43-4(08) fm
|
|
|
- 자연 환
- 5 years ago
- Views:
Transcription
1 KOREAN J. FOOD SCI. TECHNOL. Vol. 43, 4, pp. 446~452 (2011) The Korean Society of Food Science and Technology 김치에서항균활성유산균의분리및동정 김수영 1 김종두 1 손지수 1 이시경 2 박갑주 3 박명수 * 안양과학대학호텔조리과, 1 건국대학교생명과학과, 2 건국대학교응용생명과학부, 3 건국대학교기초과학연구소 Biochemical and Molecular Identification of Antibacterial Lactic Acid Bacteria Isolated from Kimchi Soo Young Kim 1, Jong Doo Kim 1, Ji Soo Son 1, Si Kyung Lee 2, Kab Joo Park 3, and Myeong Soo Park* Department of Hotel Culinary Arts, Anyang Science University 1 Department of Biological Sciences, Konkuk University 2 Department of Applied Biology and Chemistry, Konkuk University 3 Research Institute for Basic Sciences, Konkuk University Abstract Total 480 lactic acid-producing bacteria were isolated from five kinds of kimchi, and their antibacterial was tested against Salmonella enterica serovar Typhimurium, Bacillus subtilis, and Pseudomonas aeruginosa using an agar diffusion assay. Among them, 340 isolates showed a halo on MRS agar against one or more indicator strains, which were identified using multiplex, an API 50CHL kit, and a sequence analysis. As a result, 169 Lactobacillus plantarum, 20 Lactobacillus fermentum, two Lactobacillus paracasei ssp. paracasei, two Lactobacillus sp., and 15 Pediococcus sp. were identified. This may be the first report on the isolation of antibacterial Lactobacillus fermentum from kimchi. Keywords: antibacterial, kimchi, lactic acid bacteria, identification 서 유산균은자연계에광범위하게분포하며, 전통적으로다양한발효식품에이용되어왔고, 일반적으로안전하다고인식되는미생물 (GRAS, generally recognized as safe) 로서 (1), Bergey s Manual(2) 에서는그람양성구균과그람양성간균에서다루고있다. 유산균은 G+C 50 mol% 이하의그람양성, non-spore-forming 의구균, 간균, 혹은구간균이다. 많은유산균은프로바이오틱스 (probiotics) 로서소화흡수를돕고장내부패를억제하고, 설사변비의치료효과, 장내유해균의억제, 비타민의생성, 혈중콜레스테롤저하능, 항암효과, 인체의면역능력증강등다양한기능성이보고되고있다 (3). 한예로 Lactobacillus strain 의경우 immunoglobulin 의생산자극 (4), 대식세포에 interferon 유도 (5), 신체부분적산성화 (6), hypocholesteroleaemic 효과 (7), mutagenic 물질과의반응 (8), 항균물질인박테리오신의생성 (9), 그리고 Salmonella enterica serovar Typhimurium 과 Neisseria gonorrhaea 와같은병원성세균의흡착저해등의기능이밝혀진바있으며, 이와같이유산균의숙주에대하여이로운작용을하는 probiotics 로서의기능이밝혀져한때영양적측면에서가치없는식품으로오인받 *Corresponding author: Myeong Soo Park, Department of Hotel Culinary Arts, Anyang Science University, Anyang, Gyeonggi , Korea Tel: Fax : mspark@ianyang.ac.kr Received April 7, 2011; revised June 1, 2011; accepted June 6, 2011 론 았던발효식품들은오늘날에이르러서는가장과학적인식품으로인정받고있다. 식품에서유산균은발효식품의맛과발효산물의특징을결정하고, 유기산및박테리오신등의항균활성물질을생성하여식품의저장성에기여한다. 박테리오신은다양한그람양성균에서생산되는항균활성단백질또는펩타이드이며, 유산균에서유래한박테리오신의경우식품산업에서천연보존제 (natural preservative) 로이용할수있는응용성과항생제를대체할수있는물질로서관심을끌고있다. Klaenhammer(9) 는유산균이생산하는박테리오신을분자및생리학적특성에따라다음과같이분류하였다. Class I bacteriocin(lantibiotics) 은 post-translational modification 결과 lanthionine 같은특이한아미노산을포함한다. Class II 는 lanthionine 을함유하지않는박테리오신으로분자량이작고 (<13 kda), 작은분자량으로인하여 3 차구조를형성하지않으므로비교적열에안정하며, 일반적으로 20 개정도의소수성아미노산으로이루어진 transmembrane helix 를가지는것을특징으로한다. Class III 는분자량이크고 (>30 kda) 열에불안정한항균활성단백질이다. Lactococcus lactis 가생산하는 nisin 의경우 Class I 에속하며비교적넓은 antimicrobial spectrum 을가지고대부분의그람양성균의증식을억제한다. Nisin 은열에안정하고낮은 ph 에서도활성을나타내며천연식품보존제로사용되고있다. 또한대부분의박테리오신의활성이약산성에서강하고염기성환경에서불안정한것으로알려져있어산을생성하는 Lactobacillus 속의배양액으로부터박테리오신의생산여부를알아보기위해광범위하게적용할수있는실험적방법의확립에어려움이있다 (10). 최근에는박테리오신은식품보존제로서뿐아니라유산균종의개량을위한발현벡터시스템의선발유전자로이용되기도한 446
