<31355F28C0CFB9DD29B1E8B5B5C8C62E687770>

Size: px

Start display at page:

Download "<31355F28C0CFB9DD29B1E8B5B5C8C62E687770>"

량하 빈
7 years ago
Views:

1 J Plant Biotechnol (2016) 43: DOI: ISSN (Print) ISSN (Online) Research Article 육종용추출물의미백과항노화효과 양원태 김경숙 권용삼 김두현 김도훈 Whitening and anti-aging effects of Cistanche deserticola extract Won Tae Yang Kyoung Sook Kim Yong Sham Kwon Du Hyun Kim Doh Hoon Kim Received: 10 October 2016 / Revised: 31 October 2016 / Accepted: 1 November 2016 c Korean Society for Plant Biotechnology Abstract This study assessed the whitening and anti-aging effects of the Cistanche deserticola extract, to develop a cosmetic substance. The cell viability of the Cistanche deserticola extract was evaluated in B16F10 melanoma cells by the MTT (3-(4,5-dimethylthaiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay. The cell viability of the extract was determined to be 90% at 4mg/ml concentration. Furthermore, the tyrosinase, collagenase, and elastase mrna expression level were measured by RT-PCR, using the Cistanche deserticola extract treated B16F10 melanoma cells. At 4 mg/ml concentration, mrna expression level of tyrosinase, collagenase, and elastase was dramatically decreased to 80.9%, 37.6%, and 70.9%, respectively. The antioxidant activity of the Cistanche deserticola extract was determined by DPPH free radical scavenging. The DPPH free radical scavenging capacities ranged from 70.6% to 82.6%, when evaluated from 2 mg/ml to 10mg/ml concentrations. The effects of whitening and anti-aging of the Cistanche deserticola extracts were examined at 2, 4, 6, 8, and 10 mg/ml concentration. Tyrosinase activities were inhibited from 66.8% to 78.5%, elastase activities were inhibited from 67.6% to 79.3%, collagenase activities were inhibited from 72.3% to 83.6%, and hyaluronidase activities were inhibited from 65.8% to 69.2%, respectively. These data suggest that the Cistanche deserticola extract is effective in whitening and anti-aging; therefore, it is considered to be a functional cosmetic material in cosmetic products. W. T. Yang K. S. Kim Y. S. Kwon D. H. Kim D. H. Kim ( ) 동아대학교생명자원과학대학 (College of Life Science and Natural Resources, Dong-A University, Busan, , Korea) dhkim@dau.ac.kr Keywords Cosmetic product, Tyrosinase, Elastase, Collagenase, Hyaluronidase 서론 생활수준의향상과노령화사회의가속화로인하여현대인들은외적인미에대한관심이증가하면서피부의기능뿐만아니라피부노화에대한관심또한크게증가하고있다. 피부는외부의자극으로부터인체를보호해주는방어조직이며, 피부색은멜라닌과카로틴등의색소성분의양과분포, 혈관의분포및혈액, 각질층의두께및피부자체의두께와색등에의해결정된다. 피부노화는유전적요인, 나이가들어감에따른호르몬의변화, 대사적과정등의내적요인과오염된환경, 야외활동증가에따른장기적자외선노출과사회활동에서오는스트레스증가에따른활성산소의증가등다양한외적요인이피부조직의콜라겐과엘라스틴을변성시켜피부탄력을저하시키고피부주름을생성함으로피부노화를촉진한다. 이로인하여건강기능성식품과기능성화장품에대한관심과수요가증가하고있으며, 생리활성물질을이용한기능성화장품개발연구가활발히진행되고있다 (Lim and Kim 2009; Kim et al. 2006; Gang et al. 2009). 또한, 염증은피부가붓고열을동반한통증과피부의기능장애등을일으키며, 그주된원인은미생물감염및자가면역질환으로알려져있다 (Jeong et al. 1997). 