18 (03-10-OK).hwp
|
|
- 지유 상
- 5 years ago
- Views:
Transcription
1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 44(7), 1084~1089(2015) 연구노트 감귤유산균발효물의항균활성과 ACE 저해능 최소연 1 김시경 1 윤은영 1 강대욱 2 최낙식 2 문미선 3 이승철 1 1 경남대학교식품생명학과 2 창원대학교생명보건학부 3 제주담아 Antimicrobial and ACE Inhibitory Activities of Citrus unshiu Fermented with Lactic Acid Bacteria SoYeon Choi 1, SiKyung Kim 1, UnYoung Youn 1, DaeOok Kang 2, NackShick Choi 2, MiSun Mun 3, and SeungCheol Lee 1 1 Department of Food Science and Biotechnology, Kyungnam University 2 Department of Bio Health Science, Changwon National University 3 Jeju Dama Co., Ltd. ABSTRACT To develop high quality citrus products, seven lactic acid bacteria were innoculated onto ground citrus (Citrus unshiu) and cultured for 10 days. On culture days 0, 3, 5, 7, and 10, citrus ferments were withdrawn, and their antimicrobial and angiotensinⅠ converting enzyme (ACE) inhibitory activities were evaluated. Citrus ferments innoculated with and, which were isolated from kimchi, showed relatively higher antimicrobial activities against food poisoning bacteria. Citrus ferments innoculated with and also showed stronger ACE inhibitory activities than other ferments. and showed more than 99% homogeny with Pediococcus acidilactici and Lactobacillus sakei, respectively, by 16S rrna gene analysis. These results indicate that fermentation with P. acidilactici and L. sakei might contribute to the increased antimicrobial and antihypertensive activities of citrus. Key words: citrus, ferment, lactic acid bacteria, antimicrobial, ACE inhibitory activity 서 감귤은운향과 (Rutaceae) 에속하는과실을총칭한명칭이며, 식용으로이용되는종류는감귤속 (Citrus) 에많고오렌지류, 레몬류, 유자류등의많은종류가있지만우리나라에서는온주밀감 (Citrus unshiu) 에주로한정하여부르고있다. 온주밀감은주요감귤중가장낮은온도에견디는품종으로제주도에서널리재배되고있다 (1). 감귤에는 carotenoid, flavonoid, cellulose, pectin, limonoid, 비타민류등의다양한생리활성물질들이다량함유되어있어항산화, 항염, 항암등다양한생리적작용을나타낸다고보고되어있다 (2). 감귤은생과형태로주로소비가되고일부는착즙하여주스가공으로이용되어왔다. 국가통계포털에의하면우리나라의감귤은 2011년 21,424 ha에서경작되어약 68 만톤이생산되었으며, 그중약 10만톤이가공되었다 (3). 감귤은우리나라에서가장많이생산되는과실이지만 1인당 Received 10 March 2015; Accepted 26 May 2015 Corresponding author: SeungCheol Lee, Department of Food Science and Biotechnology, Kyungnam University, Changwon, Gyeongnam , Korea sclee@kyungnam.ac.kr, Phone: 론 연간소비량은계속감소할것으로예상되고있다 (4). 이에초콜릿, 크런치, 말랭이등의다양한감귤가공제품이개발되어판매되고있으며, 머핀 (5), 식초 (6), 양갱 (7), 식빵 (8) 등의다양한제품개발이연구되고있다. 한편유산균 (lactic acid bacteria) 은당류를발효하여젖산및다양한대사산물을생산하는미생물로최근에는건강증진과질병을예방하고자하는 probiotics로서의연구가폭넓게진행되고있으며, 각종발효식품, 사료첨가제등의제조에널리이용되고있다 (9). 또한발효식품을통하여인체내로섭취한유산균은장내로유입되어유익균주의생육을부양하고유해세균을억제하여장내유용미생물의균형을유지시킨다. 그리고항산화작용, 항암작용, 면역활성화작용, 혈중콜레스테롤저하등의작용이있어질병을예방하는데도움이된다고보고되어있다 (10). 유산균의이러한기능성을바탕으로근래오미자유산균발효물 (11), 유산균발효마늘추출물 (12), 유산균발효밤송이추출물 (13) 등이연구되었다. 본연구의목적은고품질감귤가공제품개발에활용한목적으로감귤을유산균으로발효시켜생리활성을향상시키고자하였다. 이를위해미생물자원센터 (Korean Collection for Type Cultures(KCTC), Daejeon, Korea) 로부터
