<31355F28C0CFB9DD29B1E8B5B5C8C62E687770>
|
|
- 량하 빈
- 7 years ago
- Views:
Transcription
1 J Plant Biotechnol (2016) 43: DOI: ISSN (Print) ISSN (Online) Research Article 육종용추출물의미백과항노화효과 양원태 김경숙 권용삼 김두현 김도훈 Whitening and anti-aging effects of Cistanche deserticola extract Won Tae Yang Kyoung Sook Kim Yong Sham Kwon Du Hyun Kim Doh Hoon Kim Received: 10 October 2016 / Revised: 31 October 2016 / Accepted: 1 November 2016 c Korean Society for Plant Biotechnology Abstract This study assessed the whitening and anti-aging effects of the Cistanche deserticola extract, to develop a cosmetic substance. The cell viability of the Cistanche deserticola extract was evaluated in B16F10 melanoma cells by the MTT (3-(4,5-dimethylthaiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay. The cell viability of the extract was determined to be 90% at 4mg/ml concentration. Furthermore, the tyrosinase, collagenase, and elastase mrna expression level were measured by RT-PCR, using the Cistanche deserticola extract treated B16F10 melanoma cells. At 4 mg/ml concentration, mrna expression level of tyrosinase, collagenase, and elastase was dramatically decreased to 80.9%, 37.6%, and 70.9%, respectively. The antioxidant activity of the Cistanche deserticola extract was determined by DPPH free radical scavenging. The DPPH free radical scavenging capacities ranged from 70.6% to 82.6%, when evaluated from 2 mg/ml to 10mg/ml concentrations. The effects of whitening and anti-aging of the Cistanche deserticola extracts were examined at 2, 4, 6, 8, and 10 mg/ml concentration. Tyrosinase activities were inhibited from 66.8% to 78.5%, elastase activities were inhibited from 67.6% to 79.3%, collagenase activities were inhibited from 72.3% to 83.6%, and hyaluronidase activities were inhibited from 65.8% to 69.2%, respectively. These data suggest that the Cistanche deserticola extract is effective in whitening and anti-aging; therefore, it is considered to be a functional cosmetic material in cosmetic products. W. T. Yang K. S. Kim Y. S. Kwon D. H. Kim D. H. Kim ( ) 동아대학교생명자원과학대학 (College of Life Science and Natural Resources, Dong-A University, Busan, , Korea) dhkim@dau.ac.kr Keywords Cosmetic product, Tyrosinase, Elastase, Collagenase, Hyaluronidase 서론 생활수준의향상과노령화사회의가속화로인하여현대인들은외적인미에대한관심이증가하면서피부의기능뿐만아니라피부노화에대한관심또한크게증가하고있다. 피부는외부의자극으로부터인체를보호해주는방어조직이며, 피부색은멜라닌과카로틴등의색소성분의양과분포, 혈관의분포및혈액, 각질층의두께및피부자체의두께와색등에의해결정된다. 피부노화는유전적요인, 나이가들어감에따른호르몬의변화, 대사적과정등의내적요인과오염된환경, 야외활동증가에따른장기적자외선노출과사회활동에서오는스트레스증가에따른활성산소의증가등다양한외적요인이피부조직의콜라겐과엘라스틴을변성시켜피부탄력을저하시키고피부주름을생성함으로피부노화를촉진한다. 이로인하여건강기능성식품과기능성화장품에대한관심과수요가증가하고있으며, 생리활성물질을이용한기능성화장품개발연구가활발히진행되고있다 (Lim and Kim 2009; Kim et al. 2006; Gang et al. 2009). 또한, 염증은피부가붓고열을동반한통증과피부의기능장애등을일으키며, 그주된원인은미생물감염및자가면역질환으로알려져있다 (Jeong et al. 1997). 