2 김치에서항균활성유산균의분리및동정 447 다 (11). 본연구에서는항균활성이우수한유산균주를탐색하고이를식품용유전자발현시스템용마커로서개발하기위한기초연구로서, 김치로부터항균활성을나타내는유산균을분리 선발하고이들균주를생화학적 유전학적방법으로동정하였다. 재료및방법 배지및시약 Lactobacillus속미생물의분리를위하여 Lactobacillus selection media(lbs-media, Difco, St. Louis, MO, USA) 와 MRS media (Difco) 에 acetic acid(shinyo Pure Chemical Co., Ltd. Osaka, Japan) 를첨가하여사용하였고계대배양에는 MRS media(difco) 를사용하였다. 혐기배양을위하여 AnaeroGen TM gas pack(oxoid Inc., Cambridge, UK) 를사용하였다. 균주의보존을위하여균배양액에 glycerol(shinyo) 이 15%(v/v) 가되도록조성하여 70 o C Deep Freezer(Ilshin lab Inc., Seoul, Korea) 에보관하며사용하였다. 분리한균주의생화학적특성검사를위해서는 Gram stain sets(difco), hydrogen peroxide(sigma Aldrich Co., St. Louis, MO, USA), oxidase reagent(biomérieux Inc., Marcy l'etoile, France), API 50CHL kit(biomérieux) 를사용하였다. 균주의분리전통적인방법으로일반가정집에서만든 5 종류의김치를수집하여 mixer 로균질화한후 180 ml 의 LBS 및 MRS 배지에 10%(w/v) 로접종한후 37 o C 에서 48 시간배양하여증균하였다. 증균액을 0.85% 멸균생리식염수를이용하여 까지희석한액 100 µl 를 0.1%(w/v) CaCO 3 를함유하는 MRS 고체배지에도말한후 AnaeroGen TM gas pack(oxoid Inc.) 을사용하여혐기적인조건에서 37 o C 로 3 일간배양한후산생성에의해투명환을형성한콜로니중 48 개씩을 MRS 고체배지에도말하여순수분리하였다. 분리한균주는 MRS 액체배지에서배양한후 15% glycerol 로조성하여 70 o C 에서보관하며동정과박테리오신활성시험에사용하였다. 본연구에사용된분리균주및표준균주는 Table 1 에표시하였다. 균주의염색및생화학적특성검사분리균주는 MRS 액체배지에서 37 o C 로 24 시간배양한후그람염색 (12) 을통하여그람양성균주를판별하고, 분리균주의크기와형태를광학현미경으로관찰하였다. 분리한균주의생화학적특성은 Cowan 과 Steel(13) 그리고 MacFaddin(14) 의방법에따라균주의특성을조사한후 Bergey s Manual of Systematic Bacteriology(2) 에준하여분류및동정하였다. Catalase test 는배양평판에 3% hydrogen peroxide(h 2 O 2 ) 를첨가한후 O 2 발생유무를관찰하였고, oxidase test 는콜로니를 비금속성막대를사용하여 filter paper 에묻힌후 Oxidase reagent(biomérieux) 를한방울떨어뜨려변색여부를관찰하였다. 항균활성검사항균활성검색을위하여 blank disc 를이용한 agar diffusion assay 를수행하였다. 24 well 배양접시에멸균된 MRS 액체배지를 2mL 씩분주하여분리균주를접균하고혐기조건에서 시간배양하였으며, 배양액 1.5 ml 를취하여멸균된 eppendorf tube 에옮긴후원심분리 (12,000 rpm, 4 o C, 5 분 ) 한후상층액 1mL 를조심스럽게취하여박테리오신조추출액으로하여 20 o C 에보관하고, 1 회해동하여냉장보관하며 agar diffusion assay 를수행하였다. 균배양액의상등액은 3 N NaOH 를사용하여 ph 으로조정한후상등액에 ammonium sulfate 를첨가하여 70% 가되도록하였다. 항균활성은멸균된 agar 배지를적당히식힌후예비실험을통해결정된희석비율을사용하여 indicator 균주배양액을최종 CFU/mL 이상, CFU/mL 이하가되게접종한다음페트리디쉬에 10 ml 씩분주하여굳힌후건조를위하여 37 o C 에서 4 시간배양하였다. 건조된 indicator plate 에 blank disc 를떨어뜨린후 20 µl 의박테리오신조추출액을점적하고 37 o C 에서 12 시간배양후투명환의형성여부를판단하여항균활성을갖는균주를선발하였다. 균주의동정최초분리한 480균주의신속한동정을위하여 (15) 을수행하였다. 주형으로사용할 genomic DNA는 Puregene TM DNA Isolation kit(gentra Systems, Minneapolis, MN, USA) 을사용하여준비하였다. 분리균주의그룹을나누기위한 multiplex -G에서는 10X reaction buffer(with MgCl 2 ) 2.5 µl, 1µL의 dntps(2.5mm each), 10 pmol/µl로희석한 primer Ldel-7, LU-5, LU-3', LU-1', 를 1µL씩을넣고, 최종 25 µl의반응용액에 0.25U의 HanTaq XL polymerase(genenmed Inc., Seoul, Korea) 를포함하게조성하였으며, PTC-100 Peltier Thermal Cycler(MJ Research Inc. Waltham, MA, USA) 를사용하여 반응을수행하였다. 