최근천연물에서분리된생리활성물질들의미백, 항산화, 항균, 보습등의피부노화억제효과가밝혀지고있으며, 건강기능성식품의항산화활성및항노화효과에대한연구도이루어지고있다 (Mun and Park 1995; Kligman 2000; Kim et al. 1994; Sharman et al. 1994). Ascorbic acid 와 arbutin 등의물질은화장품의소재로많이이용되고, 강한항산화효과및미백효과를가지고있 This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 J Plant Biotechnol (2016) 43: 으나경제성과안전성문제로인하여대체물질의개발이필요하며, 최근에천연물유래의생리활성물질을이용한항산화및항노화기능을가진화장품소재개발과관련된많은연구가이루어지고있다 (Lee et al. 2006; Lee and Cho 2007). 본연구에이용된육종용은 Cistanche 속, 열당과에속하는약용식물로서중국서부의사막지대에서자라며 Haloxylos ammidendrum 의뿌리에기생하는약용식물이다. 육종용은 1980 년대부터현재까지일본과중국의연구자들로부터많은관심을받아왔으며 17 개의 phenylethanoid glycosides 화합물이분리되었고, 약리작용으로는항산화작용, 항노화작용, 항염작용및진정작용등이보고되어있다 (Lu 1998; Kobayashi et al. 1984; Kobayashi et al. 1984; Kobayashi et al. 1985). 따라서본연구는육종용을이용한기능성화장품소재개발을목적으로생리활성물질의항산화및항노화관련효능을검정하였다. 각 well 에가하여 37 C 배양기에서 4 시간정치한후 MTT 용액을제거하였다. 그리고 100 ul DMSO 를가하여세포내에형성된 formazan 결정체를용해한후 570 nm 에서 ELISA plate reader (Bio-rad, Hercules, CA) 를이용하여세포생존율을측정하였다. 피부노화관련유전자의발현검정 육종용추출물을처리한 B16F10 melanoma 세포에 Trizol reagent (Sigma, USA) 를이용하여 Total RNA 를추출하였다. Total RNA 1ug 을 Tetro cdna synthesis kit (BioLine, USA) 를이용하여 cdna 를합성하였고, single stranded cdna 에 10X buffer 2 ul, 10 mm dntp 1.6 ul, 25 mm MgCl ul, 500 U Ex Taq polymerase 0.2 ul 와각각 1 ul 의유전자특이적 primer (Table 1) 를가하여 RT-PCR 을수행하고유전자발현을검정하였다. 재료및방법 시료추출 건조한육종용분말시료 150 g 에물 1L 을가하여 40 C 에서 24 시간동안처리하여 3 회추출하였고, Whatman No. 2 여과지로여과하여얻어진여과액을감압농축한후실험에사용하였다. MTT assay B16F10 melanoma 세포를이용하여 MTT [3-(4,5-dimethylthaiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay 를수행하였다. 10% fetal bovine serum (FBS), penicillin (100U/ml) 과 streptomycin (100ug/ml) 이첨가된 Dulvecco s Modified Eagle Medium (DMEM, Gibco-BRL, Rockville, MD) 에 B16F10 melanoma 세포를넣어 37 C 온도조건으로 5% CO 2 배양기에서배양하여안정화시킨후실험에이용하였다. 배양된 B16 melanoma 세포를 6-well plate 에 1X10 3 cell/well 로분주하여배양한다음육종용추출물을각각다른농도로희석시켜처리한후 24 시간동안배양하였다. 배양된세포를 PBS 로세척하고 100 ul 의 MTT 용액 (5 mg/ml) 을 DPPH 라디칼소거능측정 DPPH (1,1-Diphenyl-2-picryl hydrazyl) 용액을 methanol 에녹여 0.2 mm 로준비하였다. 시료와 DPPH 용액을 1:4 비율로혼합하여 37 C 에서 30 분간반응시킨후흡광광도계 (U-5100, HiTachi, Janpan) 를이용하여 520 nm 에서흡광도를측정하였다. Tyrosinase 저해활성측정 Tyrosinase 활성은 DOPA oxidase 활성을측정한것으로나타냈다. DOPA oxidase 활성은 L-DOPA 를기질로하여 tyrosianse 에의해생성되는반응산물인 dopachrome 을 492 nm 에서측정했다. 각처리구의 tyrosinase 활성측정을위해 67 mm phosphate buffer (ph6.8) 에녹인 L-DOPA (8.3 mm) 120 ul 에 40 ul 육종용추출물과 tyrosinase (125 U) 40 ul 을가하고, 37 C 에서 10 분간반응시킨후흡광광도계를이용하여 492 nm 에서흡광도를측정하였다. Tyrosinase 저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. Elastase 저해활성측정 Elastase 활성측정은육종용추출물 100 ul 와 50 mm Tris-HCl buffer (ph8.6) 에녹인 elastase pancreatic solution TypeⅠ: from Porcine Pancreas (0.6 unit/ml) 용액 50 ul 에 50 mm Tris-HCl Table 1 List of primers used for RT-PCR analysis in this study Name Forward primer (5'to3') Reverse primer (5'to3') Collagenase CTCGAGGTGGACACCACCCT CAGCTGGATGGCCACATCGG Tyrosinase CATTTTTGATTTGAGTGTCT TGTGGTAGTCGTCTTTGTCC Elastase TGCTGATGACATACGTGGCA AGGATTTGGCAAGCGTTGG β-actin ACCGTGAAAAGATGACCCAG TACGGATGTCAACGTCACAC

