Clinical, Electrophysiological, and Genetic Analysis in a Family with Autosomal Dominant Nocturnal Frontal Lobe Epilepsy Sung Il Sohn, M.D., Yong Won

Size: px

Start display at page:

Download "Clinical, Electrophysiological, and Genetic Analysis in a Family with Autosomal Dominant Nocturnal Frontal Lobe Epilepsy Sung Il Sohn, M.D., Yong Won"

재포 설
5 years ago
Views:

1 Clinical, Electrophysiological, and Genetic Analysis in a Family with Autosomal Dominant Nocturnal Frontal Lobe Epilepsy Sung Il Sohn, M.D., Yong Won Cho, M.D.*, Sang Doe Yi, M.D.*, Dae Kwang Kim, M.D., Du Kyo Jung, M.D.*, Hyung Lee, M.D.*, Jung Gun Lim, M.D.*, Ju Hwa Lee, M.D.* Department of Neurology, Eulji University School of Medicine Department of Neurology* and Anatomy, Keimyung University School of Medicine Background : Autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) is a distinct epilepsy syndrome and a genetically heterogeneous disorder linked to chromosomes 20q13.2, 15q24, and 1p21. Missense and insertion mutations in neuronal nicotine acetylcholine receptor 4 (CHRNA4) and 2 (CHRNB2) genes have been found in families with ADNFLE. Methods : Clinical, EEG-Video monitoring, and neuropsychologic study in a family with ADNFLE were tested. For detect of mutation gene, polymerase chain reaction for CHRNA4 gene and CHRNB2 gene, single strand conformational polymorphism (SSCP) analysis and DNA sequencing were done. R e s u l t s : Among 15 living family members in three generations, nine had seizures. EEG-Video monitoring showed ictal epileptiform discharges genetically or regionally in frontal, frontocentral, frontotemporal, or temporal areas and less frequently no epileptiform discharges or non-specific generalized slowing. Two affected individuals demonstrated interictal temporal spikes, whereas the others were normal. Neuropsychological study showed mental retardation and decreased frontal executive function in five affected individuals. A cytosine to thymine exchange (755C>T; S252L) in exon 5 of the CHRNA4 gene was found on all affected individuals except in an individual who wasn t tested, but this change was absent in those without epilepsy. Conclusions : This is the first study of genetically confirmed ADNFLE in a Korean family, who had mental retardation and various EEG abnormalities, ictally and interictally. J Korean Neurol Assoc 20(6):600~611, 2002 Key Words : Epilepsy, Frontal lobe, Autosomal dominant, ADNFLE, CHRNA4 gene, Mental retardation Sung Il Sohn, M.D. 600 Copyright 2002 by the Korean Neurological Association