최근천연물에서분리된생리활성물질들의미백, 항산화, 항균, 보습등의피부노화억제효과가밝혀지고있으며, 건강기능성식품의항산화활성및항노화효과에대한연구도이루어지고있다 (Mun and Park 1995; Kligman 2000; Kim et al. 1994; Sharman et al. 1994). Ascorbic acid 와 arbutin 등의물질은화장품의소재로많이이용되고, 강한항산화효과및미백효과를가지고있 This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 J Plant Biotechnol (2016) 43: 으나경제성과안전성문제로인하여대체물질의개발이필요하며, 최근에천연물유래의생리활성물질을이용한항산화및항노화기능을가진화장품소재개발과관련된많은연구가이루어지고있다 (Lee et al. 2006; Lee and Cho 2007). 본연구에이용된육종용은 Cistanche 속, 열당과에속하는약용식물로서중국서부의사막지대에서자라며 Haloxylos ammidendrum 의뿌리에기생하는약용식물이다. 육종용은 1980 년대부터현재까지일본과중국의연구자들로부터많은관심을받아왔으며 17 개의 phenylethanoid glycosides 화합물이분리되었고, 약리작용으로는항산화작용, 항노화작용, 항염작용및진정작용등이보고되어있다 (Lu 1998; Kobayashi et al. 1984; Kobayashi et al. 1984; Kobayashi et al. 1985). 따라서본연구는육종용을이용한기능성화장품소재개발을목적으로생리활성물질의항산화및항노화관련효능을검정하였다. 각 well 에가하여 37 C 배양기에서 4 시간정치한후 MTT 용액을제거하였다. 그리고 100 ul DMSO 를가하여세포내에형성된 formazan 결정체를용해한후 570 nm 에서 ELISA plate reader (Bio-rad, Hercules, CA) 를이용하여세포생존율을측정하였다. 피부노화관련유전자의발현검정 육종용추출물을처리한 B16F10 melanoma 세포에 Trizol reagent (Sigma, USA) 를이용하여 Total RNA 를추출하였다. Total RNA 1ug 을 Tetro cdna synthesis kit (BioLine, USA) 를이용하여 cdna 를합성하였고, single stranded cdna 에 10X buffer 2 ul, 10 mm dntp 1.6 ul, 25 mm MgCl ul, 500 U Ex Taq polymerase 0.2 ul 와각각 1 ul 의유전자특이적 primer (Table 1) 를가하여 RT-PCR 을수행하고유전자발현을검정하였다. 재료및방법 시료추출 건조한육종용분말시료 150 g 에물 1L 을가하여 40 C 에서 24 시간동안처리하여 3 회추출하였고, Whatman No. 2 여과지로여과하여얻어진여과액을감압농축한후실험에사용하였다. MTT assay B16F10 melanoma 세포를이용하여 MTT [3-(4,5-dimethylthaiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay 를수행하였다. 10% fetal bovine serum (FBS), penicillin (100U/ml) 과 streptomycin (100ug/ml) 이첨가된 Dulvecco s Modified Eagle Medium (DMEM, Gibco-BRL, Rockville, MD) 에 B16F10 melanoma 세포를넣어 37 C 온도조건으로 5% CO 2 배양기에서배양하여안정화시킨후실험에이용하였다. 배양된 B16 melanoma 세포를 6-well plate 에 1X10 3 cell/well 로분주하여배양한다음육종용추출물을각각다른농도로희석시켜처리한후 24 시간동안배양하였다. 배양된세포를 PBS 로세척하고 100 ul 의 MTT 용액 (5 mg/ml) 을 DPPH 라디칼소거능측정 DPPH (1,1-Diphenyl-2-picryl hydrazyl) 용액을 methanol 에녹여 0.2 mm 로준비하였다. 시료와 DPPH 용액을 1:4 비율로혼합하여 37 C 에서 30 분간반응시킨후흡광광도계 (U-5100, HiTachi, Janpan) 를이용하여 520 nm 에서흡광도를측정하였다. Tyrosinase 저해활성측정 Tyrosinase 활성은 DOPA oxidase 활성을측정한것으로나타냈다. DOPA oxidase 활성은 L-DOPA 를기질로하여 tyrosianse 에의해생성되는반응산물인 dopachrome 을 492 nm 에서측정했다. 각처리구의 tyrosinase 활성측정을위해 67 mm phosphate buffer (ph6.8) 에녹인 L-DOPA (8.3 mm) 120 ul 에 40 ul 육종용추출물과 tyrosinase (125 U) 40 ul 을가하고, 37 C 에서 10 분간반응시킨후흡광광도계를이용하여 492 nm 에서흡광도를측정하였다. Tyrosinase 저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. Elastase 저해활성측정 Elastase 활성측정은육종용추출물 100 ul 와 50 mm Tris-HCl buffer (ph8.6) 에녹인 elastase pancreatic solution TypeⅠ: from Porcine Pancreas (0.6 unit/ml) 용액 50 ul 에 50 mm Tris-HCl Table 1 List of primers used for RT-PCR analysis in this study Name Forward primer (5'to3') Reverse primer (5'to3') Collagenase CTCGAGGTGGACACCACCCT CAGCTGGATGGCCACATCGG Tyrosinase CATTTTTGATTTGAGTGTCT TGTGGTAGTCGTCTTTGTCC Elastase TGCTGATGACATACGTGGCA AGGATTTGGCAAGCGTTGG β-actin ACCGTGAAAAGATGACCCAG TACGGATGTCAACGTCACAC