494 J Plant Biotechnol (2016) 43:492 499 buffer (ph8.6) 에녹인 N-succinyl-(L-Ala) 3-p-nitoanilide (1 mg/ml) 을 100 ul 가하고 37 C 에서 30 분간반응시킨후흡광광도계를이용하여 410 nm 에서흡광도를측정하였다.

3 494 J Plant Biotechnol (2016) 43: buffer (ph8.6) 에녹인 N-succinyl-(L-Ala) 3-p-nitoanilide (1 mg/ml) 을 100 ul 가하고 37 C 에서 30 분간반응시킨후흡광광도계를이용하여 410 nm 에서흡광도를측정하였다. Elastase 저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. Collagenase 저해활성측정 Collagenase 활성측정을위해 1M Tris-HCl buffer (ph7.5) 에 4mM CaCl 2 와 4-phenylazovenzyloxycarbonyl-Pro-Leu-Gly-Pro-Arg (0.3 mg/ml) 를녹인기질액 250 ul 에육종용추출물 100 ul 와 collagenase (0.2 mg/ml) 150 ul 를가한후실온에서 20 분간배양하고 6% citric acid 500 ul 을넣어반응을정지시켰다. Ethylacetate 1.5 ml 을가한후상등액을취하고흡광광도계를이용하여 320 nm 에서흡광도를측정하였다. Collagenase 의저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. Hyaluronidase 저해활성측정 Hyaluronidase 활성은 sodium-hyaluronic acid (HA) 로부터형성된 N-acetylglucosamine 을 glucoxazoline 유도체로변형시킨후 p-dimethylaminobenzal dehyde (DMAB) 로발색시켜효소활성을측정하였다. 0.1M acetate buffer (ph3.5) 에녹인 HAase (7,900 U/ml) 50 ul 에육종용추출물 100 ul 를혼합한후 37 C 에서 20 분간배양한후 12.5 mm CaCl ul 를가하여 37 C 에서 20 분간배양하였다. 기질로 0.1M acetate buffer (ph3.5) 에녹인 HA (12 mg/ml) 250 ul 을가하고다시 40 분간배양하였다. 0.4 N potassiumtetraborate 100 ul 와 0.4 N NaOH 용액 100 ul 을가한후끓는물에서 3 분동안가열하고상온에서완전히냉각시켰다. 냉각시킨반응물에발색제로 DMAB 3 ml 을가한후 37 C 에서 20 분간배양하고, 흡광광도계를이용하여 585 nm 에서흡광도를측정하였다. Hyaluronidase 저해활성은시료용액의첨가구와무첨가구의흡광도감소율로나타내었다. B16F10 melanoma 세포를이용한세포생존율을측정하여세포독성검정을실시한결과는 Figure 1 과같다. 육종용추출물을 0, 2, 4, 6, 8, 10 mg/ml 의농도로처리한결과 2-4 mg/ml 농도에서 90% 이상의세포생존율을보여 B16 melanoma 세포에대해독성이거의없는것으로나타났으며, 육종용추출물 4 mg/ml 의농도까지화장품조성물로이용할수있는최적농도로확인되었다. Chin and Cho (2005) 의어성초추출물의경우 100 ug/ml 의농도에서 74% 세포생존율을보였으며, Lee and Yoon (2015) 의연잎추출물의경우 1 mg/ml 의농도에서 81% 세포생존율을보인결과와비교하여육종용추출물의 B16 melanoma 세포생존율이 4 ~40 배높은농도에서도독성이거의없는것을확인할수있었다. 피부노화관련유전자발현측정 육종용추출물이피부미백및노화관련유전자의발현에미치는영향을알아보기위하여육종용추출물을 0, 2, 4, 6, 8, 10 mg/ml 농도로 24 시간처리한 B16F10 melanoma 세포를회수하여 RNA 를추출하고, RT-PCR 로유전자발현을검정한결과는 Figure 2 와같다. β-actin 을 positive control 로사용하였고, 피부노화와관련된유전자인 tyrosinase, collagenase 및 elastase 유전자특이 primer 를이용하여유전자발현량을조사한결과육종용추출물을처리구에서추출물의농도가증가함에따라유전자발현이현저히억제되었으며, 특히 4 mg/ml 농도에서 tyrosinase 는 80.9%, collagenase 는 37.6%, elastase 는 70.9% 로급격히유전자의발현량이감소한것으로나타났다. 결과및고찰 B16F10 melanoma 세포생존율측정 MTT 는노란색의수용성물질로서살아있는세포에존재하는 reductase 에의해보라색의 formazan 결정체로변형된다. MTT assay 는세포생존율을측정할수있는방법으로변형된 formazan 결정체의양을통하여살아있는세포의양을측정할수있다 (Kwak and Kim 2011; Gross and Lapiere 1962). Fig. 1 Effect of Cistanche deserticola extracts on cell viability of B16F10 melanoma cells. Cells were treated with various concentrations of Cistanche deserticola extracts (0-10 mg/ml). Cell viability was measured by the MTT assay. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, ***p < )

