BFB5C2F92E687770>

<31322EB1E8BFB5C2F92E687770> 대한내과학회지 : 제 69 권제 6 호 2005 인체기관지상피세포에서리노바이러스및담배연기추출물에의한 Interleukin-8 의생성에대한연구 한양대학교의과대학내과학교실, 제주대학교의과대학내과학교실 2 김영찬 이재형 김미옥 2 김태형 손장원 윤호주 신동호 박성수 =Abstract= The effect of rhinovirus & cigarette smoke extract

More information

<B4E3B9E8B0A1B0DD3033303830322DB9E8C6F7C0DAB7E12E687770>

<B4E3B9E8B0A1B0DD3033303830322DB9E8C6F7C0DAB7E12E687770> 담배가격과 건강증진 - 1. 서론: 담배값 을 다시 보기 - 1 - 2. 고령사회( 高 齡 社 會 )와 고흡연율( 高 吸 煙 率 ): 위기의 복합 1) 과소평가되어 있는 담배 피해 - 2 - - 3 - 건 강 위 해 암, 만성호흡기계질환, 심혈관계질환의 지연 위험 등 급성호흡기계질환, 천식발작, 태아 영향, 심혈관계질환 조기 위험 등 흡연 시작 15-20년

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

歯제7권1호(최종편집).PDF

歯제7권1호(최종편집).PDF ********* (*, **, *** ).., 2002, 7, 1, 1-12. 2-5 80.,.,..,,... :,,. (naming).., (word finding), (lexical look- up), (lexical retrieval), (word recall) (Fried- Oken, 1987). (pause),,, (naming error) (Snyder

More information

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016)   ISSN 228 (JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

Kaes010.hwp

Kaes010.hwp 갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

untitled

untitled http://dx.doi.org/10.4046/trd.2011.71.2.114 ISSN: 1738-3536(Print)/2005-6184(Online) Tuberc Respir Dis 2011;71:114-119 CopyrightC2011. The Korean Academy of Tuberculosis and Respiratory Diseases. All rights

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120: Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE

More information

¼Û±âÇõ

¼Û±âÇõ 223 Table 1. Results of FEV 1.0, Methacholine Challenge Test, and Exercise Provocation Test in Eight Patients Who Performed PFT Pts Tests 1 2 3 4 5 6 7 8 FEV 1.0 (%pred) 66.6 88.8 120 101 90.5 95.4 91.6

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

44-4대지.07이영희532~

44-4대지.07이영희532~ A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

歯49손욱.PDF

歯49손욱.PDF 2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13

More information

<30372EC0CCC0AFC1F82E687770>

<30372EC0CCC0AFC1F82E687770> 산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

15.hwp

15.hwp airway, mucin, Mahwangyunpye-tang (MYT), MUC5AC mrna LDH release (% control) 150 120 90 60 30 0 cont 10 20 40 80 Concentrations (µ l / 200µ l PBS) Absorbance (% control) 150 100 50 0 cont 0.2 Concentrations

More information

연구목표 재료및방법 년도시험연구보고서

연구목표 재료및방법 년도시험연구보고서 ABSTRACT This study was conducted to determine the optimum concentration of cactus standard nutrient solution for hydroponic culture in potted succulents, Echeveria derenbergii, Sedeveria Letizia and Cotyledon

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

<5B31362E30332E31315D20C5EBC7D5B0C7B0ADC1F5C1F8BBE7BEF720BEC8B3BB2DB1DDBFAC2E687770>

<5B31362E30332E31315D20C5EBC7D5B0C7B0ADC1F5C1F8BBE7BEF720BEC8B3BB2DB1DDBFAC2E687770> 2016 지역사회 통합건강증진사업 안내 - 지역사회 중심 금연지원 서비스 - 2016. 3. 주요변경사항 5 1부 국가 금연정책 추진 및 현황 Ⅰ. 국가 금연정책 개요 1. 금연정책의 배경 및 필요성 11 2. 세계 금연정책 동향 20 3. 우리나라 금연정책 추진경과 24 4. 2016년도 금연정책 추진방향 31 Ⅱ. 국가 금연사업 현황 1. 흡연자 금연지원서비스

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

hwp

hwp 만성폐쇄성폐질환의급성악화와회복기에서유도객담내 Nuclear Factor-κ B(NF-κB) 의활성도와 IL-6, IL-8 및 TNF-α 의농도변화 가톨릭대학교의과대학내과학교실송소향, 김치홍, 권순석, 김영균, 김관형, 문화식, 송정섭, 박성학 Nuclear Factor-κB(NF-κB) Activity and Levels of IL-6, IL-8 and TNF-α

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -

More information

본문01

본문01 Ⅱ 논술 지도의 방법과 실제 2. 읽기에서 논술까지 의 개발 배경 읽기에서 논술까지 자료집 개발의 본래 목적은 초 중 고교 학교 평가에서 서술형 평가 비중이 2005 학년도 30%, 2006학년도 40%, 2007학년도 50%로 확대 되고, 2008학년도부터 대학 입시에서 논술 비중이 커지면서 논술 교육은 학교가 책임진다. 는 풍토 조성으로 공교육의 신뢰성과

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

<C1DF3320BCF6BEF7B0E8C8B9BCAD2E687770>

<C1DF3320BCF6BEF7B0E8C8B9BCAD2E687770> 2012학년도 2학기 중등과정 3학년 국어 수업 계획서 담당교사 - 봄봄 현영미 / 시온 송명근 1. 학습 목적 말씀으로 천지를 창조하신 하나님이 당신의 형상대로 지음 받은 우리에게 언어를 주셨고, 그 말씀의 능 력이 우리의 언어생활에도 나타남을 깨닫고, 그 능력을 기억하여 표현하고 이해함으로 아름다운 언어생활 을 누릴 뿐만 아니라 언어문화 창조에 이바지함으로써

More information

02양은용

02양은용 The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information