013~020. Áö¹æ¼¼Æ÷ ºÐÈ�ÁßÀÎ

Size: px

Start display at page:

Download "013~020. Áö¹æ¼¼Æ÷ ºÐÈ�ÁßÀÎ"

수연 부
5 years ago
Views:

1 3T3-L1 13 DOI : /KPI T3-L1 Received : Accepted : Adipocyte-Related Genes and Transcription Factors were affected by Ganoderma lucidum during 3T3-L1 Differentiation Chae-Woo Lee*, Hyun-Min Yoon*, Kyung-Hwa Kang** Key Words: Ganoderma lucidum (GL), adipocytes, differentiation, energy expenditure *Dept. of Acupuncture & Moxibustion College of Oriental Medicine, Dong-Eui University, Busan, , Republic of Korea ** Department of Oriental Physiology, College of Oriental Medicine, Dongeui University, Busan, , Republic of Korea ABSTRACT In this study, the effects of Ganoderma lucidum (GL) on fat metabolism were performed in 3T3-L1 adipocytes. The effects of GL on 3T3-L1 preadipocytes differentiation were also examined. Our results showed that GL decreased the TG content by ORO staining. To elucidate the mechanism of the effects of GL on lowering TG content in 3T3-L1 adipocytes, we examined whether GL modulate the expressions of transcription factors and adipokines related to control of energy expenditure process because adipokines regulate adipocyte mass and increased expenditure may consume much TG in adipocytes. As a result, the expression of C/EBP, C/EBP, C/EBP, and PPAR, genes, which induce the adipose differentiation and adipose-specific FAS, ap2, and adipsin genes, which compose fat formation were decreased. In addition, GL increased the expression of leptin, UCP2, adiponectin in 3T3-L1 adipocytes, resulting in energy homeostasis. In conclusion, GL could regulate transcript factor related to induction of adipose differentiation and control TG content by up-regulation of adipokines related to fat burn. I Corresponding author : Kyung-Hwa Kang, Dong-Eui Univ. Department of Oriental Physiology, College of Oriental Medicine, Dongeui University, San 45-1, Yangjung 2-Dong, Busanjin -Gu Busan, Korea, , Tel : (82) Fax : (82) , ghkang@deu.ac.kr * This research was suppprted by KPI(Korea Pharwacopuncture Iust. itute) in 2007.

2 FDA polysaccharide triterpene 3T3-L1 Isobutylmethylxanthine(IBMX), Dexamethasone (DEX), bovine serum albumin (BSA) Sigma (USA). 2 (Ganoderma lucidum, GL) (Korea) 300g 1 L 25% ethanol m rotary evaporator 200ml T3-L1 Preadipocytes 5% CO2, 37 DMEM (10% FBS, 100 unit/ml of penicillin G sodium, 100 g/ml of streptomycin sulfate). 100% confluent 0.5mM IBMX, 1 M DEX 1 g/ml insulin (MDI) DMEM 3, 2 1 g/ml insulin DMEM T3-L1 Preadipocytes 0.5mM IBMX, 1 M DEX 1 g/ml insulin, 1%, 2% 3% 3. II 1 3T3-L 1 mouse preadipocytes American Type Culture Collection (ATCC, USA), Dulbecco's Modified Eagle Media (DME- M), bovine calf serum (BCS), fetal bovine serum (FBS), penicillin-streptomycin mixture DMSO GibcoBRL (USA). Insulin, 4. Oil red O Oil red O. phosphate-buffered saline (PBS) 3.7% formalin 10 deionized water Oil red O 30. deionized water 3 microscopic image (Olympus, Tokyo, Japan). DMSO

3 3T3-L1 15 microplate reader (Molecular Devices, USA) 490 nm. 5. RNA Cell TRizol 2 chloroform 10 vortexing 4 14,000rpm 15., isopropanol ,000 rpm 10 75% ethanol 4 7,500 rpm 5. RNA pellet 10 DEPC (diethyl pyrocarbonate)-dw 260nm RNA. 6. RT-PCR 1 g RNA RT-PCR kit (Bioneer, Korea) 45 30, denaturation, 55 ~ annealing, 72 1 extension cycle 30~35, extension 72 5 PCR machine (GeneAmp, PCR system 9700, USA). PCR products 0.5 TBE buffer (45 mm Tris-borate, 1mM EDTA) 2% agarose gel loading 100V 30 etidium bromide. primer Bioneer (Bioneer Co., Korea) (Table 1). 7. SPSS 12.0K for Windows P<0.05. One way-anova Scheffe test. III 1 3T3-L1 confluent (0 day), MDI 1%, 2% 3% Oil red O. MDI MDI % (Figure. 1). Oil red O 4 9 MDI , MDI , 1% MDI , 2% MDI , 3% MDI (Figure. 2). 2. 3T3-L1 adipocytes MDI MDI 1%,2% 3% 9 C/EBP C/EBP PPAR C/EBP C/EBP C/EBP C/EBP mrna 4 9 C/EBP mrna 4 9

