14.fm
|
|
- 광규 목
- 5 years ago
- Views:
Transcription
1 pissn J. Fd Hyg. Safety Vol. 30, No. 1, pp. 103~108 (2015) Journal of Food Hygiene and Safety Available online at 실시간정량 PCR 을통한김치유래 Weissella spp. 에의한 Listeria monocytogenes 생육억제 이영덕 1 김대용 2 박종현 3 1 서원대학교식품공학과, 2 서원대학교제약공학과, 3 가천대학교식품생물공학과 Growth Inhibition of Listeria monocytogenes by Weissella spp. from Kimchi Through Real-time PCR Young-Duck Lee 1, Dae-Yong Kim 2, and Jong-Hyun Park 3 1 Department of Food Science and Engineering, Seowon University, Chungju , Korea 2 Department of Pharmaceutical Science and Engineering, Seowon University, Chungju , Korea 3 Department of Food Science and Biotechnology, Gachon University, Seongnam , Korea (Received November 4, 2014/Revised November 15, 2014/Accepted November 19, 2014) ABSTRACT - Weissella spp. from traditional Korean foods of Kimchi were isolated and characterized against food-borne pathogenic Listeria monocytogens. The isolates were identified as W. cibaria 0D17 and W. confusa 0D23 from Kimchi by the biochemical characteristics and 16S DNA sequencing. The culture solutions of the isolates adjusted to ph 7.0 showed L. monocytogens inhibition. To analyze the quantitative detection of L. monocytogenes, real-time PCR was performed according to the SYBR Green I method. The isolates grew well and L. monocytogens did not grow during the co-culture with those strains at 37 o C. Therefore, W. cibaria 0D17 and W. confusa 0D23 might be the candidates as the functional lactic acid bacteria for improving food safety. Key words : Weissella spp., L. monocytogenes, Kimchi, Real-time PCR, Inhibition 유산균은과거부터현재까지오랜시간동안식품발효에사용되어왔으며, 발효동안생산되는다양한영양물질, 향기성분, 항균물질등식품의풍미와제품수명에영향을주는것으로알려져있다. 그리고 probiotics로서사람의장내에서식하면서장내균총개선, 면역조절작용, 콜레스테롤저하, 병원성세균들의생육억제, 유당불내증개선등의다양한역할을하는것으로알려져있다 1,2). 또한, 최근다양한임상결과를통해 probiotics와이것들이생산하는 bacteriocin 등의물질들이다양한질환들에대해예방적효과와치료적효과가있는것으로알려져있다 3,4). Collins 등은최근다양한유산균들중 Weissella spp. 를 Leuconostoc spp. 로부터 Leuconostoc paramesenteroides으로분류하였다. Weissella spp. 는약 14종이알려져있고김치등다양한발효식품으로부터분리되고있다 5,6). 특히, 김치의발효에중요한역할을하는것으로알려져있다. 이 *Correspondence to: Jong-Hyun Park, Department of Food Science and Biotechnology, Gachon University, Seongnam , Korea Tel: , Fax: p5062@gachon.ac.kr 러한 Weissella spp. 는 catalase 음성으로포자를형성하지않는 Gram 양성세균으로상대적으로적은양의유산을생성하고, 포도당을발효하여젖산과이산화탄소를생성하는이상발효를하는것으로알려져있다. Weissella spp. 는다른유산균과마찬가지로젖산등의다양한유기산이외에 bacteriocin을생성하여다른세균에대한항균활성이있는것으로보고되어있다 7). 