3 494 J Plant Biotechnol (2016) 43: buffer (ph8.6) 에녹인 N-succinyl-(L-Ala) 3-p-nitoanilide (1 mg/ml) 을 100 ul 가하고 37 C 에서 30 분간반응시킨후흡광광도계를이용하여 410 nm 에서흡광도를측정하였다. Elastase 저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. Collagenase 저해활성측정 Collagenase 활성측정을위해 1M Tris-HCl buffer (ph7.5) 에 4mM CaCl 2 와 4-phenylazovenzyloxycarbonyl-Pro-Leu-Gly-Pro-Arg (0.3 mg/ml) 를녹인기질액 250 ul 에육종용추출물 100 ul 와 collagenase (0.2 mg/ml) 150 ul 를가한후실온에서 20 분간배양하고 6% citric acid 500 ul 을넣어반응을정지시켰다. Ethylacetate 1.5 ml 을가한후상등액을취하고흡광광도계를이용하여 320 nm 에서흡광도를측정하였다. Collagenase 의저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. Hyaluronidase 저해활성측정 Hyaluronidase 활성은 sodium-hyaluronic acid (HA) 로부터형성된 N-acetylglucosamine 을 glucoxazoline 유도체로변형시킨후 p-dimethylaminobenzal dehyde (DMAB) 로발색시켜효소활성을측정하였다. 0.1M acetate buffer (ph3.5) 에녹인 HAase (7,900 U/ml) 50 ul 에육종용추출물 100 ul 를혼합한후 37 C 에서 20 분간배양한후 12.5 mm CaCl ul 를가하여 37 C 에서 20 분간배양하였다. 기질로 0.1M acetate buffer (ph3.5) 에녹인 HA (12 mg/ml) 250 ul 을가하고다시 40 분간배양하였다. 0.4 N potassiumtetraborate 100 ul 와 0.4 N NaOH 용액 100 ul 을가한후끓는물에서 3 분동안가열하고상온에서완전히냉각시켰다. 냉각시킨반응물에발색제로 DMAB 3 ml 을가한후 37 C 에서 20 분간배양하고, 흡광광도계를이용하여 585 nm 에서흡광도를측정하였다. Hyaluronidase 저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. B16F10 melanoma 세포를이용한세포생존율을측정하여세포독성검정을실시한결과는 Figure 1 과같다. 육종용추출물을 0, 2, 4, 6, 8, 10 mg/ml 의농도로처리한결과 2-4 mg/ml 농도에서 90% 이상의세포생존율을보여 B16 melanoma 세포에대해독성이거의없는것으로나타났으며, 육종용추출물 4 mg/ml 의농도까지화장품조성물로이용할수있는최적농도로확인되었다. Chin and Cho (2005) 의어성초추출물의경우 100 ug/ml 의농도에서 74% 세포생존율을보였으며, Lee and Yoon (2015) 의연잎추출물의경우 1 mg/ml 의농도에서 81% 세포생존율을보인결과와비교하여육종용추출물의 B16 melanoma 세포생존율이 4 ~40 배높은농도에서도독성이거의없는것을확인할수있었다. 피부노화관련유전자발현측정 육종용추출물이피부미백및노화관련유전자의발현에미치는영향을알아보기위하여육종용추출물을 0, 2, 4, 6, 8, 10 mg/ml 농도로 24 시간처리한 B16F10 melanoma 세포를회수하여 RNA 를추출하고, RT-PCR 로유전자발현을검정한결과는 Figure 2 와같다. β-actin 을 positive control 로사용하였고, 피부노화와관련된유전자인 tyrosinase, collagenase 및 elastase 유전자특이 primer 를이용하여유전자발현량을조사한결과육종용추출물을처리구에서추출물의농도가증가함에따라유전자발현이현저히억제되었으며, 특히 4 mg/ml 농도에서 tyrosinase 는 80.9%, collagenase 는 37.6%, elastase 는 70.9% 로급격히유전자의발현량이감소한것으로나타났다. 결과및고찰 B16F10 melanoma 세포생존율측정 MTT 는노란색의수용성물질로서살아있는세포에존재하는 reductase 에의해보라색의 formazan 결정체로변형된다. MTT assay 는세포생존율을측정할수있는방법으로변형된 formazan 결정체의양을통하여살아있는세포의양을측정할수있다 (Kwak and Kim 2011; Gross and Lapiere 1962). Fig. 1 Effect of Cistanche deserticola extracts on cell viability of B16F10 melanoma cells. Cells were treated with various concentrations of Cistanche deserticola extracts (0-10 mg/ml). Cell viability was measured by the MTT assay. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, ***p < )