2 µ J Korean Neurol Assoc / Volume 20 / November,

3 µ µ µ Figure 1. Pedigree of a Korean family with autosonal dominant nocturnal frontal lobe epilepsy. The solid symbols represent affected status, and open symbols represent unaffected status. Arrow indicates a proband. Table 1. PCR primer pairs for amplification of CHRNB2 and CHRNA4 genes µ µ µ µ µ µ µ Exon Forward primer Reverse primer CHRNB2 1 GAGGCAGCGAGCTATGCCCG GCGGCGACTCTTGGGCCGT 2 GAGCTGGGTGGGCTCTCCT GCAGAGAGCCTGGGACCTCT 3 GGAGGTGTGAGAGGGACCCT CCAGGGGTGTGGGTGGAAG 4 CTCTAGTTCGTTTCCTTAAC CCTCCCTGAGCCCTCCAATG 5a AGGGCTGACTGTGCCCATC GTCCACGCTGGCCACCTCA 5b CACAGAGATCGACTTGGTGCT GAAGACAAGGATGGCTAGCG 5c CACCATCAACCTCATCATCC AGCAGCGCGGGCAGCTTC 5d CCTGCCCTCCGAGTGTGGC GGTCCCACCGTGCGGCACT 6 CGTTTGTCTCCCATCCTGC TGGCTGGGTGAAAGAGCATG CHRNA4 1 GGTGCGTGCGCCATGGAGC GCAGTCAGCAGCCTGCCTC 2 ACCTGAGCCACTGGCCTGCC CGACCTCAGTCACAGCGCAC 3 CCCGTCCACCATATCTTGC GGCAGTGCCCTCCCACTC 4 CATCCAGGAGTGGCACGACTA ACCAAGGCCCTGTAGAGGAC 5a ACCCTTCGCTCTCTTCCTGC CCACGATGACCCACTCGCC 5b CGGCTCCTGGACCTACGAC CAGGCAGGGGATGATGAGG 5c GGCGAGTGGGTCATCGTGG GATGACCAGTGAGGTGGACG 5d CCTGCCCTCCGAGTGTGGC GGGCATGGTGTGCGTGCGTG 5e ACGCACGCACACCATGCCC GCGGCAGGGTCCAGGCGAG 5f CCTTCCTGCAAGTCACCCTCC GTGCTTTGGTGCTGCGGGTC 5g AAGGAGCCCTCTTCGGTGTC CCCAAAGCGAAGCAGCCTGA 6 GGCCGTGCTGGAGTGACG GCCCCACAGAGTCCAGGG J Korean Neurol Assoc / Volume 20 / November,

4 Table 2. Clinical and neuroimaging findings in the family members with autosomal dominant nocturnal frontal lobe epilepsy Patient II-1 II-6 III-2 III-3 III-8 III-9 III-10 III-11 Age/Sex 53/M 46/F 24/F 22/F 23/F 22/F 20/M 18/F History of febrile convulsion No No No No No No No No Age at onset (years) Childhood Time of seizure Night Day & night Night Night Night Night Night Night Relation to sleep Falling Sleep Through Through Within Falling Falling Falling asleep aggravates all night all night 2hr asleep asleep or asleep or episodes after sleep waking up waking up Brain MRI ND Normal ND ND Normal Normal Arachnoid Normal cyst on left temporal pole Current medication None CBZ CBZ TPM Stop CBZ CBZ VBG VPA TBM LTG since VPA OCBZ CBZ VGB 19-year-old PRM VPA TPM OCBZ LTG ZNS Seizure frequency 1-4/year 3-4/day 3-4/month Seizure 3-4/month 2-5/month 1-4/year after medication free CBZ; carbamazepine, OCBZ; oxcarbazepine, VPA; sodium valproate, LTG; lamotrigine, VGB; vigabatrin, TPM; topiramate, ZNS; zonisamide, PRM; primidone, PHT; phenytoin, PB; phenobarbital, ND; not done. J Korean Neurol Assoc / Volume 20 / November,

5 Figure 2. Interictal EEG recording in III-8 case with poorly controlled seizure. The EEG shows isolated repetitive spike-and-wave complexes with phase reversals on the right frontotemporal area. Figure 3. Ictal EEG recording of brief attack arising from stage 2 non-rapid eye movement sleep in a 46-year-old woman (II-6). Ictal EEG shows rhythmic epileptiform discharges over bilateral frontal, central, and temporal areas. 604 J Korean Neurol Assoc / Volume 20 / November, 2002

6 Table 3. Video-EEG monitoring findings in the family members with autosomal dominant nocturnal frontal lobe epilepsy Patient II-6 III-2 III-3 III-9 III-10 III-11 No of seizure during a night Seizure duration (sec) 36.1± ± ± ± ± ±11.2 (mean±sd) No of secondary generalization Postictal confusion Yes No No No Yes Yes Seizure clusters Yes No No Yes Yes Yes Interictal EEG Normal Intermittent Intermittent Normal Intermittent Normal bifrontal bifrontal generalized theta waves theta waves theta waves Ictal semiology Shouting Ah, Moaning, Mumbling, Moaning, Moaning, lip Moaning, moaning, eye blinking, head neck smacking, head nodding, drooling, hand shaking, shaking or extension, both arm neck eye blinking, both arm nodding, both arm tonic flexion, extension both arm tonic flexion tonic flexion tonic flexion neck tonic tonic flexion, of right arm, extension neck tonic neck tonic extension extension Ictal onset areas Right Bilateral Bilateral Generalized, Generalized Bilateral temporal, frontal areas frontocentral central, or or bilateral frontocentral right areas bilateral frontal areas areas fontotemporal, frontal areas or bilateral frontal areas Ictal onset patterns Low voltage Rhythmic Rhythmic Rhythmic Semirhythmic Rhythmic rhythmic theta waves beta waves delta or spike/sharp alpha theta, superimposed alpha waves waves waves, nonspecific with beta nonspecific theta slowing waves theta slowing No; number, Rt; right. J Korean Neurol Assoc / Volume 20 / November,