대표적인 Weissella spp. 의 bacteriocin에대한연구는다른유산균이생성하는 bacteriocin에비해상대적으로많이진행되지않고있으나, 최근 weissellicin 110 등이보고되어있다 8,9). 또한, 최근 Weissella spp. 의 Listeria monocytogenes 등의식중독세균에대한항균활성에대한연구가보고되고있다. L. monocytogene는식중독세균으로우유, 쇠고기, 돼지고기, 닭고기같은다양한식품으로부터분리되었으며이에감염된식품또는식품원료물질을섭취하면수막염, 심내막염및파종성육아종을유발하고임산부의경우유산, 사산, 조산등을일으킬수있는리스테리아증 (listeriosis) 이유발될수있다 10,11). 특히, 저온에서도생육이가능하여미국과유럽등의식품제조업체에서매우중요한식중독 103
2 104 Young-Duck Lee, Dae-Yong Kim, and Jong-Hyun Park 세균으로인식되고있다. 국내에서도 L. monocytogenes에대한관리를위해농산물, 축산물, 수산물및식품에오염현황에대한연구와함께 L. monocytogenes의제어를위해고압이나가열처리, 수분활성도조절, 방사선조사등의물리적인방법이외에도여러가지유기산과각종유산균을활용한연구가진행되고있다 12,13). 특히몇몇유산균들은 L. monocytogenes에대한항균활성이탁월한것으로알려져있다. 하지만, 국내에서는 Weissella spp. 를활용해 L. monocytogenes의제어에적용한연구는상대적으로미흡하다. 따라서, 본연구에서는김치로부터 Weissella spp. 를분리및동정하고정량 PCR을통해 L. monocytogenes의생육억제효과를확인하고자하였다. 재료및방법 사용균주및유산균분리본실험에사용된 L. monocytogenes KCTC3710을미생물자원센터에서분양받았으며, Listeria selective agar (Oxoid, UK) 에서배양한후 BHI agar 또는 broth로옮겨 37 o C, 호기적으로 24 시간배양하였다. 유산균의배양은 0.05% L-cystein을첨가하여만든 Lactobacilli MRS broth 또는 MRS agar (Difco Laboratory, Detroit, MI, US) 에서 37 o C, 24 시간혐기적으로배양하였다. 김치로부터 Weissella spp. 를분리하기위해김치제조회사로부터김치를수집하였다. 이들시료 25 g을 225 ml의 0.1% peptone water 에혼합하고, stomacher를이용하여균질화한후 10진희석을하여 MRS agar에도말후 37 o C에서 48~72 시간배양하였다. 그리고배양된집락들중형태학적으로상이한것을선택하여 MRS agar에평판획선하여배양하여순수분리하였다. 그후분리된유산균들을대상으로현미경을통한형태학적특성확인, Gram test, catalase test를수행후 API kit 50CHL (Biomerieux Co., France) 을이용하여당자화성등의생화학적특성분석을통해 Weissella spp. 를분리하였다. 16s rrna 염기서열분석을통한동정분리된 Weissella spp. 을 API kit 50CHL을이용해당자화성특성및 1차적으로동정하고최종적인동정을위해 16s rrna 서열분석을수행하였다. 서열분석을위해분리된젖산균을 MRS broth에배양하고배양액 1mL을취해원심분리한후 0.8% 멸균생리식염수로수세하였다. 그리고 genomic DNA kit를사용하여 DNA를추출하여 PCR을위한 template DNA로이용하였으며, 세균의 16s rrna에대한 universal primer인 F-341 (CCTACGGGAG- GCAGCAG) 와 786-R (GACTACCAGGGTATCTAATC) 을사용하였다. PCR 수행후전기영동을통해 450 bp의증폭산물을확인하고 QIAquick PCR purification kit (QIAGEN, Hilden, Germany) 를사용하여정제하였다. 염기서열은 Dye Terminator Cycle Sequencing Ready Reaction Kit (Biosystems, CA, USA) 와 ABI 3700 sequencer (Biosystems, CA, USA) 에의해수행하였으며, primer는위와동일하게사용하였다. 16S rrna sequence의 homologous의분석은 National Center for Biotechnology Information ( ncbi.nlm.nih.gov/) 의 BLAST search program을이용하여 DNA database와비교하였다. 그리고계통학적분석은 Clustal X, BioEdit, MEGA 4 ( 를이용하여염기서열간의유전적거리와 phylogenic tree를확인하였다. 김치유래 Weissella spp. 의 L. monocytogenes에대한항균효과분리된 Weissella spp. 가 L. monocytogens에대한항균작용을하는지의활성유무를확인하였다. Weissella spp. 