4 J Plant Biotechnol (2016) 43: Fig. 2 Transcriptional expression levels of genes related to anti-aging, from Cistanche deserticola extracts treated B16F10 melanoma cells. The cells were treated with 0, 2, 4, 6, 8 and 10 mg/ml of Cistanche deserticola extract for 24h. Transcriptional expression level of tyrosinase (A), collagenase (B), and elastase (C) genes were analyzed by RT-PCR using total RNA extracted from B16F10 melanoma cells. β-actin is the loading control. The graph represents the fold value of exposed band intensity 항산화활성 (DPPH) 측정 DPPH 는 free radical 이안정화된물질로질소중심의 radical 이며, flavonoid 및 phenol 성물질과반응하여 DPPH 의감소가진행되면 free radical 의소거반응이일어나처리물질의항산화활성및활성산소에대한억제정도를확인할수있다 (Luciana et al. 2001; Blois 1958). 육종용추출물과대조구인 Vit. C 의 free radical scavenging rate 를측정한결과는 Figure 3 과같다. 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리구의 free radical scavenging rate 는 70.6%, 75%, 76.6%, 79.6%, 82.6% 로나타났으며, 대조구 Vit. C 0.1 mg/ml 의 free radical scavenging rate 는 67.6% 로나타났다. 특히 4 mg/ml 이상의농도에서대조구보다항산화활성이높게나타났다. Kwak et al. (2010) 은자색고구마추출물의경우 5 mg/ml 농도에서 46.8% 보다높은항산화활성을보였다고하였고, Yoon et al. (2015) 은 23 종의약용식물메탄올추출물을대상으로한실험에서두충, 구기자, 화살나무, 비수리, 주목및뽕나무등 6 종의추출물 4 mg/ml 농도에서각각 80.1%, 64.2%, 73.6%, 78.2%, 70.5%, 67.8% 의항산화활성을보였다고하였다. 따라서, 이들보고와본연구의결과를비교하여볼때육종용추출물이높은항산화활성 Fig. 3 Dose-dependant DPPH free radical scavenging rate of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01). 을나타내는것을확인할수있었다. 또한, 항산화활성이우수한 Vit. C 는수용액상태에서쉽게산화되고장기보관의문제와색상변색화로피부외용제로사용하기가어려운반면, 육종용추출물은수용액상태에서도안정적으로항산화활성을나타내기때문에기능성화장품소재로적합할것으로생각된다.
5 496 J Plant Biotechnol (2016) 43: Fig. 4 Dose-dependant tyrosinase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) Fig. 5 Dose-dependant elastase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) Tyrosinase 저해활성측정 멜라닌은 tyrosine hydroxylase 에의해 tyrosine 이 DOPA (dihydroxyphenylalanine) 로전환되고 DOPA oxidase 에의해 DOPA 가 DOPA quinone 으로전환되는두단계의반응을거치며 tyrosinase 의작용에의해생합성된다. Tyrosinase 는피부색소인멜라닌형성을조절할수있는중요한효소로서 tyrosinase 저해활성의측정은천연물의피부미백개선효과를검정하는데있어유용한방법이다 (Uitto 1986). 육종용추출물의 tyrosinase 저해활성을측정한결과 Figure 4 와같다. 육종용추출물의처리농도가증가할수록 tyrosinase 저해활성이증가하였고, 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 66.8%, 72.2%, 73.5%, 76.6%, 78.5% 의 tyrosinase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 62.4% tyrosinase 저해활성이나타났으며, 육종용추출물 4 mg/ml 이상의농도에서대조구에비해높은 tyrosinase 저해활성을보였다. Cho et al. (2009) 의솔순과솔잎추출물 4 mg/ml 농도에서각각 15.2%, 6.9% 의 tyrosinsae 저해활성을보인결과와본연구의결과를비교하였을때육종용추출물의 tyrosinase 저해활성이높게나타나피부미백개선효과가클것으로생각된다. Elastase 저해활성측정 Elastin 는피부진피와피부탄력섬유를구성하는중요한성분중하나로서 elastin 의감소는피부주름생성과탄력저하를야기하고피부노화를촉진시킨다. Elastase 는 elastin 을분해하는효소이고, elastase 의활성을저해하는물질은피부주름을개선하는효과를가진다 (Dewitt et al. 1981). 육종용추출물의 elastase 저해활성을측정한결과 Figure 5 와같다. 