2 감귤유산균발효물의항균활성과 ACE 저해능 1085 분양한유산균 5종과김치에서분리한 2종의유산균을이용하여감귤을발효시켰고, 발효과정중의항균활성과 angiotensin converting enzyme(ace) 저해능을분석하였다. 재료및방법재료및시약본실험에사용된감귤은 2014년 7월에제주도에서시판되는온주밀감 (Citrus unshiu) 을구입하여사용하였다. 항균활성을위한미생물배지는모두 Becton, Dickinson and Company(Sparks, MD, USA) 의제품을사용하였다. ACE 저해능분석을위한시약인 captopril, hippuryl histidine leucine(hhl), rabbit lung acetone powder는 Sigma Aldrich Co.(St. Louis, MO, USA) 에서구입하였다. 그외의시약은모두 1급이상을사용하였다. 사용균주및배양조건감귤발효를위해미생물자원센터에서 5종의균주 [Enterococcus faecalis KCTC 2011(), Enterococcus lactis KCTC 21015(), Lactobacillus acidophilus KCTC 3140(), Lactobacillus plantarum KCTC 3104(), Leuconostoc mesenteroides KCTC 3505()] 를분양받아이용하였다. 또한김치에서유산균분리를위하여시료에 0.85% 생리식염수를이용하여적정농도로희석하고선택배지에도말하여 1차선별을하였다. 분리원으로부터항균활성을갖는미생물균주를 1차선별하기위하여 MRS 혹은 LB 평판배지에각각 10 4 ~10 3 으로희석한시료를도말하고 30 C 항온배양기에서 20시간이상배양하여 CL 1과 를분리하여이용하였다. 감귤발효를위한실험에서모든균주의전배양은 MRS 액체배지 (Difco, Detroit, MI, USA) 에서 30 C, 100 rpm, 2일간진탕배양하여활성화시키고감귤마쇄물에접종하였다. 감귤발효물제조감귤을수돗물로깨끗이세척한후증류수로다시세척하였다. 발효과정중오염을방지하기위하여세척한감귤표면에자외선 (G30T8 germicidal lamps, Sankyo Denki Co., Ltd., Kanagawa, Japan) 을 15분간조사하였다. 그리고마쇄기 (HBL3500S, 삼양전자, 김포, 한국 ) 를이용하여감귤을고르게분쇄한후미리멸균한 1,000 ml 플라스크에 270 g의감귤마쇄물을준비하였다. MRS 액체배지에서전배양된 7종의유산균을각각 30 ml씩감귤마쇄물에접종한후, 30 C, 100 rpm의진탕배양기 (DS250SW, 대원과학, 부천, 한국 ) 에서 3, 5, 7, 10일간발효시킨후발효물을회수하였다. 각발효물을원심분리 (4 C, 10분, 5,000 g) 하여상징액을 Whatman No.1 여과지 (Advantec, Tokyo, Japan) 로통과시킨여과액을각분석의시료로사용하였다. 대조구로는유산균대신멸균증류수를첨가하여이용하였다. 항균활성 0.5% yeast extract agar plate 위에항균시험균주배양액 1% 와 0.1 M phosphate buffer(ph 7.0) 를포함한 0.8% NB soft agar 10 ml를중층하여 test plate를제조하였다. 감귤발효물시료 50 μl를 test plate에 spotting 하고건조한후, 37 C 항온배양기에서 12시간이상배양하여항균시험균주에대한투명환형성유무를조사하고항균활성을측정하였다. 항균활성에이용한균주는다음과같다. Bacillus cereus KCTC 1013, Enterococcus faecium KCTC 3095, Escherichia coli AB 1041, Micrococcus luteus IAM 1056, Salmonella Typhimurium KCTC 1926, 그리고 Staphylococcus aureus subsp. aureus KCTC ACE 저해능 ACE 저해능은 Cushman과 Cheung(14) 의방법에따라측정하였다. 50 mm sodium borate buffer(ph 8.3) 20 ml 에 1 g의 rabbit lung acetone powder를 4 C에서 24시간동안교반한후, 10분간원심분리 (4 C, 5,000 g) 하여 ACE 조효소액을얻었다. 증류수를가하여 20배로희석한시료 50 μl에 ACE 조효소액 50 μl를가하여 37 C에서 10분간방치한후, 25 mm HHL 100 μl를첨가하여 37 C에서 60분간반응시켰다. 