를 20 ml의 MRS broth에접종한후 37 o C에서 OD560에서약 1.0까지배양하고, 원심분리 (10,000 g, 5 min) 후상등액을 1 N NaOH를이용하여 ph 7.0으로조정하고 0.22 µm Syringe filter (Millipore, Billerica, MA) 를이용하여제균하였다. 그리고, 제균액을 L. monocytogenes가도말된배지위에 spot on the lawn 방법으로 10 ul 분주하고배양한뒤억제환을확인하여생육저해효과를확인하였다. L. monocytogenes의실시간정량 PCR L. monocytogenes의정량분석은 LightCycler 2.01 (Roche, Mannheim, Germany) 를사용하였으며, 이를위해 BHI broth 에서 18~24 시간동안배양한 L. monocytogenes를 Listeria selective agar에단계희석하여도말한후 37 o C에서 18~24 시간동안다시배양하였다. 배양된균수를바탕으로 standard plate count법을이용하여 colony forming unit (CFU) 값을구하였다. 구해진 CFU값을기준으로앞서추출한 genomic DNA를 10진희석하여 real-time PCR assay을실행한후, 각희석단계의 CFU값과 crossing point (Cp) 값으로표준곡선을작성하여정량분석하였다. 사용한 primer는 L. monocytogenes의 16s rrna를목적으로하는 16s forward (GGCTAATACCGAATGATGAA) 와 16s reverse (AAGCAGTTACTCTTATCCT) 를사용하였다. Capillary PCR tube에 1uL의 DNA와 10 pmol의 primer, 100 mm KCl, 40 mm Tris-HCl (ph 8.4), 0.4 mm each dntp, 50 U/mL of itaq DNA polymerase, 6 mm MgCl2 and 20 nm SYBR Green I을혼합한후실시간정량 PCR 을수행하였다. 반응조건은 95 o C 5분간진행후, 95 o C 1 분, 55 o C 1분, 72 o C 1분세단계를 45회반복하여목적유전자를증폭하였다. 그리고, temperature transition rate는 20 o C/s였고증폭된 DNA는 SYBR Green I의결합으로특유의형광을발하게되어이형광의발생정도를분석하
3 Inhibition of L. monocytogenes by Weissella spp 105 였다. Melting peak 분석은 16s rrna 유전자증폭후 95 o C 0초, 65 o C 15초, 95 o C 0초로하였으며온도변화율은 20 o C/ s이었고마지막 3번째단계만 0.1 o C/s로수행하였다. 김치유래 Weissella spp. 의 L. monocytogenes와동시배양에따른생육억제분리된 Weissella spp. 와 L. monocytogenes를각각 OD560 이약 1.0 수준이되도록배양한후 10 ml의 MRS broth 에약 3logCFU/mL 수준으로동시에접종하고 37 o C와 4 o C 에서배양하였다. 그리고, 시간에따른생육억제를확인하기위해 24 시간후에배양액 1mL을취해 DNA를추출하여실시간정량 PCR을수행하여 L. monocytogenes의생육정도를확인하였다. 결과및고찰 김치로부터 Weissella spp. 를분리하기위해 MRS agar 에서배양된집락의형태학적인특성에따라분리한후 Gram test, catalase test, 현미경관찰을통한형태학적특성확인등을통해유산균으로의심되는균을분리하였다. 그리고 API 50 CHL kit를이용하여당발효특성등의생화학적특성을확인하고, 그결과를동정프로그램을통해확인하였으며, 동정결과 (%) 가 90% 이상인균주 Weissella spp. 를분리하였다. 또한, 확인된 Weissella spp. 를 16s rrna 염기서열분석한결과 W. cibaria 0D17와 W. confusa 0D23으로최종동정되었다 (Fig. 1). 최근 DGGE (denaturing gradient gel electrophoresis), ARDRA법 (Amplified Ribosomal DNA Restriction Analysis), T-RFLP (terminal restriction fragment length polymorphism), metagenomics 분석등의다양한분자생물학적연구를통해김치의유산균총에대한연구가활발하게진행되고있다 14~16). 보통김치 발효초기와중기에는이상유산발효유산균인 L. mesenteroides 등이우점종으로생육하여김치의적숙을유도하다가, 발효후기에들어서면내산성이약한 L. mesenteroides 가감소하게된다. 반면에내산성이우수한 L. plantarum 이나 L. brevis 등이급격히증가하고그결과더많은산이생성되어김치산패를일으킨다고알려져왔다. 하지만, 최근보고되는연구결과들은 Weissella spp. 가김치발효에있어서매우중요한역할을할것으로예측하고있다 6). 하지만, Weisella spp. 