육종용추출물의처리농도가증가할수록 elastase 저해활성이증가하였고, 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 67.6%, 74.5%, 76.1%, 77.1%, 79.3% elastase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 65.1% elastase 저해활성이나타났으며, 육종용추출물 4mg/ml 이상의농도에서대조구에비해 elastase 저해활성이현저히높게나타났다. Jung and Kim (2009) 은황기, 자초추출물 1 mg/ml 농도에서 elastase 저해활성이 3.7%, 8.7% 로나타난결과와본연구결과를비교하였을때육종용추출물의 elastase 저해활성이매우높은나타나피부노화방지를위한화장품소재로개발의가능할것으로생각된다. Collagenase 저해활성측정 Collagen 은피부조직결합력및세포접착성등의기능을가지며진피의 90% 에달하는주요구성성분으로서외부자극으로부터피부를보호하고유지시키는기능을한다. Collagen 의감소는피부탄력을유지시키는결합을파괴시켜피부의탄력저하와주름이발생된다. Collagenase 는 collagen 을분해하는효소로서, collagenase 의활성을저해하는물질은피부탄력을유지하고주름방지효과를나타낸다 (El-Domyati et al. 2002). 육종용추출물의 collagenase 저해활성을측정한결과 Figure 6 과같다. 육종용추출물의처리농도가증가할수록 elastase 저해활성이증가하였고, 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 72.3%, 80.2%, 81.1%, 83.4%, 83.6% 의 collagenase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 62.3% collagenase 저해활성이나타났으며, 육종용추출물 4 mg/ml 이상의농도에서대조구에비해높은 collagenase 저해활성을나타냈다. Cheon
6 J Plant Biotechnol (2016) 43: Fig. 6 Dose-dependant collagenase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) Fig. 7 Dose-dependant hyaluronidase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) et al. (2008) 은상황버섯추출물 1 mg/ml 에서 collagenase 저해활성이 6.8% 로나타났고, 추출방법에따른 collagenase 저해활성의차이가크다고보고하였다. 상황버섯의결과와육종용추출물의결과를비교하였을때 collagenase 저해활성효과가높은것으로나타나피부주름개선효과가클것으로생각된다. Hyaluronidase 저해활성측정 Hyaluronidase (HAase) 는 glycosaminoglycan 중합체인 hyaluronic acid (HA) 의 glucosamine 결합을절단하는 moucopolysaccharide 효소로서체내의모세혈관투과성과, 염증반응등에관여한다 (Ghosh 1994). 산성다당류인 HA 는피부진피의구성요소로서뇌, 근육, 연골, 탯줄등에존재하고절반이상이피부에존재한다. Hyaluronic acid 는염증형성요인인 phagocytic ability 를저해하고, hyaluronic acid 는상처치유과정에서 fibrosis 및 collagen deposition 등을증가시키며, 많은양의물과함께존재하기때문에피부에서완충제역할을한다. 피부노화가진행되면피부수분량의감소와함께 hyaluronic acid 농도또한감소하기때문에피부에충분한수분을공급하기위하여 hyaluronic acid 를화장품의보습제원료로널리이용하고있다. HAase 는항알레르기나항염증물질에의해활성이억제되며, HAase 활성을저해함으로서항알레르기및항염증효과를기대할수도있다 (Seo 1988; Batt et al. 1988; Meyer 1947). 육종용추출물의 HAase 저해활성을측정한결과 Figure 7 과같다. 육종용추출물과메탄올추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 65.8%, 67.2%, 67.3% 68.2%, 69.2% HAase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 59% 저해활성이나타났으며, 육종용추출물 2 mg/ml 이 상의농도에서대조구에비해큰 HAase 저해활성을나타냈다. Choi et al. (2008) 이보고한목과, 상황버섯추출물 1mg/ml 농도에서 HAase 활성이각각 58.2%, 55.2% 로나타났다고보고하여, 육종용추출물의경우 HAase 저해활성에미치는효과가우수한것으로판단된다. 본연구에서 MTT assay 를이용한 B16F10 melanoma 세포의생존율실험에서육종용추출물 4 mg/ml 농도이하에서세포생존율이 90% 이상으로나타났고, 이농도에서 tyrosinase, collagenase 및 elastase 유전자의발현이각각 80.9%, 37.6% 및 70.9% 로급격히감소하는것으로나타나미백및항노화에효과적인농도로생각되었다. 육종용추출물의 DPPH 라디칼소거능은대조구인 Vit. C 와비교하여육종용추출물은 70 ~ 80% 이상의우수한항산화효능을나타내어피부노화방지에효과적일것으로평가되었다. 미백, 항노화및항염증효능을검정하기위해육종용추출물을처리한결과, tyrosinase 저해활성은 60 ~ 70%, elastase 저해활성은 60 ~ 70%, collagenase 저해활성은 70 ~ 80%, hyaluronidase 저해활성은 60-70% 로각각나타났으며, 대조구 Vit. C 의 50 ~ 60% 와비교하여우수한미백, 항노화및항염효과가인정되었다. 이상의연구결과를종합해보면, 육종용추출물은높은항산화효능을가지고 tyrosinase, elastase, collagenase 및 hyaluronidase 저해활성도우수한것으로나타났으며, 특히세포의독성과효능을고려할때 4 mg/ml 농도가기능성화장품소재로이용할수있는적정농도로판단된다. 그리고육종용추출물은화장품소재뿐만아니라의약품, 식품등의기능성소재로서가치가있을것으로생각된다.