1 M HCI 250 μl를가하여 30초간교반하고원심분리 (4 C, 10분, 5,000 g) 하여상징액 200 μl를얻었다. 이상징액을 80 C에서 30분간완전히건조시켜증류수 1 ml를넣은후에 228 nm에서흡광도를측정하였다. 대조군은추출물대신증류수를가해실험하였으며, 양성대조군으로 captopril을사용하였다. ACE 저해능은다음계산식을이용하여구하였다. ACE 저해능 (%)=1 시료첨가구의흡광도무처리구의흡광도 균주동정김치에서분리하여본연구에사용된유산균 과 CL 2를 16S rrna 유전자분석으로동정하였다. Colony 형태로균주를솔젠트사 ( 대전, 한국 ) 에송부하여유전자분석을의뢰하였다. 16S rrna sequencing에사용되는 universal primer인 27F primer(5'agagtttgatcctggctcag 3') 와 1492R primer(5'ggttaccttgttacgactt 3') 를이용하여 polymerase chain reaction(pcr) 을실시하였다. Capillary DNA Sequencer(3730XL, Applied Biosystems, Grand Island, NY, USA) 를이용하여염기서열을분석하였고, 분석된염기서열을이용하여 NCBI(National Center for Biotechnology Information, nlm.nih.gov/) 의 blast search를통해상동성을조사하여동정하였다. 통계처리모든실험은 3회반복으로이루어졌으며, 그결과 SPSS
3 1086 최소연 김시경 윤은영 강대욱 최낙식 문미선 이승철 software(ver. 12.0K, SPSS Inc., Chicago, IL, USA) 를사용하여처리하였다. 각측정군의평균과표준편차를산출하고 Duncan의다중범위검정 (Duncan's multiple range test) 으로유의성을검정하였다. 모든처리값의차이는신뢰수준 95%(P<0.05) 로비교분석하였다. 결과및고찰항균활성 7종의유산균을접종하여배양한감귤발효물시료의항균활성을 6종의병원성미생물 (B. cereus, Ent. faecium, E. coli, M. luteus, Sal. Typhimurium, S. aureus) 을대상으로조사하여그결과를 Table 1에나타내었다. 유산균을별도로첨가하지않고감귤만을배양한발효물 () 의경우실험에사용된모든균주에대해항균활성을나타나지않았으며, (Ent. lactis), (Ent. faecalis), (Lac. acidophilus) 균주로발효시킨감귤발효물들도항균활성을보이지않았다. (Leu. mesenteroides) 균감귤발효물은 B. cereus, E. coli, Sal. Typhimurium에대해약한항균 활성을보였다. (Lac. plantarum) 균감귤발효물은모든대상균주에대하여약한항균활성을보였다. 김치에서분리한유산균 과 균감귤발효물은비교적항균활성이강하였다. 특히 균감귤발효물은발효기간이증가할수록항균활성이가장증가하여발효 10일째에는 Ent. faecium 균주를제외하고모든대상균주에대해강한항균활성을나타내었다. 이는감귤에서유산균이발효하는과정에서생성된대사산물에기인하는것으로생각된다. Cho 등 (15) 은자연발효한오미자발효액에서원래항균활성이없었으나발효에의해오미자액이 E. coli 균주에대해항균활성을나타낸바있다. 한편본연구에서항균활성의대상으로이용한 B. cereus는식품부패의원인균으로대부분비병원성균이지만일부는식중독의원인으로독소형과설사형으로분류되며, Ent. faecium은병원성으로수막염을유발하며, E. coli는대부분비병원성균이지만일부는장염성의병원성이있고, M. luteus는일상환경에널리존재하는미생물이며호염성이있고환자에게감염되기도하며, Sal. Typhimurium과 S. aureus는대표적인식중독균이다. Table 1. Antibacterial effect of extracts from fermented Citrus unshiu Microorganism Sample 1) Fermentation day Microorganism Sample 1) Fermentation day Bacillus cereus Escherichia coli Salmonella Typhimurium Enterococcu faecium Micrococcus luteus Staphylococcus aureus 1), unfermented citrus;, fermented citrus without starter. Fermented citrus with, Enterococcus lactis;, Enterococcus faecalis;, Leuconostoc mesenteroides;, Lactobacillus acidophilus;, Lactobacillus plantarum;, a lactic acid bacteria isolated from kimchi; and, another lactic acid bacteria isolated from kimchi. 2) Antibacterial activity:, nondetected;, <1.0 mm;, mm; and, >1.5 mm of hallow size.