의생육과김치품질에미치는영향에관한연구는아직미흡한실정으로김치유래 Weissella spp. 특성, 발효조건, 스타터로서의가능성, 김치발효와 Weissella spp. 의대사산물과의연관성등에대한연구결과가보다많이필요할것으로판단된다. 본연구를통해분리된김치유래 W. cibaria 0D17와 W. confusa 0D23이식중독세균인 L. monocytogenes에대한항균활성유무를확인하고자하였다. W. cibaria 0D17와 W. confusa 0D23의배양상등액을 ph 7.0으로조정했을때와그렇지않을경우모두 L. monocytogenes에대해억제환을나타내어항균효과가있음을확인하였다 (data not shown). 이러한결과는 ph를조정하지않았을경우는 Weissella spp. 가생성하는다양한유기산과항균물질등에의한것으로보이며, ph를중성으로조정하였을때는 Weissella spp. 가형성하는 bacteriocin 등의항균물질에의한것으로사료된다. 하지만, L. monocytogenes를생육을저해하는유기산과 bacteriocin 등의항균물질과의상호작용에대한추후연구가진행되어야할것으로판단된다. 안등은김치에서분리한 W. cibaria JW15의배양상등액이 L. monocytogenes에대한항균활성이있다는보고와유사하였다 17). 그리고, 분리된 W. cibaria 0D17와 W. confusa 0D23가각각 L. monocytogenes와공동배양시온도에따른생육억제효과를 SYBR Green I을이용해 Fig. 1. Phylogenetic relation between Weissells spp. and other LAB based on 16s rrna sequence.
4 106 Young-Duck Lee, Dae-Yong Kim, and Jong-Hyun Park Fig. 2. Specificity of real-time PCR for amplification of 16s rrna as determined by melting peak analysis. : L. monocytogenes, X: W. cibaria 0D17, : W. confusa 0D23. 실시간정량 PCR을통해확인하였다. 실시간정량 PCR 은다양한형광색소를활용해형광의강도를측정해목적유전자의증폭을확인하는방법으로, 이중 SYBR Green I은 DNA 이중나선사이로결합되어나타나는형광을측정함으로써 Cp 값과 Tm값을알수있고이를통해시료의농도, 증폭여부및종을확인할수있다 18). Cp 값은증폭물이나타나면서형광이증가하기시작하는점으로주형의농도가많을수록빠른시간내에나타난다. Tm 값은반응이끝난후 60~95 o C까지온도를올려주게되면 DNA의이중나선이단일가닥으로떨어지면서 SYBR Green I이방출되는데염기서열의길이및구성에따라방출되는온도가다르다. 이특정온도를이용하여목적유전자가맞는지확인할수있다 18). 본연구에서도 L. monocytogenes의정량분석을위해 melting peak를확인한결과 L. monocytogenes의경우 Tm값이약 87 o C로고유의 melting peak가나타나는반면에 W. cibaria 0D17와 W. confuse 0D23는확인되지않았다. 이를통해 W. cibaria 0D17와 W. confuse 0D23와공동배양시에 L. monocytogene 만을정량적으로분석이가능한것을확인하였다 (Fig. 2). 그리고, 정량분석을위한표준곡선은배양된 L. monocytogenes를약 2~6 log CFU/mL로 10진희석하여실시간정량 PCR을통해유전자를증폭하여 Cp 값과농도와의선형분석결과, 상관계수 0.994, 기울기는 으로나타났다 (Fig. 3). 표준곡선에위생처리를 3반복실험한 Cp값의평균을대입하여 L. monocytogenes의농도를산출하였다. 이를통해 W. cibaria 0D17와 W. confusa 0D23 가 L. monocytogenes와공동배양시생육억제효과를확인한결과는 Table 1과같다. 37 o C의경우, W. cibaria 0D17와 W. confusa 0D23는 L. monocytogenes에대한생육억제효과가공동배양하지않은때와비교해약 4log CFU/mL 수준으로확인되었다. 또한, 4 o C에서는 W. cibaria 0D17와 W. confusa 0D23 모두 L. monocytogenes의생육억제에는효과가크게나타나지않는것으로나타났다. 이러한결과는 Weissella spp. 가 4 o C에서는생육이거의되지않으나, 37 o C에서는왕성하게생육하면서유기산, Fig. 3. Real-time PCR for quantitative detection of L. monocytogenes. A) Amplification profiles of 10 fold serial dilution of L. monocytogenes. : 6 log CFU/mL, : 5 log CFU/mL, : 4 log CFU/ ml, : 3 log CFU/mL, : 2 log CFU/mL. B) Standard curve showing correlation between Cp and log concentration. Table 1. Quantitative analysis of L. monocytogenes co-cultured with W. cibaria 0D17 and W. confusa 0D23 after 24 h 37 o C (CFU/mL) 4 o C (CFU/mL) L. monocytogenes L. monocytogenes cocultured with W. cibaria 0D L. monocytogenes cocultured with W. confusa 0D bacteriocin 등의다양한항균물질을생산할수있기때문으로보인다. 