7 Table 4. Results of neuropsychological tests in the family members with autosomal dominant nocturnal frontal lobe epilepsy Patient II-6 III-2 III-3 III-9 III-10 III-11 K-WAIS Verbal IQ Performance IQ Full IQ 68* 54* 69* 53* 76 <45 K-MAS Short-term M (%ile) 112 (93) 69 (2) 58 (<1) 91 (28) 118 (89) 72 (3) Verbal M (%ile) 61 (<1) 58 (<1) 110 (75) 99 (47) 96 (40) 86 (18) Visual M (%ile) 53 (<1) 74 (4) 72 (4) 83 (13) 110 (75) 63 (1) Total M (%ile) 53 (<1) 62 (1) 89 (23) 84 (14) 104 (61) 72 (3) Rey-CFT Copy NA Immediate recall NA 20min delayed recall NA Trailmaking test Part A (%ile) 115 (<10) 52 (<10) 55 (<10) 78 (<10) 80 (<10) 78 (<10) Part B (%ile) 43 (<10) Refuse 135 (<10) 126 (<10) 159 (<10) 195 (<10) Pegboard test Refuse Right (Mean±SD) (66.5±7.0) (67.6±20.9) (60.4±6.4) (62.1±20.8) (60.4±6.4) Left (Mean±SD) (71.1±8.5) (62.2±11.8) (64.1±9.2) (67.6±20.9) (64.1±9.2) WCST Refuse Refuse Total errors (%ile) 102 (<1) 101 (<1) 17 (68) 56 (5) % Errors (%ile) 80 (<1) 79 (<1) 14 (84) 44 (6) PR (%ile) 102 (<1) 14 (39) 8 (77) 24 (14) PE (%ile) 81 (<1) 14 (37) 8 (73) 24 (9) NCC (%ile) 0 (<1) 0 (<1) 6 (>16) 5 (>16) TCFC (%ile) 65 (2-5) 65 (2-5) 10 (>16) 12 (>16) FMS (%ile) 0 (>16) 0 (>16) 4 (6-10) 1 (>16) * mild mental retardation by American Association on Mental Deficiency, moderate mental reterdation by AAMD, age and sex matched normative data, K-WAIS; Korean-Wechsler Adult Intelligence Scale, K-MAS; Korean-Memory Assessment Scale, IQ; Intelligence Quotient, Rey-CFT; Rey-Osterrieth Complex Figure Test, %ile; percentile, WCST; Wisconsin Card Sorting Test, PR; perseverative responses, PE; perseverative errors, NCC; number of categories completed, TCFC; trials to complete first category, FMS; failure to maintain set. 606 J Korean Neurol Assoc / Volume 20 / November, 2002

Figure 4. Single-strand conformational polymorphism (SSCP) mutation analysis of exon 5 of CHRNA4 gene in a Korean family with autosomal dominant nocturnal frontal lobe epilepsy.

Nuleotide sequence of the relevant region of exon 5 of CHRNA4 gene. Arrow indicates the position of the mutat- ed 755 nucleotide.