4 감귤유산균발효물의항균활성과 ACE 저해능 1087 ACE 저해능인체내에존재하는 renin은 angiotensinogen을 angiotensin Ⅰ로분해하고, 비활성의 angiotensin Ⅰ은 ACE에의해혈관수축작용이있는 angiotensin Ⅱ가된다. 이 angiotensin Ⅱ는동맥혈관을수축하여혈압을상승시키고, 부신에서 aldosterone의분비를촉진하여신장의나트륨및수분의재흡수를증가시킴으로써고혈압발병에관여한다 (16). 감귤발효물시료를 20배희석하여 ACE 저해활성을측정한결과를 Fig. 1에나타내었다. ACE 저해능은 4.62± 2.71~86.22±1.57% 의범위를보이는데, 20배희석한추출물임에도 7일과 10일발효한, 감귤발효물시료는 80% 가넘는높은 ACE 저해능을보였다. 한편양성대조군인 captopril은 2 μg/ml 농도에서 91% 의 ACE 저해능을유발하였다. 그러나 발효추출물은오히려발효기간이길어질수록 38.17% 에서 14.19% 로감소하였다. 부추당침액의유산균발효에따른 ACE 저해능경우에는유산균종류에따라 50.4~67% 의 ACE 저해능을보이며 (17), 이것은사용된유산균의종류는다르지만본연구가더높은저해능을보이는것을확인할수있었다. 또한 ACE 저해능은주로단백질이나펩티드에의해유발되는데 (18) 유산균을이용하여발효한감귤추출물에서생성된산물이단백질, 펩티드로이루어졌을가능성이커보이며이로인해 ACE 저해능이우수하게나타난것으로사료된다. 균주동정김치에서분리되어감귤의발효과정에서높은항균활성을보인유산균균주 과 를동정하기위해서 PCR 로 16S rrna 유전자를증폭시킨후염기서열을결정하고, 이를 NCBI의 GenBank에등록된유전자들과상동성을비교한결과 은 Pediococcus acidilactici와, 는 Lactobacillus sakei와 99% 이상의상동성을보였다 (Fig. 2). P. acidilactici는김치 (19) 와막걸리 (20) 에서분리되어보고된바있으며, Pediococcus 속에서생성된박테리오신은총칭하여 pediocin이라명명되고있다 (21,22). P. acidilactici의 pediocin은특히 Listeria monocytogenes에강한항균력을보였다 (23). Lac. sakei는당으로부터알코올 또는유산균을생성하는젖산균으로 sakacin이라는박테리오신을생성한다 (24). 박테리오신은펩타이드, 단백질로구성된항균성물질로같은환경에서자라는다른미생물에대한경쟁적인저해제로다양한미생물에서분리된다 (25). 특히유산균은김치발효에중요한역할을하고다양한항균물질을생산하는것으로알려졌으며, 박테리오신의항균범위는매우광범위하여부패균, 식중독균, 전염병균이나포자형성균등의증식을억제하거나사멸시키는데효과적이다 (26). 박테리오신은항생제와달리단백질로구성되어인체에들어오면소화기관내에서단백질가수분해효소에의해쉽게분해되어인체에무독성이고잔류성이없다. 항생제는 2차대사산물인데비해박테리오신은자신의유전자로부터직접생합성된다 (27). Lac. sakei가생산하는 sakacin은 A, G, K, P, Q형이보고되어있는데, 그중에서 A형과 P형이잘알려져있다 (28). 본연구에서확인된 Lac. sakei가생산하는 sakacin은저해범위가좁은박테리오신이아니라 Streptococcus lactis가생성하는박테리오신인 nisin(29) 과같이저해범위가매우넓은것을알수있었다. 한편 P. acidilactici로생선풀 (surimi) 을발효시켰을때생성된아미노화합물에의해 ACE 저해능을보인다고보고되었다 (30). 또한육류유래 Lac. sakei로돼지골격근을분해하였을때생성되는펩티드가 ACE 저해능을보이는것도확인되었다 (31). 이상으로볼때본연구에서이용된 P. acidilactici와 Lac. sakei 균주도감귤의발효과정에서생성한대사물질이 ACE 저해능을유발한것으로유추할수있었다. 요약고품질감귤가공품개발을위하여감귤에 7종의유산균을각각접종하여 10일간배양하면서 0, 3, 5, 7, 10일째의발효물의생리활성을분석하였다. 병원성미생물에대한감귤발효물의항균활성을측정한결과김치에서분리한유산균인 과 의발효물이발효기간이길어질수록강한항균활성이나타났다. 또한각감귤발효물의항고혈압활성을 ACE 저해능으로분석하였을때 과 의발효 ACE inhibitory activity (%) aw bx cx cx dy cw d ew dz eey bcz cz ay efy fy by dx y dz dyx exw e fx gw cy by cx d dw ev bz ex ew cy d dw ew Day bx cz fv Fig. 1. Angiotensin converting enzyme (ACE) inhibitory activity of fermented Citrus unshiu ( 20 dilution). Values are means±sd of triplicate experiments. Different letters (ag and vz) above the bars are significantly different (P<0.05) within same days and same lactic acid bacteria fermentation, respectively. Groups are the same as in Table 1.