따라서, 저온성식중독세균인 L. monocytogenes의제어를위해서 Weissella spp. 또는다른유산균이생산하는 bacteriocin과의병행처리를통해저온발효에서도효과적인제어가가능할것을판단된다. 최근 L. monocytogenes에대한위해성이높아짐에따라 anti-listeria 활성이있는 E. faecium, L. sake, L. mesenteroides, P. pentosaceus 및 P. acidilactici 등 19~22) 의 bacteriocin 등의항균물질과다양한식품저장조건에대한연구가진행되어왔다 23-25). 하지만, Weissella spp. 에의한 L. monocytogenes 에생육억제에대한연구는상대적으로많이이루어지지않았으나, 근래에 Weissella spp. 가생산하는 weissellicin에
5 Inhibition of L. monocytogenes by Weissella spp 107 대한분리와항균활성특성에대한연구결과가보고되었으며, L. monocytogene에대한항균효과가있는 bacteriocin과항균효과가없는 bacteriocin도있는것으로알려져있다 8,9). 따라서, 추후에김치유래 Weissella spp. 에대한항균물질과유기산등의특성규명과더불어상호작용에관한연구를통해 L. monocytogenes 이외에다양한식중독세균에제어를위한생균제또는항균제로서사용이가능할것으로판단된다. 본연구에서분리된 W. cibaria 0D17와 W. confusa 0D23가 L. monocytogenes와공동배양시생육억제효과는이들이생산하는유기산등의항균효과를갖는물질과함께 bacteriocin에의해생육억제가있었을것으로판단된다. 따라서, W. cibaria 0D17와 W. confusa 0D23가생성하는 weissellicin 등의 bacteriocin에대한특성규명에대한연구가필요할것이며, 다양한식품내에서 L. monocytogenes와 Weissella spp. 가함께존재하였을때각각의생리특성, 발효식품의특성변화등에대한추가적인연구가수행되어야할것이다. 또한, 공동배양시분자수준에서변화를 metagenomics 분석이나 transcriptomics 분석등을통해규명되어야할것이다. 요약 본연구에서는김치로부터 W. cibaria 0D17와 W. confusa 0D23를생화학적특성분석과 16s rrna 염기서열분석을통해분리, 동정하였으며, W. cibaria 0D17와 W. confusa 0D23 배양상등액이 L. monocytogenes에대한항균효과가있는것으로나타났다. 또한, 실시간정량 PCR을통해 W. cibaria 0D17 및 W. confusa 0D23가 L. monocytogenes 를공동배양했을때의생육억제효과를분석한결과, 37 o C 에서는생육억제효과가있는것으로확인되었다. 따라서, 김치유래 Weissella spp. 가갖는 L. monocytogenes에대한항균활성에대한기초자료로활용가능할것으로판단되며, W. cibaria 0D17 및 W. confusa 0D23가생산하는 bacteriocin 등의항균물질특성에대한연구가추가적으로진행될필요가있을것이다. 감사의말씀 본논문은농촌진흥청연구사업 ( 과제번호 : PJ009799) 의지원에의해이루어진것임. 참고문헌 1. Leroy, F. and De Vuyst, L.: Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends Food Sci. Technol. 15, (2004). 2. Vyas, U. and Ranganathan, N.: Probiotics, prebiotics, and synbiotics: Gut and beyond. Gastroenterol. Res. Pract. 2012, 1-16 (2012). 3. Jeppsson, B., Mangell, P., and Thorlacius, H.: Use of probiotics as prophylaxis for postoperative infections. Nutri. 3, (2011). 4. Wallace, T.C., Guarner, F., Madsen, K., Cabana, M.D., Gibson, G., Hentges, E., and Sanders, M.E.: Human gut microbiota and its relationship to health and disease. Nutr. Rev. 69, (2011). 