8 Figure 4. Single-strand conformational polymorphism (SSCP) mutation analysis of exon 5 of CHRNA4 gene in a Korean family with autosomal dominant nocturnal frontal lobe epilepsy. The migration differences of the bands () in affected patients (lane 1-4 and 6-9) are clearly evident and indicate that shift bands contain a putatively mutated allele. Figure 5. Nuleotide sequence of the relevant region of exon 5 of CHRNA4 gene. Arrow indicates the position of the mutat- ed 755 nucleotide. A C to transition (: 755 C>T) resulting in a S252L missense mutation is found in exon 5. Nucleotied numbers are based on the nomenclature for the Torpedo a- subunit of an acetylcholine receptor. J Korean Neurol Assoc / Volume 20 / November,

9 608 J Korean Neurol Assoc / Volume 20 / November, 2002

10 Marsden CD, Andermann E, et al. Autosomal dominant 01. Scheffer IE, Bhatia KP, Lopes-Cendes I, Fish DR, Marsden CD, Andermann F, et al. Autosomal dominant frontal epilepsy misdiagnosed as sleep disorder. L a n c e t 1994;343: Scheffer IE, Bhatia KP, Lopes-Cendes I, Fish DR, nocturnal frontal lobe epilepsy. A distinctive clinical disorder. Brain 1995;118: Oldani A, Zucconi M, Ferini-Strambi L, Bizzozero D, Smirne S. Autosomal dominant nocturnal frontal lobe epilepsy: electroclinical picture. Epilepsia 1996 ; 37 : Picard F, Bertrand S, Steinlein OK, Bertrand D. Mutated nicotinic receptors responsible for autosomal dominant nocturnal frontal lobe epilepsy are more sensitive to carbamazepine. Epilepsia 1999;40: Oldani A, Zucconi M, Asselta R, Modugno M, Bonati MT, Dalpra L, et al. Autosomal dominant nocturnal frontal lobe epilepsy. A video-polysomnographic and genetic appraisal of 40 patients and delineation of the epileptic syndrome. Brain 1998;121: Steinlein OK, Mulley JC, Propping P, Wallace RH, Phillips HA, Sutherland GR, et al. A missense mutation in J Korean Neurol Assoc / Volume 20 / November,