J Plant Biotechnol (2016) 43:492 499 495 Fig. 2 Transcriptional expression levels of genes related to anti-aging, from Cistanche deserticola extracts treated B16F10 melanoma cells.

4 J Plant Biotechnol (2016) 43: Fig. 2 Transcriptional expression levels of genes related to anti-aging, from Cistanche deserticola extracts treated B16F10 melanoma cells. The cells were treated with 0, 2, 4, 6, 8 and 10 mg/ml of Cistanche deserticola extract for 24h. Transcriptional expression level of tyrosinase (A), collagenase (B), and elastase (C) genes were analyzed by RT-PCR using total RNA extracted from B16F10 melanoma cells. β-actin is the loading control. The graph represents the fold value of exposed band intensity 항산화활성 (DPPH) 측정 DPPH 는 free radical 이안정화된물질로질소중심의 radical 이며, flavonoid 및 phenol 성물질과반응하여 DPPH 의감소가진행되면 free radical 의소거반응이일어나처리물질의항산화활성및활성산소에대한억제정도를확인할수있다 (Luciana et al. 2001; Blois 1958). 육종용추출물과대조구인 Vit. C 의 free radical scavenging rate 를측정한결과는 Figure 3 과같다. 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리구의 free radical scavenging rate 는 70.6%, 75%, 76.6%, 79.6%, 82.6% 로나타났으며, 대조구 Vit. C 0.1 mg/ml 의 free radical scavenging rate 는 67.6% 로나타났다. 특히 4 mg/ml 이상의농도에서대조구보다항산화활성이높게나타났다. Kwak et al. (2010) 은자색고구마추출물의경우 5 mg/ml 농도에서 46.8% 보다높은항산화활성을보였다고하였고, Yoon et al. (2015) 은 23 종의약용식물메탄올추출물을대상으로한실험에서두충, 구기자, 화살나무, 비수리, 주목및뽕나무등 6 종의추출물 4 mg/ml 농도에서각각 80.1%, 64.2%, 73.6%, 78.2%, 70.5%, 67.8% 의항산화활성을보였다고하였다. 따라서, 이들보고와본연구의결과를비교하여볼때육종용추출물이높은항산화활성 Fig. 3 Dose-dependant DPPH free radical scavenging rate of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01). 을나타내는것을확인할수있었다. 또한, 항산화활성이우수한 Vit. C 는수용액상태에서쉽게산화되고장기보관의문제와색상변색화로피부외용제로사용하기가어려운반면, 육종용추출물은수용액상태에서도안정적으로항산화활성을나타내기때문에기능성화장품소재로적합할것으로생각된다.