5 1088 최소연 김시경 윤은영 강대욱 최낙식 문미선 이승철 A B Fig. 2. Phylogenetic trees of related to Pediococcus acidilactici (A) and related Lactobacillus sakei (B).
6 감귤유산균발효물의항균활성과 ACE 저해능 1089 물이발효기간이길수록높은활성을나타내었다. 과 균주를 16S rrna gene의구조로분자계통학적유연관계를파악한결과각각 Pediococcus acidilactici 및 Lactobacillus sakei와 99% 이상의상동성을가지는것을확인할수있었다. 이상의결과는감귤을 P. acidilactici와 Lac. sakei로발효하여항균력과항고혈압능이증진된가공품의제조에활용이가능함을시사한다. 감사의글 본논문은중소기업청에서지원하는 2013년도산학연공동기술개발 (No. C ) 의연구수행으로인한결과물임을밝힙니다. RERENCES 1. The Korean Society of Food and Nutrition Food nutrition dictionary. Korea Dictionary Research Publishing, Seoul, Korea. p Silalahi J Anticancer and health protective properties of citrus fruit components. Asia Pac J Clin Nutr 11: Korean Statistical Information Service. Html/statHtml.do?orgId=101&tblId=DT_1ET0292&vw_cd =MT_ZTITLE&list_id=F1H&seqNo=&lang_mode=ko&lan guage=kor&obj_var_id=&itm_id=&conn_path=e1 (accessed Feb 2015). 4. Jejuilbo. idxno= (accessed Feb 2015). 5. Oh SW, Chung KH Physicochemical and sensory properties of muffins with added powdered tangerine peel. Food Eng Prog 18: Yi MR, Hwang JH, Oh YS, Oh HJ, Lim SB Quality characteristics and antioxidant activity of immature Citrus unshiu vinegar. J Korean Soc Food Sci Nutr 43: Cha MA, Chung HJ Quality characteristics of Yanggaeng supplemented with freezedried Citrus mandarin powder. Korean J Food Culture 28: Lee EJ, Ju HW, Lee KS Quality characteristics of pan bread added with citrus mandarin peel powder. Korean J Culinary Res 18: Kanmani P, Satish Kumar R, Yuvaraj N, Paari KA, Pattukumar V, Arul V Probiotics and its functionally valuable productsa review. Crit Rev Food Sci Nutr 53: Masood MI, Qadir MI, Shiri JH, Khan IU Beneficial effects of lactic acid bacteria on human beings. Crit Rev Microbiol 37: Lee JH, Kim JI, Choi HJ, Lee JH Antiwrinkle effect of Schizandra chinensis baillon fermented with Lactobacillus plantarum. J Soc Cosmet Sci Korea 40: Lee HS, Lim WC, Choi JH, Yu HJ, Kim KH, Lee SH, Cho HY Ameliorating effects of lactic acidfermented garlic extracts on oleic acidinduced hepatic steatosis. Korean J Food Sci Technol 46: Jun DH, Cho WA, Lee JB, Jang MJ, You MS, Park JY, Kim SH, Lee JT Antioxidant activity of chestnut (Castanea crenata S.et Z.) bur fermented by Lactobacillus casei. J Life Sci 24: Cushman DW, Cheung HS Spectrophotometric assay and properties of the angiotensinconverting enzyme of rabbit lung. Biochem Pharmacol 20: Cho EK, Cho HE, Choi YJ Antioxidant and antibacterial activities, and tyrosinase and elastase inhibitory effect of fermented Omija (Schizandra chinensis Baillon.) beverage. J Appl Biol Chem 53: Sun TS, Zhao SP, Wang HK, Cai CK, Chen YF, Zhang HP ACEinhibitory activity and gammaaminobutyric acid content of fermented skim milk by Lactobacillus helveticus isolated from Xinjiand koumiss in China. Eur Food Res Technol 228: Lee JB, Bae JS, Son IK, Jeon CP, Lee EH, Joo WH, Kwon GS Antioxidant and ACE inhibiting activities of sugaredbuchu (Allium ampeloprasum L. var. porum J. Gay) fermented with lactic acid bacteria. J Life Sci 24: Fujita H, Yokoyama K, Yoshikawa M Classification and antihypertensive activity of angiotensin Ⅰconverting enzyme inhibitory peptides derived from food proteins. J Food Sci 65: Choi SY, Jung BM, Kim HJ, Seong SH, Kim WJ, Park WS Extracellular enzyme activities of the lactic acid bacteria isolated from kimchi. Kor J Appl Microbiol Biotechnol 28: Kwon SJ, Ahn TY, Shon JH Analysis of microbial diversity in makgeolli fermentation using PCRDGGE. J Life Sci 