4 (Figure 3A). C/EBP PPAR C/EBP mrna 4 9. PPAR mrna 4, 9 3% (Figure 3B). (Figure 5). 3% leptin. UCP mrna 4 9, (Figure 5). Adiponectin mrna 4 9, (Figure 5). IV 3. 3T3-L1 adipocytes MDI MDI 1%, 2% 3% 4 9 fatty acid synthase (FAS) mrna fatty acid binding protein ap2 adipsin mrna. FAS mrna ap2 mrna 4, 9 2% 3%. adipsin mrna 4 9 (Figure 4). 4. 3T3-L1 adipocytes adipokines MDI MDI 1%, 2% 3% 4 9 leptin, UCP2, adiponectin adipokines. Leptin mrna 4, 9 1% 2% 3T3-L1 3T3-L1 adipocytes in vivo adipocytes 3T3-L1 Triglycerol (TG)

5 3T3-L T3-L1 (Figure1 and 2) camp adipogenetic signal CCAAT/enhancer-binding protein (C/EBP) C/EBP adipogenesis peroxisome proliferator-activated receptor (PPAR) C/EBP family PPAR family C/EBP C/EBP C/EBP PPAR C/EBP PPAR adipogenesis leptin, fatty acid synthase (FAS) fatty acid binding protein (ap2) adipogenic gene PPAR PPAR PPAR C/EBP, C/EBP, C/EBP PPAR mrna C/EBP C/EBP mrna C/EBP PPAR mrna (Figure 3) FAS mrna ap2 adipsin mrna (Figure 4) leptin, UCP adiponectin mrna Leptin UCP (uncoupling protein) 2 Adiponectin 2 adiponectine leptin adipokines dedifferentiation V 3T3-L1 1. 3T3-L1 2. C/EBP C/EBP

6 mrna C/EBP PPAR mrna FAS mrna ap2 adipsin mrna 3. leptin, UCP adiponectin mrna dedifferentiation 1. Stein CJ, C.G., The epidemic of obesity. J Clin Endocrinol Metab, : p Kopelman, P., Obesity as a medical problem. Nature, : p Ahima RS, F.J., Adipose tissue as an endocrine organ. Trends Endocrinol Metab., (8): p Kim, M., Updates in treating obesity. Korean J Health Psychol., : p Reddy P, C.M., Focus on orlistat: A nonsystemic inhibitor of gastrointestinal lipase for weight reduction in the management of obesity. Formulary, : p Seo, Y., Patent trend of anti-obesity supplmentary food. Food World, : p Lee SZ. Compendium of Materia Medica. 2007, Yeoil Nogami M, I.M., Kubo M, Takahashi M, Kimura H, Matsuike Y., Studies on Ganoderma lucidum. VII. Anti-allergic effect. (2) Yakugaku Zasshi., (7): p Futrakul N, B.M., Patumraj S, Siriviriyakul P, Tosukhowong P, Futrakul P., Treatment of glomerular endothelial dysfunction in steroidresistant nephrosis with Ganoderma lucidum, vitamins C, E and vasodilators. Clin Hemorheol Microcirc., (3-4): p Chen WQ, L.S., Ll HZ, Yang H., Effects of ganoderma lucidum polysaccharides on serum lipids and lipoperoxidation in experimental hyperlipidemic rats. Zhongguo Zhong Yao Za Zhi, (17): p Qi G, H.H., Gao Y, Lin Q, Yu GY, Effects of Ganoderma lucidum spores on sialoadenitis of nonobese diabetic mice. Chin Med J (Engl), (5): p Lin, Z.B., Cellular and molecular mechanisms of immuno-modulation by Ganoderma lucidum. J Pharmacol Sci., (2): p Jiang J, G.B., Thyagarajan A, Sliva D, Ganoderic acids suppress growth and invasive behavior of breast cancer cells by modulating AP-1 and NF-kappaB signaling. Int J Mol Med., (5): p Lee DH. Incurable Disease and herbal pharmacopuncture therapy. Journal of Korean pharmacopuncture institute, (1): p Lee CW, Yoon HM, Kang KH, The effects of Ganoderma lucidum herba pharmacopuncture on 3T3-L1 preadipocyte differentiation. Journal of Korean pharmacopuncture institute, (3): p MacDougald OA, H.C., Fan H, Lane MD Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes. Proc Natl Acad Sci USA, (20): p Klaus, S., Adipose tissue as a regulator of energy balance. Curr Drug Targets., (3): p ` 18. Koldovsky O, D.M., Drahota Z, Hahn P., Developmental aspects of lipid metabolism. Physiol Res., (6): p Gregoire FM, S.C., Sul HS, Understanding adipocyte differentiation. Physiol Rev.,

3T3-L1 19 1998. 78: p. 783-809. 20. Camp HS, R.D., Leff T., Adipogenesis and fatcell function in obesity and diabetes. Trends Mol Med., 2002. 8(9): p. 442-447. 21. Long SD, P.