7 498 J Plant Biotechnol (2016) 43: 적요 본연구는육종용을이용한기능성화장품소재개발을목적으로육종용추출물의피부미백및항노화효능검정을위해수행되었다. 육종용추출물의세포생존율은 B16F10 melanoma 세포를이용하여 MTT assay 를수행하여측정한결과, 육종용추출물 4 mg/ml 농도에서 90% 이상의세포생존율을보였다. 육종용추출물을처리한 B16F10 melanoma 세포를이용하여 RT-PCR 로유전자발현을검정한결과 tyrosinase, collagenase 및 elastase 유전자의발현을육종용추출물 4 mg/ml 농도에서각각 80.9%, 37.6%, 70.9% 억제하였다. 육종용추출물의 DPPH 라디칼소거능측정을이용한항산화활성은 2 ~ 10 mg/ml 농도에서 70.6% ~ 82.6% 로높게나타났다. 육종용추출물의미백과항노화효과를검정하기위하여육종용추출물을 2, 4, 6, 8 및 10 mg/ml 농도로처리하여확인하였다. 육종용추출물의 tyrosinase 저해활성은 66.8% ~ 78.5%, elastase 저해활성은 67.6% ~ 79.3%, collagenase 저해활성은 72.3% ~ 83.6% 로각각나타났으며, hyaluronidase 저해활성은 65.8% ~ 69.2% 로나타났다. 따라서육종용은피부미백및노화방지를위한기능성화장품소재로우수한것으로평가되며, 세포생존율과각종효능을고려할때, 육종용추출물 4 mg/ml 농도가적정농도로판단된다. Acknowledgments This work was supported by the Dong-A University research fund. References Batt MD, Davis WB, Fairhurst E, Gerrard WA, Ridge BD (1988) Changes in the Physical properties of the stratum corneum following treatment with glycerol. J Soc Cosmet Chem 39: Blois MS (1958) Antioxidant determinations by the use of a stable free radical. Nature 26: Cheon SJ, Jang MJ, Jang YA, Choi EY, Jun DH, Kim YH, Cho WA, Jeong YS, Kwon HB, Kim TH, Choi KI, Do JR, Lee CE, Lee JT (2008) Anti-wrinkle Effect of Cambodian Phellinus linteus Extracts. J Life Sci 12: Chin JE, Cho NC (2005) Effect of houttuynia cordata extracts on tyrosinase Gene Expression. J kor Soc Food Sci Nutr 34: Cho EK, Song HJ, Cho HE, Kim MY, Choi IS, Choi YJ (2009) Inhibitory effects of ethanol extracts from Pine Buds (Pinus densiflora) on angiotensin converting enzyme, xanthine oxidase and nitric oxide synthesis. J Life Sci 19: Choi SI, Lee YM, Heo TR (2003) Screening of hyaluronidase inhibitory and free radical scavenging activity in vitro of traditional herbal medicine extracts. J Biotechnol Bioeng 18: DeWitt DL, Rollins T, Day JS, Gauger JA, Smith WL (1981) Orientation of the active site, and antigenic determinants of prostaglandin endoperoxide of synthase in the endoplasmic reticulum. J Biol Chem 256: El-Domyati M, Attia S, Saleh F, Brown D, Birk DE, Gasparro F, Ahmad H, Uitto J (2002) Intrinsic aging vs. photoaging:a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Experimental Dermatology 11: Ghosh P (1994) The role of hyaluronic acid (hyaluronan) in health and disease: interactions with cells, cartilage and components of synovial fluid. Clin Exp Rheumatol 12:75-82 Gang SR, Min KJ, Kim YC (2009) The inhibitory effect of Saururus chinensis water extract on skin wrinkle in hairless mice. J Korean Soc Cosm 15: Gross J, Lapiere CM (1962) Collagenolytic activity in amphibian tissue: a tissue culture assay. Proc Natl Acad Sci 54: Jeong SJ, Kim NY, Ahn NH, Kim YC (1997) Screening of hyaluronidase inhibition activity using a microplate assay. Kor J Pharmacogn 28: Jung JH, Kim KJ (2009) Experimental studies about the inhibitory effect on tyrosinase and elastase activities by various herb medicines. J Kor Med Ophthalmology & Otolaryngology & Dermatology 22:82-91 Kim MJ, Kim JY, Jung TK, Choi SW, Yoon KS (2006) Skin anti-aging effect of Forsythia viridissima L. extract. Kor J Biotechnol Bioeng 21: Kim SY, Kim JH, Ki SK, Oh MJ, Jung MY (1994) Antioxidant activities of selected oriental herb extracts. J Am Oil Chem Soc 71: Kligman D (2000) Cosmeveuticals. Dermatol Clin 18: Kobayashi H, Karasawa H, Miyase T (1984) Studies on the constituents of Cistanchis Herba. III. Chem Pharm Bull 32: Kobayashi H, Karasawa H, Miyase T (1984) Studies on the constituents of Cistanchis Herba. IV. Chem Pharm Bull 32: Kobayashi H, Karasawa H, Miyase T (1985) Studies on the constituents of Cistanchis Herba. V. Chem Pharm Bull 33: Kwak JH, Choi GN, Park JH, Kim JH, Jeong HR, Jeong CH, Heo HJ (2010) Antioxidant and neuronal cell protective effect of purple sweet potato extract. J Agric Life Sci 44:57-66 Kwak YJ, Kim KS (2011) Fermented Viola mandshurica Inhibits melanogenesis in B16 melanoma cell. Biosci Biotechnol Biochem 75: Lee SH, Cho HS (2007) Trends in functional food ingredients for beauty and its application in skin care. Food Sci Ind 40:31-38 Lee YR, Yoon N (2015) Anti-Oxidative and Anti-Diabetic Effects of MethanolExtracts from Medicinal Plants. J Korean Soc Food Sci Nutr 44:
8 J Plant Biotechnol (2016) 43: Lee YS, Park JH, Kim MH, Kim HJ (2006) Synthesis of tyrosinase inhibitory kojic acid derivative. Arch Pharm (Weinheim) 339: Lim SJ, Kim JD (2009) Skin-whitening awareness and whiteningcare behavior in women. J. Kor Soc Cosm 15: Lu MC (1998) Studies on the sedative effect of Chstanche deserticola. J Ethnopharmacol. 59: Luciana L, Mensor FS, Menezes GG, Leitao AS, Reis TC, Santos D, Cintia SC, Suzana GL (2001) Screeing of Brazilian plant extracts for antioxidant activity by the use of DPPH free radical method. Phytother Res 15: Meyer K (1947) The biological significance of hyaluronic acid and hyaluronidase. Physiol Rev 27: Mun JH, Park CW (1995) Flavonoid chemistry of Polygonum sect. Tovara (Polygonaceae) a systematic survey. Pl Syst Evol Seo YS (1988) Hyaluronic acid; properties and applications. Polymer (korea) 12: Sharman S, Jill DS, Kelloff GJ,Vernon ES (1994) Screening of potential chemopreventive agents using biochemical markers of carcinogenesis. Cancer Res 54: Uitto J (1986) Connective tissue biochemistry of the aging dermi s:age-related alterations in collagen and elastin. Dermatol Clin 4: Yoo DH, Joo DH, Lee SY, Lee JY (2015) Antioxidant effect of nelumbonucifera G. leaf extract and inhibition of MITF, TRP-1, TRP-2 and tyrosinase expression in a B16F10 melanoma cell line. J Life Sci 10:
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
Statistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
μ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
DBPIA-NURIMEDIA
J. Ginseng Res. Vol. 30, No., 8-87 (006) y r w z yᜠÁÁ½Á *ÁÁ # w t gw tw (006 6 7, 006 6 0 ) Comparison of Phenolic Compounds Contents between White and Red ginseng and Their Inhibitory Effect on Melanin
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
Jkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
Ⅰ. 서 론 鼻 茸 은 비강과 부비동의 점막이 염증성, 부종성 변 화로 돌출되어 발생하는 질환으로 비교적 흔하며 그 표면이 매끄럽고 회백색 혹은 회적색을 띠고 있다. 감 염과 알레르기가 중요한 발병원인으로 생각되고 있으 며, 치료 후에도 잘 재발하는 만성 염증성 질환이
J Korean Med Ophthalmol Otolaryngol Dermatol 2015;28(2):85-92 pissn 1738-6640 eissn 2234-4020 http://www.ood.or.kr http://dx.doi.org/10.6114/jkood.2015.28.2.085 Case Report / 증례 지혈겸자 적출술을 이용한 비용종 환자의 치험
(72) 발명자 이상현 부산남구오륙도로 85, 101 동 605 호 ( 용호동, 오륙도 SKVIEW 아파트 ) 김미향 부산남구신선로 566, 308 동 1404 호 ( 용호동, GS 하이츠자이 ) 전명제 부산사하구신산북로 63, 나동 301 호 ( 신평동, 중앙쉐르빌
(19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) (45) 공고일자 2014년12월24일 (11) 등록번호 10-1475505 (24) 등록일자 2014년12월16일 (51) 국제특허분류 (Int. Cl.) A61K 8/97 (2006.01) A61Q 19/02 (2006.01) A61Q 19/00 (2006.01) (21) 출원번호 10-2012-0076458
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
DBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
<C6EDC1FD2D32382D34C8A32DBEC8C0CCBAF1C0CEC8C4B0FAC7D0C8B8C1F62E687770>
J Korean Med Ophthalmol Otolaryngol Dermatol 2015;28(4):156-164 pissn 1738-6640 eissn 2234-4020 http://www.ood.or.kr http://dx.doi.org/10.6114/jkood.2015.28.4.156 Report Case / 중례 한양방 치료를 병행한 삼출액을 주소로
53(3)-02(김동욱 147).fm
Korean Chem. Eng. Res., 53(3), 289-294 (2015) http://dx.doi.org/10.9713/kcer.2015.53.3.289 PISSN 0304-128X, EISSN 2233-9558 여주열매추출물의기능성화장품소재특성 김현우 신혜진 황단비 이지은 정향리 김동욱 인제대학교제약공학과 621-749 경남김해시어방동 607 번지
(2)-02(최경자).fm
Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