11 the neuronal nicotinic acetylcholine receptor alpha 4 subunit is associated with autosomal dominant nocturnal frontal lobe epilepsy. Nat Genet 1995;11: Steinlein OK, Magnusson A, Stoodt J, Bertrand S, Weiland S, Berkovic SF, et al. An insertion mutation of the CHRNA4 gene in a family with autosomal dominant nocturnal frontal lobe epilepsy. Hum Mol Genet ; 6: Hirose S, Iwata H, Akiyoshi H, Kobayashi K, Ito M, Wada K, et al. A novel mutation of CHRNA4 responsible for autosomal dominant nocturnal frontal lobe epilepsy. Neurology 1999;53: De Fusco M, Becchetti A, Patrignani A, Annesi G, Gambardella A, Quattrone A, et al. The nicotinic receptor beta 2 subunit is mutant in nocturnal frontal lobe epilepsy. Nat Genet 2000;26: Phillips HA, Favre I, Kirkpatrick M, Zuberi SM, Goudie D, Heron SE, et al. CHRNB2 is the second acetylcholine receptor subunit associated with autosomal dominant nocturnal frontal lobe epilepsy. Am J Hum Genet ; 6 8 : Sutor B, Zolles G. Neuronal nicotinic acetylcholine receptors and autosomal dominant nocturnal frontal lobe epilepsy: a critical review. Pflugers Arch 2001;442: Phillips HA, Scheffer IE, Crossland KM, Bhatia KP, Fish DR, Marsden CD, et al. Autosomal dominant nocturnal frontal-lobe epilepsy: genetic heterogeneity and evidence for a second locus at 15q24. Am J Hum Genet ; 6 3 : Paterson D, Nordberg A. Neuronal nicotinic receptors in the human brain. Prog Neurobiol 2000;61: Gil Z. Connors BW, Amitai Y. Differential regulation of neocortical synapses by neuromodulators and activity. Neuron 1997;19: Alkondon M, Pereira EF, Eisenberg HM, Albuquerque EX. Nicotine receptor activation in human cerebral cortical interneurons: a mechanism for inhibition and disinhibition of neuronal networks J Neurosci 2000;20: Porter JT, Cauli B, Tsuzuki K, Lambolez B, Rossier J, Audinat E. Selective excitation of subtypes of neocortical interneurons by nicotinic receptors. J Neurosci ; 19: Phillips HA, Scheffer IE, Berkovic SF, Hollway GE, Sutherland GR, Mulley JC. Localization of a gene for autosomal dominant nocturnal frontal lobe epilepsy to chromosome 20q Nat Genet 1995;10: Yeom TH, Park YS, Oh GJ, Kim JG, Lee YH. The Main Principle for Assessment of K-WAIS. 1st ed. Seoul: Korea Guidance, 1992; Lee HS, Park BK, An CI, Kim MLH, Jung IG. The Main Principle for Assessment and Scoring of Korean Version of Memory Assessment Scales. 1st ed. Seoul: Korea Guidance, 2001; Mitrushina MN, Boone KB, D Elia LF. Handbook of Normative DATA for Neuropsychological Assessment. 1st ed. New York: Oxford University Press, 1999; Khatami R, Neumann M, Schulz H, Kolmel HW. A family with autosomal dominant nocturnal frontal lobe epilepsy and mental retardation. J Neurol 1998;245: Saenz A, Galan J, Caloustian C, Lorenzo F, Marquez C, Rodriguez N, et al. Autosomal dominant nocturnal frontal lobe epilepsy in a Spanish family with a Ser252Phe mutation in the CHRNA4 gene. Arch Neurol 1999 ; 56 : Ito M, Kobayashi K, Fujii T, Okuno T, Hirose S, Iwata H, et al. Electroclinical picture of autosomal dominant nocturnal frontal lobe epilepsy in a Japanese family. Epilepsia 2000;41: Hayman M, Scheffer IE, Chinvarun Y, Berlangieri SU, Berkovic SF. Autosomal dominant nocturnal frontal lobe epilepsy: demonstration of focal frontal onset and intrafamilial variation. Neurology 1997;49: Scheffer IE, Phillips HA, O Brien CE, Saling MM, Wrennall JA, Wallace RH, et al. Familial partial epilepsy with variable foci: a new partial epilepsy syndrome with suggestion of linkage to chromosome 2. Ann Neurol 1998;44: Xiong L, Labuda M, Li DS, Hudson TJ, Desbiens R, Patry G, et al. Mapping of a gene determining familial partial epilepsy with variable foci to chromosome 22q11-q12. Am J Hum Genet 1999;65: Cendes F, Lopes-Cendes I, Andermann E, Andermann F. Familial temporal lobe epilepsy: a clinically heterogeneous syndrome. Neurology 1998;50: Scheffer IE, Jones L, Pozzebon M, Howell RA, Saling MM, Berkovic SF. Autosomal dominant rolandic epilepsy and speech dyspraxia: a new syndrome with anticipation. Ann Neurol 1995;38: Provini F, Plazzi G, Tinuper P, Vandi S, Lugaresi E, Montagna P. Nocturnal frontal lobe epilepsy. A clinical and polygraphic overview of 100 consecutive cases. Brain 1999;122: Lugaresi E, Cirignotta F, Montagna P. Nocturnal paroxysmal dystonia. J Neurol Neurosurg Psychiatry 1986;49: Oldani A, Zucconi M, Castronovo C, Ferini-Strambi L. Nocturnal frontal lobe epilepsy misdiagnosed as sleep apnea syndrome. Acta Neurol Scand 1998;98: Provini F, Plazzi G, Lugaresi E. From nocturnal paroxysmal dystonia to nocturnal frontal lobe epilepsy. C l i n Neurophysiol 2000;111(Suppl 2): Seo WK, Kim BJ, Park MK, Park KW, Kim L, Lee DH. A case of nocturnal paroxysmal dystonia. J Korean Neurol Assoc 2001;19: Picard F, Baulac S, Kahane P, Hirsch E, Sebastianelli R, Thomas P, et al. Dominant partial epilepsies. A clinical, electrophysiological and genetic study of 19 European families. Brain 2000;123: J Korean Neurol Assoc / Volume 20 / November, 2002