5. De Bruyne, K., Camu, N., De Vuyst, L., and Vandamme, P.: Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation. Int. J. Syst. Evol. Microbiol. 60, (2010). 6. Collins, M.D., Samelis, J., Metaxopoulos, J., and Wallbanks, S.: Taxonomic studies on some leuconostoc-like organisms from fermented sausages: description of a new genus Weissella for the Leuconostoc paramesenteroides group of species. J. Appl. Bacteriol. 75, (1993). 7. Kim, J.H., Lee, K.W., Han, N.S., Park, J.Y., and Chun, J.Y.: Importance of Weissella Species during Kimchi Fermentation and Future Works. J. Microbiol. Biotechnol. 38, (2010). 8. Srionnual, S., Yanagida, F., Lin, L.H., Hsiao, K.N., and Chen, Y.S.: Weissellicin 110, a newly discovered bacteriocin from Weissella cibaria 110, isolated from plaa-som, a fermented fish product from Thailand. Appl. Environ. Microbiol. 73, (2007). 9. Leong, K.H., Chen, Y.S., Lin, Y.H., Pan, S.F., Yu, B., and Wu, H.C., Yanagida, F.: Weissellicin L, a novel bacteriocin from sian-sianzih-isolated Weissella hellenica 4-7. J. Appl. Microbiol. 115, (2013). 10. Dieterich, G., Karst, U., Fischer, E. Wehland, J. and Jansch, L.: LEGER: knowledge database and visualization tool for comparative genomics of pathogenic and non-pathogenic Listeria species. Nucleic Acids Res. 34, D402-D406 (2006). 11. Farber, J.M. and Peterkin, P.I.: Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 55, (1991). 12. Gravesen, A., Z. Diao, J. Voss, B.B. Budde, and S. Knochel.: Differential inactivation of Listeria monocytogenes by D- and L lactic acid. Lett. Appl. Microbiol. 39, (2004). 13. Lu, Z., Sebranek, J.G., Dickson, J.S., Mendonca, A.F. and Bailey, T.B.: Application of predictive models to estimate Listeria monocytogenes growth on frankfurters treated with organic acid salts. J. Food Prot. 68, (2005). 14. Bae, J.W., Rhee, S.K., Park, J.R., Chung, W.H., Nam, Y.D., Lee, I., Kim, H. and Park, Y.H.: Development and evaluation of genome-probing microarray for monitoring lactic acid bacteria. Appl. Environ. Microbiol. 71, (2005). 15. Kim, M.J., and Chun, J.S.: Bacterial community structure in kimchi, a Korean fermented vegetable food, as revealed by 16S rrna gene analysis. Int. J. Food Microbiol. 103, (2005). 16. Lee, J.S., Heo, G.Y., Lee, J.W., Oh, Y.J., Park, J.A., Park, Y.H., Pyun,Y.R., and Ahn, J.S.: Analysis of kimchi microflora using denaturing gradient gel electrophoresis. Int. J.