10 (06-01-OK).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 43(), 695~7(24) http://dx.doi.org/.3746/jkfn.24.43..695 한방발효주주박추출물의미백및피부주름개선효과 이수민 * 이상진,2 * 권이영 백상훈 김종식 3 손호용 4 신우창 ( 주 ) 국순당부설연구소, 2 숙명여자대학교세포운명조절센터 3 안동대학교생명과학과,
???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
(14) hwp
Journal of Life Science 2010 Vol. 20. No. 12. 1838~1843 ISSN : 1225-9918 DOI : 10.5352/JLS.2010.20.12.1838 Anti-Wrinkle Effects of Korean Rice Wine Cake on Human Fibroblast Jung-Min Yoo, Yeo-Jin Kang,
112 Ⅰ. 서론 울금은 (CurcumalongaL.) 생강과 Zingiberaceae 의근경으로 phenol 류및그배당체,monoterpene 배당체,tannin, 기타 sucrose 등의성분으로항염 증작용, 항알레르기작용, 항균작용, 중추억제, 위 액분비억제, 진경
대한피부미용학회지제 8 권제 1 호 111 울금의항산화및미백효과 박은영 허선정 * 김경영 * 황완균 * 양기숙 숙명여자대학교약학대학 중앙대학교약학대학 * Ⅰ. 서론 Ⅱ. 본론 1. 재료및실험방법 2. 실험결과및통계처리 < 목차 > Ⅲ. 결과및고찰 1.DPPH 를이용한항산화능측정 2.Tyrosinase 억제능측정 3. 멜라닌생성억제효과및세포독성 Ⅳ. 결론 참고문헌
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
Microsoft Word - KSR2016S168
2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
α 경성대학교식품응용공학부식품생명공학전공 년 월 일접수 년 월 일승인 α α α α α 활성산소종 은 체내의산화촉진물질 과산화억제물질 의불균형으로인해생성되는수퍼옥사이드라디칼 과산화수소 하이드록시라디칼 등의산소화합물을 경성대학교식품응용공학부식품생명공학전공학사과정 주저자
α 경성대학교식품응용공학부식품생명공학전공 년 월 일접수 년 월 일승인 α α α α α 활성산소종 은 체내의산화촉진물질 과산화억제물질 의불균형으로인해생성되는수퍼옥사이드라디칼 과산화수소 하이드록시라디칼 등의산소화합물을 경성대학교식품응용공학부식품생명공학전공학사과정 주저자 경성대학교식품응용공학부식품생명공학전공교수 교신저자 천원영 김영화 총칭한다 활성산소종은반응성이높아여러생체
1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
untitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
67-72
40 1, 025 029 (2013) Korean J. Poult. Sci. Vol.40, No.1, 025 029 (2013) http://dx.doi.org/10.5536/kjps.2013.40.1.025 25 Assessment of Antimicrobial and Antioxidant Effects of Ripened Medicinal Herb Extracts
(00-1) Journal of Life.hwp
Journal of Life Science 2014 Vol. 24. No. 4. 386~392 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2014.24.4.386 산사 는장미과 의열 매로단맛과신맛이나고우리나라및중국 일본에자생하고 있는붉은색의열매로예로부터항비만
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 18, No. 11 : 2593~2599 Nov. 2014 오픈소스 모바일 UI컴포넌트 선정 절차 프레임워크 손효정 1 이민규 2 성백민
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
DBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 29(3): 199-204 (2014) http://dx.doi.org/10.7841/ksbbj.2014.29.3.199 ISSN 1225-7117 / eissn 2288-8268 연구논문 차전초뿌리추출물이항산화활성및피부미백작용에미치는영향 윤미연 *,
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
본초학표지
大韓本草學會誌제 29 권제 2 호 (2014 년 3 월 ) Kor. J. Herbology 2014;29(2):39-45 ISSN 1229-1765(Print), ISSN 2288-7199(Online) http://dx.doi.org/10.6116/kjh.2014.29.2.39. 한약재복합추출물의인간피부섬유아세포 HS68 에대한항노화효과 신동철 1#, 김귀철
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
58-3(12) fm
J Appl Biol Chem (2015) 58(3), 266 271 http://dx.doi.org/10.3839/jabc.2015.042 Online ISSN 2234-7941 Print ISSN 1976-0442 Original Article: Bioactive Materials Whitening Effects of Solvent Fractions Isolated
untitled
Original Article Experiences of Unwed Mothers Choi, Yang-Ja 1) Kim, Kwuy-Bun 2) 1) Professor, Redcross College of Nursing, 2) Professor, Kyung Hee University, College of Nursing Science 1) 2) 1) 2) Purpose:
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
(......).hwp
7 6 4 10 20 30 ph 5 4 3 0 10 20 30 40 50 60 Fermentation time(day) Fig.2-1. Changes of ph in DLMK according to various fermentation temperature 2 4 10 20 30 Acidity (%) 1 0 0 10 20 30 40 50 60 Fermentation
유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
untitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
jaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
1 1 10-0767050 2 10-1166045 3 10-0895586 4- - 10 4 10-1616887 11 5 10-1358259 12 6 10-0775080 7 10-0973839 8 10-1165269 15 9 10-1056952 16 10 10-1551559 11 10-1179175 12 10-1179177 19 13 10-1136822 20
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
μ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α