은 95 o C에서 5분간반응후에 95 o C에서 20초, 55 o C에서 2분의반응을총 35회수행한후 72 o C에서 5 분간최종신장하였다. -G의결과에따라 multiplex 를수행하였다. -IV는 primer로 Lsal-1, Lreu- 1, Lpla-3, Lfer-3, Lsal-2, Lreu-4, Lpla-2, Lfer-4를 10 pmol로희석하여각 1µL씩을사용하였으며, 나머지성분은 multiplex - G와동일하게조성한후 95 o C에서 5분간반응한후에 95 o C에서 20초, 58 o C에서 2분의반응을총 35회수행한후 72 o C에서 5분간최종신장한후 2% 아가로즈겔전기영동으로확인하였다. -G와 multiplex -IV에의한증폭산물을형성하지않은균주중간균 9종을선별하여 API 50CHL kit을사용하여당분해능, arginine과 esculin 분해능을배지의색변화로관 Table 1. Bacterial strains used in this study. s Relevant characteristics Source or reference Isolates L101-L Isolates from 5 kinds of kimchi by LBS enrichment This study Isolates M101-M Isolates from 5 kinds of kimchi by MRS enrichment This study B. subtilis KCTC 3716 Indicator strain for antibacterial KCTC 1) P. aeruginosa KCTC 2651 Indicator strain for antibacterial KCTC S. enterica serovar Typhimurium ATCC and ATCC Indicator strain for antibacterial ATCC 2) 1) KCTC: Korean Collection for Type Culture 2) ATCC: American Type Culture Collection
3 448 한국식품과학회지제 43 권제 4 호 (2011) Table 2. primers used in this study Target Primers Nucleotide sequences (5' 3') Usage Group I Group II Group III Group IV Lb. salivarius Lb. reuteri Lb. plantarum Lb. fermentum Ldel-7 LU-5 LU-1' LU-3' Lsal-1 Lsal-2 Lreu-1 Lreu-4 Lpla-3 Lpla-2 Lfer-3 Lfer-4 27F 920R 350F 920R 27F 1492R 350F 1492R ACAGATGGATGGAGAGCAGA CTAGCGGGTGCGACTTTGTT ATTGTAGAGCGACCGAGAAG AAACCGAGAACACCGCGTT AATCGCTAAACTCATAACCT CACTCTCTTTGGCTAATCTT CAGACAATCTTTGATTGTTTAG GCTTGTTGGTTTGGGCTCTTC ATTCATAGTCTAGTTGGAGGT CCTGAACTGAGAGAATTTGA ACTAACTTGACTGATCTACGA TTCACTGCTCAAGTAATCATC AGAGTTTGATCCTGGCTCAG GTCAATTCCTTTGAGTTT TACGGGAGGCAGCAG GTCAATTCCTTTGAGTTT AGAGTTTGATCCTGGCTCAG GGTTACCTTGTTACGACTT TACGGGAGGCAGCAG GGTTACCTTGTTACGACTT Amplicon size (bp) Reference -G G G G IV IV IV IV Identification Identification Identification Identification 찰하여 apiweb program( Biomerieux) 을이용하여동정하였다. -G 와 multiplex -IV 에의한증폭산물을형성하지않은균주중구균 18 종을선별하여 서열을분석하여동정하였다. 염기서열결정용으로 27F, 350F, 920R, 1492R primer 를사용하였으며, 각각의결과를보정하여 BLASTN progarm( ncbi.nlm.nih.gov/blast.cgi) 을사용하여해당균주를동정하였다. 에사용된 primer 는 Table 2 에표시하였다. 결과및고찰 김치유산균분리및항균활성균주선발 5 종류의김치로부터산생성, 그람양성, catalase 음성, oxidase 음성을기준으로 480 종의균주를분리한후재료및방법에의하여이들중 426 균주에대한박테리오신조추출액을제조하여항균활성실험에사용하였다. S. enterica serovar Typhimurium, P. aeruginosa, B. subtilis 을항균활성에대한지표균주로사용하여시험한결과 340 균주가한가지이상의균주에대하여항균활성을나타내었다. 이중 S. enterica serovar Typhimurium 균주에대해서만항균활성을갖는것은 L420 이었으며, P. aeruginosa 에대해서만항균활성을갖는것이 35 균주, B. subtilis 에대해서만항균활성을나타내는균주가 71 균주이었으며, S. enterica serovar Typhimurium 과 P. aeruginosa 에대하여항균활성을나타낸것은 3 균주, P. aeruginosa 와 B. subtilis 두균주에대한항균활성을나 타내는것은 165 균주, S. enterica serovar Typhimurium 과 B. subtilis 에대해서항균활성을나타낸것은 6 균주이고, 59 균주가 S. enterica serovar Typhimurium, P. aeruginosa, B. subtilis 세균주모두에대하여항균활성을나타내었다 (Table 3). 