496 J Plant Biotechnol (2016) 43:492 499 Fig. 4 Dose-dependant tyrosinase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml.

5 496 J Plant Biotechnol (2016) 43: Fig. 4 Dose-dependant tyrosinase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) Fig. 5 Dose-dependant elastase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) Tyrosinase 저해활성측정 멜라닌은 tyrosine hydroxylase 에의해 tyrosine 이 DOPA (dihydroxyphenylalanine) 로전환되고 DOPA oxidase 에의해 DOPA 가 DOPA quinone 으로전환되는두단계의반응을거치며 tyrosinase 의작용에의해생합성된다. Tyrosinase 는피부색소인멜라닌형성을조절할수있는중요한효소로서 tyrosinase 저해활성의측정은천연물의피부미백개선효과를검정하는데있어유용한방법이다 (Uitto 1986). 육종용추출물의 tyrosinase 저해활성을측정한결과 Figure 4 와같다. 육종용추출물의처리농도가증가할수록 tyrosinase 저해활성이증가하였고, 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 66.8%, 72.2%, 73.5%, 76.6%, 78.5% 의 tyrosinase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 62.4% tyrosinase 저해활성이나타났으며, 육종용추출물 4 mg/ml 이상의농도에서대조구에비해높은 tyrosinase 저해활성을보였다. Cho et al. (2009) 의솔순과솔잎추출물 4 mg/ml 농도에서각각 15.2%, 6.9% 의 tyrosinsae 저해활성을보인결과와본연구의결과를비교하였을때육종용추출물의 tyrosinase 저해활성이높게나타나피부미백개선효과가클것으로생각된다. Elastase 저해활성측정 Elastin 는피부진피와피부탄력섬유를구성하는중요한성분중하나로서 elastin 의감소는피부주름생성과탄력저하를야기하고피부노화를촉진시킨다. Elastase 는 elastin 을분해하는효소이고, elastase 의활성을저해하는물질은피부주름을개선하는효과를가진다 (Dewitt et al. 1981). 육종용추출물의 elastase 저해활성을측정한결과 Figure 5 와같다. 육종용추출물의처리농도가증가할수록 elastase 저해활성이증가하였고, 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 67.6%, 74.5%, 76.1%, 77.1%, 79.3% elastase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 65.1% elastase 저해활성이나타났으며, 육종용추출물 4mg/ml 이상의농도에서대조구에비해 elastase 저해활성이현저히높게나타났다. Jung and Kim (2009) 은황기, 자초추출물 1 mg/ml 농도에서 elastase 저해활성이 3.7%, 8.7% 로나타난결과와본연구결과를비교하였을때육종용추출물의 elastase 저해활성이매우높은나타나피부노화방지를위한화장품소재로개발의가능할것으로생각된다. Collagenase 저해활성측정 Collagen 은피부조직결합력및세포접착성등의기능을가지며진피의 90% 에달하는주요구성성분으로서외부자극으로부터피부를보호하고유지시키는기능을한다. Collagen 의감소는피부탄력을유지시키는결합을파괴시켜피부의탄력저하와주름이발생된다. Collagenase 는 collagen 을분해하는효소로서, collagenase 의활성을저해하는물질은피부탄력을유지하고주름방지효과를나타낸다 (El-Domyati et al. 2002). 육종용추출물의 collagenase 저해활성을측정한결과 Figure 6 과같다. 육종용추출물의처리농도가증가할수록 elastase 저해활성이증가하였고, 육종용추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 72.3%, 80.2%, 81.1%, 83.4%, 83.6% 의 collagenase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 62.3% collagenase 저해활성이나타났으며, 육종용추출물 4 mg/ml 이상의농도에서대조구에비해높은 collagenase 저해활성을나타냈다. Cheon

J Plant Biotechnol (2016) 43:492 499 497 Fig. 6 Dose-dependant collagenase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1mg/ml.