6 108 Young-Duck Lee, Dae-Yong Kim, and Jong-Hyun Park Food Microbiol. 102, (2005). 17. Ahn, S.B., Park, H.E., Lee, S.M., Kim, S.Y., Shon, M.Y., and Lee, W.K.: Characteristics and immuno-modulatory effects of Weissella cibaria JW15 isolated from Kimchi, Korea traditional fermented food, for probiotic use. J. Biomed. Res. 14, (2013). 18. Maurer, J.: The methodology of PCR. pp 27-40: In: PCR methods in foods. Maurer J (ed.), Springer, Inc., New York, NY, USA (2006). 19. Heo, S., Lee, S.K., Lee, C.H., Min, S.G., Park, J.S., and Kim. H.Y.: Morphological changes induced in Listeria monocytogenes V7 by a bacteriocin produced by Pediococcus acidilactici. J. Microbiol. Biotechnol. 17, (2007). 20. Iseppi, R., Pilati, F., Marini, M., Toselli, M., Niederhausern, D.S., Guerrieri, F., Messi, P., Sabia, C., Manicardi, G., Anacarso, I., and Bondi, M.: Anti-listerial activity of a polymeric film coated with hybrid coatings doped with Enterocin 416K1 for use as bioactive food packaging. Int. J. Food Microbiol. 30, (2008). 21. Shin, M.S., Han, S.K., Ryu, J.S., Kim, K.S., and Lee, W.K.: Isolation and partial characterization of a bacteriocin produced by Pediococcus pentosaceus K23-2 isolated from Kimchi. J. Appl. Microbiol. 105, (2008). 22. Trias, R., Badosa, E., Montesinos, E., and Baneras, L.: Bioprotective Leuconostoc strains against Listeria monocytogenes in fresh fruits and vegetables. Int. J. Food Microbiol. 127, (2008). 23. Boyer, R.R., Matak, K., Sumner, S.S., Meadows, B., Williams, R.C., Eifert, J.D., Birbari, W.: Survival of Listeria monocytogenes, Listeria innocua, and lactic acid bacteria in chill brines. J. Food Sci. 74, M219-M23 (2009). 24. Aguilar, C., and KLOTZ, B.: Effect of the temperature on the antagonistic activity of lactic acid bacteria against Escherichia coli and Listeria monocytogenes. J. Food Safety. 30, (2010). 25. de Carvalho, A.A., de Paula, R.A., Mantovani, H.C., and de Moraes, C.A.: Inhibition of Listeria monocytogenes by a lactic acid bacterium isolated from Italian salami. Food Microbiol. 23, (2006).
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information43(2)-10(단보)023(p ).fm
The Korean Journal of Microbiology, Vol. 43, No. 2, June 2007, p. 142-146 Copyright 2007, The Microbiological Society of Korea Ginsenoside y ƒ w z ½ ³Á½» Á * w w w œw l (Panax ginseng) z w x š. ù, w š
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information22 (07-29-OK).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 43(2), 328~332(2014) http://dx.doi.org/10.3746/jkfn.2014.43.2.328 김치의저장성향상을위한항균활성우수유산균선발 연구노트 최학종 1 김유진 1 이나라 1 박해웅 1 장자영 1 박성희 1 강미란 1 김현주 1 이종희 1 이종훈 2 변유량 3 김태운
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationpissn eissn J. Milk Sci. Biotechnol. 2019;37(2): ARTICLE 전통김치로부터 Probiotic 유산균의
pissn 2384-0269 eissn 2508-3635 J. Milk Sci. Biotechnol. 2019;37(2):115-128 https://doi.org/10.22424/jmsb.2019.37.2.115 ARTICLE 전통김치로부터 Probiotic 유산균의분리및우유발효특성 임영순 * 김지연 강현철 서울에프엔비식품연구소 Isolation and Identification
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information(......).hwp
7 6 4 10 20 30 ph 5 4 3 0 10 20 30 40 50 60 Fermentation time(day) Fig.2-1. Changes of ph in DLMK according to various fermentation temperature 2 4 10 20 30 Acidity (%) 1 0 0 10 20 30 40 50 60 Fermentation
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationDBPIA-NURIMEDIA
J East Asian Soc Diet Life 27(3): 348 363 (2017) http://dx.doi.org/10.17495/easdl.2017.6.27.3.348 348 1 1 2 1 1, 2 Mixed Culture Characteristics of Fungi Strains isolated from Korean Traditional Nuruk
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
More information<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information13장문현(541~556)ok
A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More information<C8B2BCBABCF62DB8D4B0C5B8AEBFCDB0C7B0AD2E687770>
먹거리와 건강 황성수 인도주의실천의협의회(humandoctor.org) 황성수 의사님의 글 http://humandoctor.org/technote/main.cgi?board=whang 서적 곰탕이 건강을 말아먹는다 로도 출판되어 있음. lightworker.kr 편집 1. 이 글을 읽는 분들에게 황성수의 먹거리와 건강 을 읽는 모든 분들에게 인사드립니다.