12 35. Phillips HA, Marini C, Scheffer IE, Sutherland GR, Mulley JC, Berkovic SF. A de novo mutation in sporadic nocturnal frontal lobe epilepsy. Ann Neurol 2000;48: Nakken KO, Magnusson A, Steinlein OK. Autosomal dominant nocturnal frontal lobe epilepsy: an electroclinical study of a Norwegian family with ten affected members. Epilepsia 1999;40: Steinlein OK, Stoodt J, Mulley J, Berkovic S, Scheffer IE, Brodtkorb E. Independent occurrence of the CHRNA4 Ser248Phe mutation in a Norwegian family with nocturnal frontal lobe epilepsy. Epilepsia 2000;41: Sihver W, Gillberg PG, Nordberg A. Laminar distribution of nicotinic receptor subtypes in human cerebral cortex as determined by [3H](-)nicotine, [3H]cytisine and [3H]epibatidine in vitro autoradiography. N e u r o s c i e n c e ; 8 5 : Alkondon M, Albuquerque EX. Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes. J Pharmacol Exp Ther ; : Gray R, Rajan AS, Radcliffe KA, Yakehiro M, Dani JA. Hippocampal synaptic transmission enhanced by low concentrations of nicotine. Nature 1996;383: Wonnacott S. Presynaptic nicotinic ACh receptors. Trends Neurosci 1997;20: Alkondon M, Pereira EF, Albuquerque EX. alpha-bungarotoxin- and methyllycaconitine-sensitive nicotinic receptors mediate fast synaptic transmission in interneurons of rat hippocampal slices. Brain Res ; : Matsuyama S, Matsumoto A, Enomoto T, Nishizaki T. Activation of nicotinic acetylcholine receptors induces long-term potentiation in vivo in the intact mouse dentate gyrus. Eur J Neurosci 2000;12: Hunter BE, de Fiebre CM, Papke RL, Kem WR, Meyer EM. A novel nicotinic agonist facilitates induction of long-term potentiation in the rat hippocampus. N e u r o s c i Lett 1994;168: Guan ZZ, Zhang X, Ravid R, Nordberg A. Decreased protein levels of nicotinic receptor subunits in the hippocampus and temporal cortex of patients with Alzheimer s disease. J Neurochem 2000;74: Marutle A, Warpman U, Bogdanovic N, Lannfelt L, Nordberg A. Neuronal nicotinic receptor deficits in Alzheimer patients with the Swedish amyloid precursor protein 670/671 mutation. J Neurochem ; 7 2 : Bertrand S, Weiland S, Berkovic SF, Steinlein OK, Bertrand D. Properties of neuronal nicotinic acetylcholine receptor mutants from humans suffering from autosomal dominant nocturnal frontal lobe epilepsy. Br J Pharmacol 1998;125: Kuryatov A, Gerzanich V, Nelson M, Olale F, Lindstrom J. Mutation causing autosomal dominant nocturnal frontal lobe epilepsy alters Ca 2 + permeability, conductance, and gating of human alpha4beta2 nicotinic acetylcholine receptors. J Neurosci 1997;17: J Korean Neurol Assoc / Volume 20 / November,

<30382DB1E8B5BFBFED28C8A5B5B7C0BB20BAB8C0CCB4C220B0A2BCBA292E687770>

<30382DB1E8B5BFBFED28C8A5B5B7C0BB20BAB8C0CCB4C220B0A2BCBA292E687770> 원 저 J Kor Sleep Soc / Volume 5 / December, 2008 혼돈을 보이는 각성 - 사건수면인가, 간질발작인가? 이서영 1 김남희 2 김동욱 3 1 강원대학교 신경과, 2 동국대학교 신경과, 3 건국대학교 신경과 Confusional Arousal - Parasomnia or Seizure? Seo-Young Lee 1, Nam-Hee