6 J Plant Biotechnol (2016) 43: Fig. 6 Dose-dependant collagenase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) Fig. 7 Dose-dependant hyaluronidase inhibition activity of Cistanche deserticola extracts. Concentration of Vit C as positive control is 0.1 mg/ml. Values are expressed as mean ± SD of three independent experiments, and represented as % of control cell viability (*p < 0.05, **p < 0.01) et al. (2008) 은상황버섯추출물 1 mg/ml 에서 collagenase 저해활성이 6.8% 로나타났고, 추출방법에따른 collagenase 저해활성의차이가크다고보고하였다. 상황버섯의결과와육종용추출물의결과를비교하였을때 collagenase 저해활성효과가높은것으로나타나피부주름개선효과가클것으로생각된다. Hyaluronidase 저해활성측정 Hyaluronidase (HAase) 는 glycosaminoglycan 중합체인 hyaluronic acid (HA) 의 glucosamine 결합을절단하는 moucopolysaccharide 효소로서체내의모세혈관투과성과, 염증반응등에관여한다 (Ghosh 1994). 산성다당류인 HA 는피부진피의구성요소로서뇌, 근육, 연골, 탯줄등에존재하고절반이상이피부에존재한다. Hyaluronic acid 는염증형성요인인 phagocytic ability 를저해하고, hyaluronic acid 는상처치유과정에서 fibrosis 및 collagen deposition 등을증가시키며, 많은양의물과함께존재하기때문에피부에서완충제역할을한다. 피부노화가진행되면피부수분량의감소와함께 hyaluronic acid 농도또한감소하기때문에피부에충분한수분을공급하기위하여 hyaluronic acid 를화장품의보습제원료로널리이용하고있다. HAase 는항알레르기나항염증물질에의해활성이억제되며, HAase 활성을저해함으로서항알레르기및항염증효과를기대할수도있다 (Seo 1988; Batt et al. 1988; Meyer 1947). 육종용추출물의 HAase 저해활성을측정한결과 Figure 7 과같다. 육종용추출물과메탄올추출물 2, 4, 6, 8, 10 mg/ml 처리농도에서각각 65.8%, 67.2%, 67.3% 68.2%, 69.2% HAase 저해활성을보였고, 대조구인 Vit. C 0.1 mg/ml 농도에서 59% 저해활성이나타났으며, 육종용추출물 2 mg/ml 이 상의농도에서대조구에비해큰 HAase 저해활성을나타냈다. Choi et al. (2008) 이보고한목과, 상황버섯추출물 1mg/ml 농도에서 HAase 활성이각각 58.2%, 55.2% 로나타났다고보고하여, 육종용추출물의경우 HAase 저해활성에미치는효과가우수한것으로판단된다. 본연구에서 MTT assay 를이용한 B16F10 melanoma 세포의생존율실험에서육종용추출물 4 mg/ml 농도이하에서세포생존율이 90% 이상으로나타났고, 이농도에서 tyrosinase, collagenase 및 elastase 유전자의발현이각각 80.9%, 37.6% 및 70.9% 로급격히감소하는것으로나타나미백및항노화에효과적인농도로생각되었다. 육종용추출물의 DPPH 라디칼소거능은대조구인 Vit. C 와비교하여육종용추출물은 70 ~ 80% 이상의우수한항산화효능을나타내어피부노화방지에효과적일것으로평가되었다. 미백, 항노화및항염증효능을검정하기위해육종용추출물을처리한결과, tyrosinase 저해활성은 60 ~ 70%, elastase 저해활성은 60 ~ 70%, collagenase 저해활성은 70 ~ 80%, hyaluronidase 저해활성은 60-70% 로각각나타났으며, 대조구 Vit. C 의 50 ~ 60% 와비교하여우수한미백, 항노화및항염효과가인정되었다. 이상의연구결과를종합해보면, 육종용추출물은높은항산화효능을가지고 tyrosinase, elastase, collagenase 및 hyaluronidase 저해활성도우수한것으로나타났으며, 특히세포의독성과효능을고려할때 4 mg/ml 농도가기능성화장품소재로이용할수있는적정농도로판단된다. 그리고육종용추출물은화장품소재뿐만아니라의약품, 식품등의기능성소재로서가치가있을것으로생각된다.