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More information41.4(8) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 41, No. 4, pp. 399~404 (2009) The Korean Society of Food Science and Technology Bacillus subtilis Lactobacillus plantarum yw t e w Á û * œ w tœw Effect of the Mixed Culture
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석
한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information(1) 04. 오계헌.fm
Korean Society for Biotechnology and Bioengineering Journal 28(1): 1823 (2013) http://dx.doi.org/10.7841/ksbbj.2013.28.1.18 연구논문 장기간발효김치인묵은지에서분리한 Lactobacillus sakei JK17 의기능성조사 김동선, 조형우, 김대한, 오계헌 * Functional
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More informationDBPIA-NURIMEDIA
J Korean Soc Food Sci Nutr 한국식품영양과학회지 39(4), 595~601(2010) DOI: 10.3746/jkfn.2010.39.4.595 Multiplex Polymerase Chain Reaction(PCR) 법을이용한 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information<C3D6C1BEBAB8B0EDBCAD2E687770>
Counter Pulse Generator TRX(Thyratron) Oscilloscope Pump Chamber Power Supply Oscilloscope Controller Inductor High Voltage Pulse Generator (-) 펄스폭:-0.5uS, 승압비:-1:2(GND) (-) 펄스폭:-2uS, 승압비:-1:1(GND)
More information00....
Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More informationuntitled
ª Œª Œ 27ƒ 2B Á 2007 3œ pp. 193 ~ 199 ª ƒ w d w ƒ sƒ Methodology of Drought Assessment Using National Groundwater Monitoring Network Data «x Á½ Kwon, Hyung JoongÁKim, Seong Joon Abstract The objective
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information< 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ]
< 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 2010. 09. 28. 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ] 목 차 Ⅰ. 탐구주제 02 Ⅱ. 탐구하게된동기 02 Ⅲ. 배경이론 02 1. 유글레나의특징가. ph 나. 온도 Ⅳ. 선행연구고찰 03 1. 산소결핍과인체에미치는영향
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information공학박사학위 논문 운영 중 터널확대 굴착시 지반거동 특성분석 및 프로텍터 설계 Ground Behavior Analysis and Protector Design during the Enlargement of a Tunnel in Operation 2011년 2월 인하대
저작자표시-비영리-동일조건변경허락 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 이차적 저작물을 작성할 수 있습니다. 다음과 같은 조건을 따라야 합니다: 저작자표시. 귀하는 원저작자를 표시하여야 합니다. 비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information<372E20B9DAC0B1C8F12DB0E62E687770>
7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information43-4(08) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 43, 4, pp. 446~452 (2011) The Korean Society of Food Science and Technology 김치에서항균활성유산균의분리및동정 김수영 1 김종두 1 손지수 1 이시경 2 박갑주 3 박명수 * 안양과학대학호텔조리과, 1 건국대학교생명과학과, 2 건국대학교응용생명과학부,
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
More information