22: Kwon DY, Koo MS, Ryoo CR, Kang CH, Min KH, Kim WJ Bacteriocin produced by Pediococcus sp. in kimchi and its characteristics. J Microbiol Biotechnol 12: Elegado FB, Kim WJ, Kwon DY Rapid purification, partial characterization, and antimicrobial spectrum of the bacteriocin, Pediocin AcM, from Pediococcus acidilactici M. Int J Food Microbiol 37: Anastasiadou S, Papagianni M, Filiousis G, Ambrosiadis I, Koidis P Pediocin SA1, an antimicrobial peptide from Pediococcus acidilactici NRRL B5627: production conditions, purification and characterization. Bioresour Technol 99: Moretro T, Aasen IM, Storro I, Axelsson L Production of sakacin P by Lactobacillus sakei in a completely defined medium. J Appl Microbiol 88: Kim HK, Lee KH, Kim JH Bacteriocins produced by lactic acid bacteria isolated from Kimchi. J Agric Life Sci 38: Drider D, Fimland G, Héchard Y, McMullen, Prévost H The continuing story of class Ⅱa bacteriocins. Microbiol Mol Biol Rev 70: Cleveland J, Montville TJ, Nes IF, Chikindas ML Bacteriocins: safe, natural antimicrobials for food preservation. Int J Food Microbiol 71: Sablon E, Contreras B, Vandamme E Antimicrobial peptides of lactic acid bacteria: mode of action, genetics and biosynthesis. Adv Biochem Eng Biotechnol 68: Oh SJ, Lee JH, Kim GT, Shin JG, Baek YJ Anticarcinogenic activity of a bacteriocin produced by Lactococcus sp. HY 449. Food Sci Biotechnol 12: Shan J, Ogawa Y, Watanabe T, Morimoto R, Oota S, Seiki M, Miyamoto T Angiotensin Ⅰconverting enzyme inhibitory activity of fermented surimi by lactic acid bacteria. Nippon Shokuhin Kagaku Kogaku Kaishi 54: Castellano P, Aristoy MC, Sentandreu MÁ, Vignolo G, Toldrá F Peptides with angiotensin Ⅰ converting enzyme (ACE) inhibitory activity generated from porcine skeletal muscle proteins by the action of meatborne Lactobacillus. J Proteomics 89:
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More informationμ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information( ).fm
Korean J. Food Sci. Ani. Resour. Vol. 30, No. 2, pp. 286~290(2010) ARTICLE Ovotransferrin 가수분해물의 Angiotensin-converting Enzyme 활성억제효과및생산최적화 이나경 안동욱 1 박근규 2 백현동 * 건국대학교동물생명과학부및생명분자정보학센터 1 아이오와주립대학교동물과학과및서울대학교
More information43(2)-10(단보)023(p ).fm
The Korean Journal of Microbiology, Vol. 43, No. 2, June 2007, p. 142-146 Copyright 2007, The Microbiological Society of Korea Ginsenoside y ƒ w z ½ ³Á½» Á * w w w œw l (Panax ginseng) z w x š. ù, w š
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information가자미식해의제조공정최적화 37., (Choi et al., 200).. 재료 재료및방법 (Verasper Jordan et Gilbert;, ), (, ), (, ) (, )., (, ), (, ), (, ), (, ), (, ), (, ). 가자미식해제조 (round
한수지 48(), 036-043, 205 Original Article Kor J Fish Aquat Sci 48(),036-043,205 반응표면분석법을이용한가자미 (Verasper moseri Jordan et Gilbert) 식해제조최적화 한대원 김덕기 한호준 조순영 2 * 강릉원주대학교식품과학과, 강릉원주대학교동해안해양생물자원연구센터, 2 강릉원주대학교식품가공유통학과
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationDBPIA-NURIMEDIA
J East Asian Soc Diet Life 27(3): 348 363 (2017) http://dx.doi.org/10.17495/easdl.2017.6.27.3.348 348 1 1 2 1 1, 2 Mixed Culture Characteristics of Fungi Strains isolated from Korean Traditional Nuruk
More information22 (07-29-OK).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 43(2), 328~332(2014) http://dx.doi.org/10.3746/jkfn.2014.43.2.328 김치의저장성향상을위한항균활성우수유산균선발 연구노트 최학종 1 김유진 1 이나라 1 박해웅 1 장자영 1 박성희 1 강미란 1 김현주 1 이종희 1 이종훈 2 변유량 3 김태운
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
More information(1) 04. 오계헌.fm
Korean Society for Biotechnology and Bioengineering Journal 28(1): 1823 (2013) http://dx.doi.org/10.7841/ksbbj.2013.28.1.18 연구논문 장기간발효김치인묵은지에서분리한 Lactobacillus sakei JK17 의기능성조사 김동선, 조형우, 김대한, 오계헌 * Functional
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information409.fm
한국식생활문화학회지 28(4): 401-408, 2013 KOREAN J. FOOD CULTURE 28(4): 401-408, 2013 본논문의저작권은한국식생활문화학회에있음. Copyright The Korean Society of Food Culture ISSN 1225-7060 http://dx.doi.org/10.7318/kjfc/2013.28.4.401
More information<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 251-255 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.251 ISSN 1225-7117 / eissn 2288-8268 Research Paper 유산균의생존율향상을위한동결건조보호제로서호박분말의효과
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information9(3)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationePapyrus PDF Document
육아지원연구 2008. 제 3권 1 호, 147-170 어린이집에서의 낮잠에 대한 교사와 부모의 인식 및 실제 이 슬 기(동작구 보육정보센터)* 1) 요 약 본 연구의 목적은 어린이집에서의 일과 중 낮잠 시간에 대한 교사와 부모의 인식 및 실제를 알아봄 으로써, 교사와 부모의 협력을 통해 바람직한 낮잠 시간을 모색해 보는 데 있었다. 연구 대상은 서울, 경기지역
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information46(6)완결.indd
한수지 46(6), 689-695, 2013 Original Article Kor J Fish Aquat Sci 46(6),689-695,2013 가자미 (Verasper moseri Jordan et Gilberu) 식해의최적발효조건 ( 온도및염도 ) 한대원 1 한호준 김덕기 임미진 1 조순영 2* 강릉원주대학교식품과학과, 1 강릉원주대학교동해안해양생물자원연구센터,
More informationpissn eissn J. Milk Sci. Biotechnol. 2019;37(2): ARTICLE 전통김치로부터 Probiotic 유산균의
pissn 2384-0269 eissn 2508-3635 J. Milk Sci. Biotechnol. 2019;37(2):115-128 https://doi.org/10.22424/jmsb.2019.37.2.115 ARTICLE 전통김치로부터 Probiotic 유산균의분리및우유발효특성 임영순 * 김지연 강현철 서울에프엔비식품연구소 Isolation and Identification
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information41.4(8) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 41, No. 4, pp. 399~404 (2009) The Korean Society of Food Science and Technology Bacillus subtilis Lactobacillus plantarum yw t e w Á û * œ w tœw Effect of the Mixed Culture
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More information목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의
K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting
More information67-72
40 1, 025 029 (2013) Korean J. Poult. Sci. Vol.40, No.1, 025 029 (2013) http://dx.doi.org/10.5536/kjps.2013.40.1.025 25 Assessment of Antimicrobial and Antioxidant Effects of Ripened Medicinal Herb Extracts
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information43(2)-3(009)(p ).fm
The Korean Journal of Microbiology, Vol. 43, No. 2, June 2007, p. 124-129 Copyright 2007, The Microbiological Society of Korea ½e w Lactococcus lactis W-44 w z e e w ½ 1 Á 2 Á 3 Á½ 4 Á½ 5 Á 6 Á 7 Á 1 Á½
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information43-4(08) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 43, 4, pp. 446~452 (2011) The Korean Society of Food Science and Technology 김치에서항균활성유산균의분리및동정 김수영 1 김종두 1 손지수 1 이시경 2 박갑주 3 박명수 * 안양과학대학호텔조리과, 1 건국대학교생명과학과, 2 건국대학교응용생명과학부,
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information<B1A4B0EDC8ABBAB8C7D0BAB8392D345F33C2F75F313032362E687770>
광고에 나타난 가족가치관의 변화 : 97년부터 26년까지의 텔레비전 광고 내용분석* 2) 정기현 한신대학교 광고홍보학과 교수 가족주의적 가치관을 사회통합의 핵심 중의 핵심으로 올려놓았던 전통이 현대사회에서 아직 영향력을 미치는 점을 감안할 때, 한국에서의 가족변동은 사회전반의 변동으로 직결된다고 해도 크게 틀리지 않을 것이다. 97년부터 26년까지 텔레비전에서
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More information2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70
경상남도 고시 제2010-46호 하천기본계획 고시 하천법 제25조 및 같은 법 시행령 제24조의 규정에 따라 수립한 하천 기본계획을 같은 법 시행규칙 제13조에 따라 고시합니다. 2010. 1. 29 경 상 남 도 지 사 1.수립 또는 변경 목적 하천의 효율적인 이용과 계획적이고 체계적인 하천사업추진 및 원활한 유지관리와 하천의 일관된 개발계획을 위하여 하천법
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More informationDBPIA-NURIMEDIA
金 台 俊 의 學 術 硏 究 와 國 故 整 理 作 業 *1) - 朝 鮮 漢 文 學 史 서술을 중심으로 崔 英 成 ** ` Ⅰ. 머리말 Ⅱ. 天 台 山 人 의 생애 개관 Ⅲ. 天 台 山 人 의 학문 역정 Ⅳ. 조선한문학사 의 위치 Ⅴ. 조선한문학사 의 방법론과 한계 요 약 1930년대 국문학자, 문학사가( 文 學 史 家 )로 활약했던, 전설적인 인물
More informationhwp
연구개발보고서 초록 과제명 ( 국문 ) 치즈유청의 생리활성 펩타이드와 프로바이오틱스를 이용한 인스턴트 건강음료의 개발 ( 영문 ) Development of instant health beverage by probiotics and bioactive peptides of whey 주관연구기관건국대학교 ( 소속 ) 축산식품생물공학전공총괄연구책임자참여기업 ( 성명
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information10(3)-02.fm
w y wz 10«3y 203~211 (2010.12.) Journal of Korean Society of Urban Environment w ù p yá k«áyw *Á xá½k w y œw Á* y w (2010 9 15, 2010 12 2 k) Characterization of Nonpoint Source Pollutant Loads from the
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More informationPDFCoTemp.HWP
국립수의과학검역원 고시 제2010-2호 축산물가공처리법 제4조제2항의 규정에 의거 축산물의가공기준및성분규격을 다음과 같이 개정 고시합니다. 2010년 4월 7일 국립수의과학검역원장 축 산 물 의가 공 기 준 및 성 분 규 격 제1조(목적) 이 고시는 축산물가공처리법(이하 법 이라 한다) 제4조제2항의 규정에 의하여 축산물의 가공기준 및 성분규격을 규정함으로써
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)
141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information(00-1) Journal of Life.hwp
Journal of Life Science 2014 Vol. 24. No. 4. 386~392 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2014.24.4.386 산사 는장미과 의열 매로단맛과신맛이나고우리나라및중국 일본에자생하고 있는붉은색의열매로예로부터항비만
More information14.fm
pissn 1229-1153 J. Fd Hyg. Safety Vol. 30, No. 1, pp. 103~108 (2015) http://dx.doi.org/10.13103/jfhs.2015.30.1.103 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 실시간정량
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More informationhwp
- Appl. Chem. Eng., Vol. 23, No. 1, February 2012, 100-104 누룩으로부터분리한알긴산분해효소생산균주인 Erwinia tasmaniensis 의특성 김현지 이성목 김성구 * 이재화 신라대학교의생명과학대학생명공학과, * 부경대학교수산과학대학생물공학과 (2011 년 10 월 14 일접수, 2011 년 11 월 10 일심사,
More information101~110 ¿õ´ã.¿ìȲ
101 DOI : 10.3831/KPI.2010.13.2.101 Received : 10. 05. 06 Accepted : 10. 05. 27 The Experimental Study on the Effect of Fel Ursi & Bovis Calculus Pharmacopuncture Solution in Bacterial Species which cause
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information605.fm
Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **
More information주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 -
- 1 - 주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 - 식품소비구조의변화가국민건강에미치는영향 硏究責任者 : 孟元在 ( 自然第 2 分科 ) 共同硏究者 : 洪熙玉 ( 祥明大學校兼任敎授 ) 1. 서론 2. 연도별식품소비변화추이 - 3 - (g/ / ) 1970 1980 1990
More informationfm
[ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information000표지
04 Contents 1. Background 2. Outline 3. Schedule 4. Opening Ceremony (Sep.27(Tue)) 5. Sisterhood ceremony & Cultural performance (Sep.27(Tue)) 6. Movie- Jun-Ai / Banquet (Sep.27(Tue)) 7. Korea cultural
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More information10 이지훈KICS2015-03-068.hwp
논문 15-40-05-10 The Journal of Korean Institute of Communications and Information Sciences '15-05 Vol.40 No.05 http://dx.doi.org/10.7840/kics.2015.40.5.851 가로등 인프라를 활용한 안전한 스마트 방범 시스템 차 정 화, 이 주 용 *, 이
More informationKorean Journal of Microbiology (2019) Vol. 55, No. 3, pp pissn DOI eissn Copyright
Korean Journal of Microbiology (2019) Vol. 55, No. 3, pp. 258-267 pissn 0440-2413 DOI https://doi.org/10.7845/kjm.2019.9060 eissn 2383-9902 Copyright c 2019, The Microbiological Society of Korea 유산균의증식과항균활성에관한탈지유및두유의영향
More information