7 498 J Plant Biotechnol (2016) 43: 적요 본연구는육종용을이용한기능성화장품소재개발을목적으로육종용추출물의피부미백및항노화효능검정을위해수행되었다. 육종용추출물의세포생존율은 B16F10 melanoma 세포를이용하여 MTT assay 를수행하여측정한결과, 육종용추출물 4 mg/ml 농도에서 90% 이상의세포생존율을보였다. 육종용추출물을처리한 B16F10 melanoma 세포를이용하여 RT-PCR 로유전자발현을검정한결과 tyrosinase, collagenase 및 elastase 유전자의발현을육종용추출물 4 mg/ml 농도에서각각 80.9%, 37.6%, 70.9% 억제하였다. 육종용추출물의 DPPH 라디칼소거능측정을이용한항산화활성은 2 ~ 10 mg/ml 농도에서 70.6% ~ 82.6% 로높게나타났다. 육종용추출물의미백과항노화효과를검정하기위하여육종용추출물을 2, 4, 6, 8 및 10 mg/ml 농도로처리하여확인하였다. 육종용추출물의 tyrosinase 저해활성은 66.8% ~ 78.5%, elastase 저해활성은 67.6% ~ 79.3%, collagenase 저해활성은 72.3% ~ 83.6% 로각각나타났으며, hyaluronidase 저해활성은 65.8% ~ 69.2% 로나타났다. 따라서육종용은피부미백및노화방지를위한기능성화장품소재로우수한것으로평가되며, 세포생존율과각종효능을고려할때, 육종용추출물 4 mg/ml 농도가적정농도로판단된다. Acknowledgments This work was supported by the Dong-A University research fund. References Batt MD, Davis WB, Fairhurst E, Gerrard WA, Ridge BD (1988) Changes in the Physical properties of the stratum corneum following treatment with glycerol. J Soc Cosmet Chem 39: Blois MS (1958) Antioxidant determinations by the use of a stable free radical. Nature 26: Cheon SJ, Jang MJ, Jang YA, Choi EY, Jun DH, Kim YH, Cho WA, Jeong YS, Kwon HB, Kim TH, Choi KI, Do JR, Lee CE, Lee JT (2008) Anti-wrinkle Effect of Cambodian Phellinus linteus Extracts. J Life Sci 12: Chin JE, Cho NC (2005) Effect of houttuynia cordata extracts on tyrosinase Gene Expression. J kor Soc Food Sci Nutr 34: Cho EK, Song HJ, Cho HE, Kim MY, Choi IS, Choi YJ (2009) Inhibitory effects of ethanol extracts from Pine Buds (Pinus densiflora) on angiotensin converting enzyme, xanthine oxidase and nitric oxide synthesis. J Life Sci 19: Choi SI, Lee YM, Heo TR (2003) Screening of hyaluronidase inhibitory and free radical scavenging activity in vitro of traditional herbal medicine extracts. J Biotechnol Bioeng 18: DeWitt DL, Rollins T, Day JS, Gauger JA, Smith WL (1981) Orientation of the active site, and antigenic determinants of prostaglandin endoperoxide of synthase in the endoplasmic reticulum. J Biol Chem 256: El-Domyati M, Attia S, Saleh F, Brown D, Birk DE, Gasparro F, Ahmad H, Uitto J (2002) Intrinsic aging vs. photoaging:a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Experimental Dermatology 11: Ghosh P (1994) The role of hyaluronic acid (hyaluronan) in health and disease: interactions with cells, cartilage and components of synovial fluid. Clin Exp Rheumatol 12:75-82 Gang SR, Min KJ, Kim YC (2009) The inhibitory effect of Saururus chinensis water extract on skin wrinkle in hairless mice. J Korean Soc Cosm 15: Gross J, Lapiere CM (1962) Collagenolytic activity in amphibian tissue: a tissue culture assay. Proc Natl Acad Sci 54: Jeong SJ, Kim NY, Ahn NH, Kim YC (1997) Screening of hyaluronidase inhibition activity using a microplate assay. Kor J Pharmacogn 28: Jung JH, Kim KJ (2009) Experimental studies about the inhibitory effect on tyrosinase and elastase activities by various herb medicines. J Kor Med Ophthalmology & Otolaryngology & Dermatology 22:82-91 Kim MJ, Kim JY, Jung TK, Choi SW, Yoon KS (2006) Skin anti-aging effect of Forsythia viridissima L. extract. Kor J Biotechnol Bioeng 21: Kim SY, Kim JH, Ki SK, Oh MJ, Jung MY (1994) Antioxidant activities of selected oriental herb extracts. J Am Oil Chem Soc 71: Kligman D (2000) Cosmeveuticals. Dermatol Clin 18: Kobayashi H, Karasawa H, Miyase T (1984) Studies on the constituents of Cistanchis Herba. III. Chem Pharm Bull 32: Kobayashi H, Karasawa H, Miyase T (1984) Studies on the constituents of Cistanchis Herba. IV. Chem Pharm Bull 32: Kobayashi H, Karasawa H, Miyase T (1985) Studies on the constituents of Cistanchis Herba. V. Chem Pharm Bull 33: Kwak JH, Choi GN, Park JH, Kim JH, Jeong HR, Jeong CH, Heo HJ (2010) Antioxidant and neuronal cell protective effect of purple sweet potato extract. J Agric Life Sci 44:57-66 Kwak YJ, Kim KS (2011) Fermented Viola mandshurica Inhibits melanogenesis in B16 melanoma cell. Biosci Biotechnol Biochem 75: Lee SH, Cho HS (2007) Trends in functional food ingredients for beauty and its application in skin care. Food Sci Ind 40:31-38 Lee YR, Yoon N (2015) Anti-Oxidative and Anti-Diabetic Effects of MethanolExtracts from Medicinal Plants. J Korean Soc Food Sci Nutr 44:

8 J Plant Biotechnol (2016) 43: Lee YS, Park JH, Kim MH, Kim HJ (2006) Synthesis of tyrosinase inhibitory kojic acid derivative. Arch Pharm (Weinheim) 339: Lim SJ, Kim JD (2009) Skin-whitening awareness and whiteningcare behavior in women. J. Kor Soc Cosm 15: Lu MC (1998) Studies on the sedative effect of Chstanche deserticola. J Ethnopharmacol. 59: Luciana L, Mensor FS, Menezes GG, Leitao AS, Reis TC, Santos D, Cintia SC, Suzana GL (2001) Screeing of Brazilian plant extracts for antioxidant activity by the use of DPPH free radical method. Phytother Res 15: Meyer K (1947) The biological significance of hyaluronic acid and hyaluronidase. Physiol Rev 27: Mun JH, Park CW (1995) Flavonoid chemistry of Polygonum sect. Tovara (Polygonaceae) a systematic survey. Pl Syst Evol Seo YS (1988) Hyaluronic acid; properties and applications. Polymer (korea) 12: Sharman S, Jill DS, Kelloff GJ,Vernon ES (1994) Screening of potential chemopreventive agents using biochemical markers of carcinogenesis. Cancer Res 54: Uitto J (1986) Connective tissue biochemistry of the aging dermi s:age-related alterations in collagen and elastin. Dermatol Clin 4: Yoo DH, Joo DH, Lee SY, Lee JY (2015) Antioxidant effect of nelumbonucifera G. leaf extract and inhibition of MITF, TRP-1, TRP-2 and tyrosinase expression in a B16F10 melanoma cell line. J Life Sci 10:

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,