을이용한균주의동정 Song 등 (15) 의 Lactobacillus 속의신속한동정법을이용하여 1 차선발한 340 균주에대하여 multiplex-g 을수행한결과 204 균주에서 group IV(Lb. salivarius ssp. salivarius, Lb. salivarius ssp. salicinius, Lb. reuteri, Lb. fermentum, Lb. plantarum) 에해당하는 증폭산물 (350bp) 을형성하였으며, 이들에대하여 multiplex- 을수행하여 162 균주를 Lb. plantarum, 20 균주를 Lb. fermentum 으로확인하였다 (Table 3). API 50CHL Kit을이용한균주의동정 -G와 multiplex -IV에의한증폭산물을형성하지않은균주중간균 9종 (L328, L331, L521, L538, L543, M305, M307, M311, M317) 에대하여 API 50CHL Kit을이용한실험결과를웹프로그램 ( 을이용하여, 표준균종에대한상대적근접성을나타내는 %ID, 각균종에대하여전형적인생화학특성에대한근접성을나타내는 T-index 를이용하여동정결과 L328(%ID=99.9%, T-index 0.58), L331 (99.9%, 0.69), L521(99.9%, 0.59), L538(99.9%, 0.35), L543 (99.9%, 0.44), M305(94.3%, 0.25), M317(99.7%, 0.38) 를나타내어각각 Lb. plantarum으로동정하였다. M307균주는 %ID의합
4 김치에서항균활성유산균의분리및동정 449 Table 3. Biochemical and bactericidal characteristics of isolates from kimchi and identification of several strains by, 16S rdna sequencing and multiplex G IV Sa 1) Ps 2) Ba 3) G Sa Ps Ba L101 - P. acidilactici - 4) ND 5) M IV P L147 - P. acidilactici - ND M IV P L IV P 6) M IV P L210 - P. pentosaceus - ND M IV P L246 - Lb. plantarum - ND X 8) 11 0 M IV P L IV F 7) M IV P L IV F M IV P L IV F M IV P M311 Lb. paracasei or plantarum - IV ND M IV P M IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P 0 9 X L IV P M IV P M IV P M IV P M IV P M IV P M IV P L IV F M IV P L IV F M IV P L IV F L IV P M IV F L IV P M IV F L IV F M IV F L IV P L145 - P. acidilactici - ND L521 Lb. plantarum - - ND M120 - P. pentosaceus - ND L IV P L IV F L IV P L IV P 0 X 12 L IV P L IV P L IV P L IV P L IV P L IV P L IV P L IV P L528 - Lb. plantarum - P L IV P L IV P L IV P L543 Lb. plantarum - - P L IV P L P L IV P L IV P M IV P M109 - P. pentosaceus - ND L IV F M111 - P. acidilactici - ND L IV F L IV P 8 X 9 L IV F L IV P M IV F M IV P M IV F M IV P M IV F L IV P M IV F L IV P M IV F L IV P M IV F L IV P L245 - P. pentosaceus - ND L IV P L IV P L IV P
5 450 한국식품과학회지제 43 권제 4 호 (2011) Table 3. Contined G Sa 1) Ps 2) Ba 3) G IV Sa Ps Ba M IV P L IV P L115 - P. acidilactici - ND L328 Lb. plantarum - IV L146 - P. acidilactici - ND L IV P L IV P L331 Lb. plantarum - IV L IV P L IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M337 - P. pentosaceus - ND L IV P M IV P L238 - P. pentosaceus - ND M IV P M223 - P. acidilactici - ND L IV P L IV P L IV P L IV P L IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M437 - P. pentosaceus IV L IV P M IV P L IV P L502 - Lb. plantarum IV P L IV P L IV P L IV P L IV P L IV P L IV P M IV P L IV P M IV P L IV P M305 Lb. plantarum - IV L IV P M307 Lb. paracasei or plantarum - IV L IV P M IV P L IV P M IV P L IV P M IV P L IV P M IV P L IV P M317 Lb. plantarum - IV L IV P M IV P L IV P M IV P L IV P M IV P L538 Lb. plantarum - - P M IV P L P ) Salmonella enterica serovar Thyphimurium, 2) Pseudomonas aureuginosa, 3) Bacillus subtilis, 4) No detectable multiplex -G product, 5) No detectable multiplex -IV product, 6) Lactobacillus plantarum, 7) Lb. fermentum, 8) Not tested.
6 김치에서항균활성유산균의분리및동정 %, T index 평균 0.25 를보여 Lactobacillus 속으로동정하였다. M311 균주는 Lb. paracasei ssp. paracasei 에대하여 %ID= 71.9%, T index 평균 0.16 를보였다. sequencing을이용한균주의동정 에서증폭산물을형성하지않은구균혹은구간균 17종을선택하여 를 27F, 1492R primer를사용하여 로증폭한후 27F, 350F, 920R, 1492R primer를사용하여염기서열중일부를결정하였다. 이들 primer 중특히 1492R primer가가장좋은결과를보였으며 920R primer를사용한경우대부분의균주가반응을나타내지않았는데, 이는 920R primer의부착부위인 의보존서열에 primer 부착이저해될정도의변이가있을가능성을나타낸다. 이렇게얻어진부분적인 염기서열을 BLASTN program으로데이터베이스와비교한결과 L210, L238, L245, M109, M120, M337, M437의 7균주가 P. pentosaceus와 99% 이상의상동성을나타냈으며, L101, L115, L145, L146, L147, M111, M223은 P. acidilactici와 99% 이상의상동성을나타냈고, L246, L502와 L528은 Lb. plantarum 과 99% 이상의상동성을보였다. 김치에는 30종이상의유산균종이보고되고있다. 그중에서 Lb. plantarum, Lb. brevis, Ent. faecalis, Leu. mesenteroides, P. pentosaseus 등이우점종으로알려지고있다. 기존의연구를통하여김치에서박테리오신을생산하는 Ent. faecium, P. pentosaseus, P. acidilactici, Leu. mesenteroides, Leu, paramesenteroides, Lc. lactis, Lb. brevis 등에대해보고가된바있다 (17). 그러나 Lb. fermentum에서박테리오신에대한연구는매우미비한편이다. Yan과 Lee(18) 는 Lb. fementum에서항균활성범위가매우좁은박테리오신을부분정제하고 fermenticin B로명명하였다. 또한 Wells 등 (19) 은소의위에서 Streptococcus bovis에대한항균활성을가지는 Lb. fermentum을분리하여보고하였다. Fazeli 등 (20) 은이란의전통빵의제조에사용되는 sourdough에서곰팡이의성장을억제하여유통기한을연장할수있는 Lb. fermentum을분리하여보고하였다. 최근의연구에의하면 Lb. fermentum은구강에서충치균을억제하는것으로나타났으며 (21), 훈제연어에서분리된 Lb. fermentum의경우 Listeria monocytogenes에대한항균활성과함께장상피세포에대한우수한부착능을보였다 (22). 본연구에서분리된 Lb. fermentum 균주들은 P. aeruginosa 혹은 B. subtilis에만활성을나타내었다 (Table 3). Lb. fermentum의경우, Lb. acidophilus와함께인체장내에서 probiotics로서의활성이보고되고있어 (23) 본연구를통해분리한균주들의효율적인활용을위해서는보다광범위한균주에대한활성검사와이들이생산하는박테리오신의특성규명에대한추가적인연구가진행되어야할것이다. 요 항균활성을나타내는야생형유산균을분리 동정하기위하여김치에서 480 종의유산균을분리하였으며, S. enterica serovar Typhimurium, P. aeruginosa, B. subtilis 에대한항균활성을 agar diffusion 법을사용하여검사하였다. 이들중항균활성을나타내는균주 340 종에대하여 multiplex 과 API 50CHL Kit 을이용한생화학적특성검사및 sequencing 을통해 Lb. plantarum 169 균주, Lb. fermentum 20 균주, Lb. paracasei spp. paracasei 2 균주, Lactobacillus 속 2 균주와 Pediococcus 속 15 균주를동정하였다. 이들균주중 Lb. fermentum 의경우는프로바이 약 오틱스로서의활성이보고되고있는균으로추가적인연구가필요하다고사료된다. 감사의글 이논문은 2010 년도건국대학교학술진흥연구비및농촌진흥청차세대바이오그린 21 사업 ( 과제번호 :PJ008005) 지원에의한논문임 문 1. Sandine WE, Muralidhara KS, Elliker PR, England DC. Lactic acid bacteria in food and health: A review with special reference to enteropathogenic Escherichia coli as well as certain enteric diseases and their treatment with antibiotics and lactobacilli. J. Milk Food Technol. 35: (1972) 2. Sneath PHA, Mair NS, Sharpe ME, Holt JG. Bergey's Manual of Systematic Bacteriology Vol. 2, Williams and Wilkins, Baltimore, MD, USA. pp (1986) 3. Gilliland SE. Health and nutritional benefits from lactic acid bacteria. FEMS Microbiol. Rev. 7: (1990) 4. Isolauri E, Joensuu J, Suomalainen H, Luomala M, Vesikari T. Improved immunogenicity of oral D x RRV reassortant rotavirus vaccine by Lactabacillus casei GG. Vaccine 13: (1995) 5. Kitazawa H, Matsumura K, Itoh T, Yamaguch T. Interferon induction in murine peritoneal macrophage by stimulation with Lactobacillas acidophilus. Microbiol. Immunol. 36: (1992) 6. Zheng HY, Alcorn TM, Cohen MS. Effects of H 2 O 2 -producing lactobacilli on Neisseria gonorrhoeae growth and catalase. J. Infect. Dis. 170: (1994) 7. Fernandes CF, Shahani KM, Amer MA. Therapeutic role of dietary lactobacilli and lactobacillic fermented dairy products. FEMS Microbiol. Lett. 46: (1987) 8. Orrhage K, Sillerstrm E, Gustafsson JA, Nord CE, Rafter J. Binding of mutagenic heterocyclic amines by intestinal and lactic acid bacteria. Mutat. Res. 311: (1994) 9. Klaenhammer TR. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12: (1993) 10. Kim SH. Screening and characterization of bacteriocin from Lactococcus sp. HY449. Korean J. Dairy Sci. Technol. 12: 1-10 (1995) 11. Mierau I, Kleerebezem M. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl. Microbiol. Biot. 68: (2005) 12. Gerhardt P, Murray RGE, Wood WA, Krieg NR. Methods for general and molecular bacteriology, American Society for Microbiology, Washington DC, USA. pp (1994) 13. Cowan ST, Steel KJ. Manual for the identification of medical bacteria. 2 nd ed. Cambridge University Press, Cambridge, UK. pp (1974) 14. MacFaddin JF. Biochemical tests for identification of medical bacteria. 2 nd ed. Williams and Wilkins. Baltimore, MD, USA. pp (1980) 15. Song Y, Kato N, Liu C, Matsumaya Y, Kato H, Watanabe K. Rapid identification of 11 human intestinal Lactobacillus species by multiple assays using group-and species-specific primers derived from 16S-23S rrna intergenic spacer region and its flanking 23S rrna. FEMS Microbiol. Lett. 187: (2000) 16. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplication for phylogenetic study. J. Bacteriol. 173: (1991) 17. Kwon DY, Koo MS, Ryoo CR, Kang CH, Min KH, Kim WJ. Bacteriocin produced by Pediococcus sp. in kimchi and its characteristics. J. Microbiol. Biotechn. 12: (2002) 18. Yan TR, Lee CS. Characterization of a partially purified bacteriocin, Fermenticin B, from Lactobacillus fermentum. Biotechnol. Lett. 19: (1997) 19. Wells JE. Krause DO, Callaway TR, Russell JB. A bacteriocinmediated antagonism by ruminal lactobacilli against Streptococcus 헌
7 452 한국식품과학회지제 43 권제 4 호 (2011) bovis. FEMS Microbiol. Ecol. 22: (1997) 20. Fazeli MR, Shahveri AR, Sedaghat B, Jamalifar H, Samadi N. Sourdough-isolated Lactobacillus fermentum as a potent antimould preservative of a traditional Iranian bread. Eur. Food Res. Technol. 218: (2004) 21. Botina SG, Chervinets IuV, Klimina KM, Koroban NV, Chervinets VM, Gavrilova OA, Lebedev DV, Mironov AIu. Genetic identification of antagonistically active lactobacillus strains isolated from the oral cavity of healthy individuals. Klin. Lab. Diagn. 11: (2010) 22. Todorov SD, Furtado DN, Saad SM, Tome E, Franco BD. Potential beneficial properties of bacteriocin-producing lactic acid bacteria isolated from smoked salmon. J. Appl. Microbiol. 110: (2011) 23. Pascual LM, Daniele MB, Giordano W, Pájaro MC, Barberis IL. Purification and partial characterization of novel bacteriocin L23 produced by Lactobacillus fermentum L23. Curr. Microbiol. 56: (2008)
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
43(2)-10(단보)023(p ).fm
The Korean Journal of Microbiology, Vol. 43, No. 2, June 2007, p. 142-146 Copyright 2007, The Microbiological Society of Korea Ginsenoside y ƒ w z ½ ³Á½» Á * w w w œw l (Panax ginseng) z w x š. ù, w š
untitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
22 (07-29-OK).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 43(2), 328~332(2014) http://dx.doi.org/10.3746/jkfn.2014.43.2.328 김치의저장성향상을위한항균활성우수유산균선발 연구노트 최학종 1 김유진 1 이나라 1 박해웅 1 장자영 1 박성희 1 강미란 1 김현주 1 이종희 1 이종훈 2 변유량 3 김태운
<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
ca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
로의 흡수 및 에너지 대사 등을 조절한다 면서 유산균은 유해균의 성장을 억제하면서 동시에 유산균의 증식 을 도울 수 있는 능력이 있다. 따라서 프레바이오틱스(prebiotics)나 프로바이오틱스가 함유된 식품이나 의약 품을 꾸준히 섭취하는 것이 중요하다 고 강조했다.
프로바이오틱스의 진면목(2) 저자 김성철 영남대학교 임상약학대학 겸임교수 약학정보원 학술자문위원 개요 인간의 위장관에는 숙주세포, 영양소, 미생물로 이루어진 복잡하고 다양한 생태계(ecosystem)가 존재한 다. 장관에서 배양 가능한 미생물의 종류는 500종 이상이며, 위, 십이지장, 공장에는 미생물의 수가 10 5 CFU/g으로 증가한다. 장내 세균의 수는
- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
Microsoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
DBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
pissn eissn J. Milk Sci. Biotechnol. 2019;37(2): ARTICLE 전통김치로부터 Probiotic 유산균의
pissn 2384-0269 eissn 2508-3635 J. Milk Sci. Biotechnol. 2019;37(2):115-128 https://doi.org/10.22424/jmsb.2019.37.2.115 ARTICLE 전통김치로부터 Probiotic 유산균의분리및우유발효특성 임영순 * 김지연 강현철 서울에프엔비식품연구소 Isolation and Identification
???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
수단으로여러식품의제조에적용되고있다 (Alan 2003, Cheigh 1994, Kitazawa 등 2004). 다당을생산하는유산균은점성강화, 물성강화, 유화제로서의잠재성때문에발효낙농산업에서상당한관심을받아왔다 (Grobben 등, 1996). 그들은또한항암 (Ebina
과제구분기본수행시기전반기 연구과제및세부과제 청정특화작목활용면역증강안전김치산업화 1) 면역증강우수유산균선발및김치제품화 ( 현장 ) 색인용어된장, 검은콩 연구분야 농촌자원 농촌자원 수행기간 08~ 10 08~ 10 소속 ( 과 / 연구소 ) 친환경농업연구과친환경농업연구과 책임자 윤향식 윤향식 ABSTRACT To use LAB as a Kimchi starter,
<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
류코노스톡발현시스템개발연구동향 충북대학교식품생명공학과한남수교수 1. 류코노스톡및이의발현벡터류코노스톡속은락트산, 아세트산, 알코올, 이산화탄소, 아세토인등의방향족화합물및네개의탄소함유화합물을생성하는이종발효유산균이다. 이는광범위하게채소 ( 김치, 사우어크라우트, 피클 ) 와
류코노스톡발현시스템개발연구동향 충북대학교식품생명공학과한남수교수 1. 류코노스톡및이의발현벡터류코노스톡속은락트산, 아세트산, 알코올, 이산화탄소, 아세토인등의방향족화합물및네개의탄소함유화합물을생성하는이종발효유산균이다. 이는광범위하게채소 ( 김치, 사우어크라우트, 피클 ) 와유발효에사용되며구연산대사및디아세틸배양유제품의주된맛화합물인휘발성화합물을생산한다. 일반적으로독소를생성하지않으며호기성및혐기성조건에서성장하고
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
DBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
DBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 30(3): 109-113 (2015) http://dx.doi.org/10.7841/ksbbj.2015.30.3.109 ISSN 1225-7117 / eissn 2288-8268 연구논문 프로바이오틱스의동결보호및장관안정성개선을위한첨가제효과분석 정은지
41.4(8) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 41, No. 4, pp. 399~404 (2009) The Korean Society of Food Science and Technology Bacillus subtilis Lactobacillus plantarum yw t e w Á û * œ w tœw Effect of the Mixed Culture
Effects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
42(3)-11(p ).fm
The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.
14.fm
pissn 1229-1153 J. Fd Hyg. Safety Vol. 30, No. 1, pp. 103~108 (2015) http://dx.doi.org/10.13103/jfhs.2015.30.1.103 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 실시간정량
<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
164-2.fm
J. Fd Hyg. Safety 16(4), 264 273 (2001) Lactobacillus reuteri t w w w³ z «ûz 1 Á½ x 1 Á»Á½ Á Á Á½ Á *Áx Á y œ» w œw w w Antimicrobial Activity of Lactobacillus reuteri Against Major Food-Borne Pathogens
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
2003_17_어영.hwp
임상병리와정도관리 : 제 25 권제 2 호 2003 J. Lab. Med. & Quality Assuarance 2003:25:215-221 215 Microplate 를이용한장구균동정법 어영 황규열 장인호 윤갑준 이경원 * 이형환 ** 연세대학교원주의과대학진단검사의학과, 연세대학교의과대학진단검사의학과 *, 건국대학교생명과학과 ** Identification
( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
DBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 251-255 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.251 ISSN 1225-7117 / eissn 2288-8268 Research Paper 유산균의생존율향상을위한동결건조보호제로서호박분말의효과
27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
(1) 04. 오계헌.fm
Korean Society for Biotechnology and Bioengineering Journal 28(1): 1823 (2013) http://dx.doi.org/10.7841/ksbbj.2013.28.1.18 연구논문 장기간발효김치인묵은지에서분리한 Lactobacillus sakei JK17 의기능성조사 김동선, 조형우, 김대한, 오계헌 * Functional
-07-......
A Depth Interview on Qualification, Role, and Professionalism of Infant/Toddler Teachers Department of Child & Family Studies, Kyung Hee University Associate Professor : Ahn, Sun Hee Department of Early
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
<4D F736F F D20B1D4B0DDBCAD5BC0AFBBEAB1D5C0C7B0CBC3E2B9D7B0E8BCF6B9E6B9FD5D2D30365B315D2E31322E3134>
한국바이오벤처협회단체표준 KBVA 유산균의검출및계수방법 0007 : 2006 Detection and enumerization method of lactic acid-producing bacteria 서문이규격은학교법인서울여자대학교가원안을준비하여한국바이오벤처협회단체표준으로제정토록요청한것을관련한국바이오벤처협회장이제정한한국바이오벤처협회단체표준이다. 식품산업이나의약산업에서활용사례가늘고있는프로바이오틱인유산균을각종적용제품에서정확하게측정하는방법이필요하다.
A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
13 (JLS_150045).hwp
Journal of Life Science 2015 Vol. 25. No. 6. 709~714 The Anti-inflammatory Effects of Probiotic-produced Exopolysaccharide Seung Hoon Lee 1, Min-Jeong Kwon 1, Hyung-Taek Kang 1, Chung Wook Chung 1, Byung
表紙（化学）
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
DBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(2): 146-152 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.2.146 ISSN 1225-7117 / eissn 2288-8268 Research Paper 질내유산균의 Candida albicans 에대한항진균효과연구
Korean Journal of Microbiology (2019) Vol. 55, No. 3, pp pissn DOI eissn Copyright
Korean Journal of Microbiology (2019) Vol. 55, No. 3, pp. 258-267 pissn 0440-2413 DOI https://doi.org/10.7845/kjm.2019.9060 eissn 2383-9902 Copyright c 2019, The Microbiological Society of Korea 유산균의증식과항균활성에관한탈지유및두유의영향
상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /
,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
untitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *
, 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
올바른 먹거리 유통과 건강한 식문화 창조를 통해 함께하는 행복한 내일을 꿈꾸는 서울특별시농수산식품공사입니다 CONTENTS 마음에 그린 마켓, 함께하는 행복한 내일 지속가능경영 전반 CEO 인사말 04 2013 하이라이트 06 공사 소개 10 위험과 기회 12 비전 및
마음에 그린 마켓 함께하는 행복한 내일 2014 지속가능경영보고서 올바른 먹거리 유통과 건강한 식문화 창조를 통해 함께하는 행복한 내일을 꿈꾸는 서울특별시농수산식품공사입니다 올바른 먹거리 유통과 건강한 식문화 창조를 통해 함께하는 행복한 내일을 꿈꾸는 서울특별시농수산식품공사입니다 CONTENTS 마음에 그린 마켓, 함께하는 행복한 내일 지속가능경영 전반 CEO
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
MERRY CHRISTMAS AND HAPPY NEW YEAR WITH THE CLASS 2 / 3 CEO s Letter 어느덧 달력의 마지막 장을 넘깁니다. 다사다난했던 2011년도 막바지로 달려가고 희망찬 2012년이 밝아 옵니다. 새로운 해는 지난해 보다 더 활기찬 마음으로 시작할 수 있도록 한껏 희망의 숨을 불어넣어 봅니다. 올해 더클래스 효성의
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
07-1960(JH)
한국두피모발미용학회지 제5권 제1호 2009 The Journal of Beauty & Trichology 5(1), 00~00(2008) 1960년대 뷰티 및 패션트렌드 분석 - 모델 트위기 (Twiggy) 를 중심으로 - 김희선* 안양과학대학 뷰티디자인학부 Analysis of Beauty and Fashion trends in the 1960 s - Focusing
Hardware Manual TSP100
Trademark acknowledgments TSP: Star Micronics., Ltd. Notice All rights reserved. Reproduction of any part of this manual in any form whatsoever, without STAR s express permission is forbidden. The contents
<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
(00-1) Journal of Life.hwp
Journal of Life Science 0 Vol.. No.. 3~ ISSN (Print) 5998 ISSN (Online) 87306 DOI : http://dx.doi.org/0.535/jls.0...3 Probiotic Properties of Lactobacillus strains Isolated from Kimchi Hye Jung Choi, Bo
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
01이정훈(113~127)ok
The Role of Historical Relativity in International Exchange of Culture and Tourism at the Regional Level: A Case of Gyeonggi and Shandong Province Jung-hoon Lee** Kyung-Eun Choi*** Eun-Ja Lee****,.,,.,,.,,.,.,.,,,
*2007BT..........
BT 정보 교육 최신 BT 공개특허 이처영 Experimental Biology 2007 Meeting을 다녀와서 전희진 제4회 ASM Conference on Biofilm 참관기 김재은 BT News 정보 교육 최신 BT 공개특허 5T국제특허법률사무소 이처영박사 1. 미생물 발명의 명칭 출원인 발명자 공개번호 숙신산 생산이 증가된 돌연변이 대장균 균주 라이스