Annu Rev Cell Dev Biol., 1997. 13: p. 231-259. 23. Ceddia RB, W.W.J.

7 3T3-L : p Camp HS, R.D., Leff T., Adipogenesis and fatcell function in obesity and diabetes. Trends Mol Med., (9): p Long SD, P.P., Lipid mediators of insulin resistance: ceramide signalling down-regulates GLUT4 gene transcription in 3T3-L1 adipocytes. Biochem J., : p Hwang CS, L.T., Mandrup S, Lane MD, Adipocyte differentiation and leptin expression. Annu Rev Cell Dev Biol., : p Ceddia RB, W.W.J., Lima FB, Flandin P, Curi R, Giacobino JP, Leptin stimulates uncoupling protein-2 mrna expression and Krebs cycle activity and inhibits lipid synthesis in isolated rat white adipocytes. Eur J Biochem., (19): p Berg AH, C.T., Du X, Brownlee M, Scherer PE., The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med., (8): p Antuna-Puente B, F.B., Fellahi S, Bastard JP., Adipokines: the missing link between insulin resistance and obesity. Diabetes Metab., (1): p Table 1. Primers for RT-PCR Target mrna SEQUENCE(5-3 ) C/EBP F GTGTGCACGTCTATGCTAA R GCCGTTAGTGAAGAGTCTC C/EBP F GTTTCGGGAGTTGATGCAA R AACAACCCCGCAGGAACAT C/EBP F GATCTGCACGGCCTGTTGT R CTCCACTGCCCACCTGTCA PPAR F CGCTGATGCACTGCCTATG R TGCGAGTGGTCTTCCATCA FAS F TGGTGGGTTTGGTGAATTG R GCTTGTCCTGCTCTAACTG ap2 F CCAATGAGCAAGTGGCAAG R GATGCCAGGCTCCAGGATA Leptin F CCAAAACCCTCATCAAGAC R CTCAAAGCCACCACCTCTG Adiponectin F GGAGATGCAGGTCTTCTTGG R TCCTGATACTGGTCGTAGGT UCP2 F AACAGTTCTACACCAAGGGC R AGCATGGTAAGGGCACAGTG Adipsin F CTGCTGGACGAGCAGTGG R GATGACACTCGGGTATAGT 1&S F GTAACCCGTTGAACCCCATT R CCATCCAATCGGTAGTAGCG F: forward, R: reverse Figure 1. Effects of GL on the 3T3-L1 preadipocytes differentiation. 3T3-L1 adipocytes were observed 4 and 9 days after the initiation of differentiation and were treated with 1-3% of GL (B) for 72 h at 37 C in a humidified 5% CO2 incubator. (A) undifferented cells, (B) Control was treated with MDI to induce differentiation, (C, D, and E) MDI and 1%, 2%, and 3% of GL were treated Figure 2. Effects of GL on oil red O stained material in 3T3-L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation and were stained with oil red O (A). Cells were treated with 1-3% of GL (B) for 72 h at 37 C in a humidified 5% CO2 incubator. Cells were stained with oil red O. The reported values are the means SD (n = 4). a; p 0.05 vs undifferentiated cells, b; p 0.05 vs differentiated cells

20 12 2 2009 6 Figure 3. Effect of GL on mrna levels of C/EBP and C/EBP (A), and C/EBP and PPAR (B) in 3T3- L1 adipocytes.

1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated Figure 5.

1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated Figure 4.

8 Figure 3. Effect of GL on mrna levels of C/EBP and C/EBP (A), and C/EBP and PPAR (B) in 3T3- L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation. Cells were treated with 1-3% of GL for 72 h at 37 C in a humidified 5% CO2 incubator. 1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated Figure 5. Effect of GL on mrna levels of Leptin, UCP2, and Adiponectin in 3T3-L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation. Cells were treated with 1-3% of GL for 72 h at 37 C in a humidified 5% CO2 incubator. 1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated Figure 4. Effect of GL on mrna levels of FAS, ap2 and adipsin in 3T3-L1 adipocytes. 3T3-L1 adipocytes were harvested 4 and 9 days after the initiation of differentiation. Cells were treated with 1-3% of GL for 72 h at 37 C in a humidified 5% CO2 incubator. 1: undifferented cells, 2: Control was treated with MDI to induce differentiation, 3, 4, and 5: MDI and 1%, 2%, and 3% of GL were treated

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract