00-목차(41-2).hwp

Transcription

1 Volume 41 Number 2 Vol. 41 No. 2 June ISSN June 30, 2014

2 Volume 41 Number 2 Vol. 41 No. 2 June ISSN June 30, 2014

3 Journal of Plant Biotechnology ISSN Volume 41, Number 2 June 30, 2014 Editorial Board plpm@sunchon.ac.kr hort@pcu.ac.kr ygcho@cbnu.ac.kr jbhee1011@kku.ac.kr hslee@kribb.re.kr lhjid@cbnu.ac.kr yoahn@dongbu.com dwchoi63@chonnam.ac.kr chungws@gsnu.ac.kr sjyun@chonbuk.ac.kr leeko@gnu.ac.kr thzoo@daegu.ac.kr kimjeon4@knu.ac.kr jnam@dau.ac.kr ykwon@kribb.re.kr jhalee@silla.ac.kr grace77@dau.ac.kr jhnlee@dau.ac.kr stkim71@pusan.ac.kr khnam514@sookmyung.ac.kr kykang@hknu.ac.kr kimhr@kribb.re.kr ju-kyung.yu@syngenta.com Editors-in-Chief Park, Ky-Young Sunchon National University Managing Editor Cho, Yong-Gu Chungbuk National University Chung, Woo-Suk Gyeongsang National University Kwon, Suk-yoon KRIBB Associate Editors Kim, Jong-Bo Konkuk University Lee, Haeng-Soon KRIBB Lee, Hye-Jung Chungbuk National University Ahh, Yung-Ock DongBu Farm Hannong Choi, Dong-Uk Chonnam National University Yun, Song-Joong Chonbuk National University Lee, Gyun-O Gyeongsang National University Park, Tae-Ho Daegu National University Kim, Jeong-Hoe Kyungpook National University Nam, Jae-Sung Dong-A University Lee, Jae-Hwa Silla University Jeong, Eun-Suk Dong-A University Lee, Jae-Heon Dong-A University Kim, Sun-Tae Pusan National University Nam, Kyoung-Hee Sookmyung Womem s University Kang, Kwon-Kyoo HanKyong National University Kim, Hye-Ran KRIBB Yu, Ju-Kyung Syngenta Seeds, Inc. Aims and Scope The Journal of the Korean Society of Plant Biotechnology(KSPBT) publishes original, peer-reviewed articles dealing with all aspects of fundamental and applied research in the field of plant biotechnology, which includes molecular biology, genetics, biochemistry, cell and tissue culture, production of secondary metabolites, metabolic engineering, genomics, proteomics, and metabolomics. The journal publishes 4 issues per year, founded in the Korean Society of Plant Biotechnology emphasizes studies related to commercialization of plant biotechnology. The Journal of Plant Biotechnology does not exclude studies on lower plants including algae and cyanobacteria if studies are carried out within the aspects described above. Electronic Edition The Journal of the KSPBT allows open access to all published articles. ANeither registration nor subscription is required to access the electronic free full-text PDF format is avaliable at Subscription Information Neither registration nor subscription is required to access the articles published in the Journal of the KSPBT. The price for subscription of the print version is 30,000KRW annually. Editorial Office The Korean Society of Plant Biotechnology, 2017 Hongin Tower Officetel, 28 Daehak-ro, Yuseong-gu, Daejeon , Korea. Tel: , Fax: , kspbt0986@hanmail.net Society Website: Printing Company CIR / Yejang-dong, Jung-gu, Seoul , Republic of Korea Tel: , Fax: , circom@chol.com Copyright c 2014 by the Korean Society of Plant Biotechnology This journal was supported by the Korean Federation of Science and Technology Societies Grant funded by the Korean Government(MEST) Printed on JUN 25, 2014 and published on JUN 30, 2014 The Korean Society of Plant Biotechnology

4 Journal of Plant Biotechnology Vol. 41 No. 2 June 30, 2014 CONTENTS Review 원형질체융합을이용한감자육종조광수 박태호 65 Potato breeding via protoplast fusion Kwang-Soo Cho Tae-Ho Park Research Articles Paraquat 유도산화스트레스하의배추잎에서 Ascorbate-Glutathione 회로효소의활성도에대한산화질소 (Nitric oxide) 의효과나호견 진창덕 73 Effects of nitric oxide on ascorbate-glutathione cycle enzymes activities in chinese cabbage leaves under paraquat-induced oxidative stress Ho-Gyun Na Chang-Duck Jin Salt cress 유전자의형질전환을통한내염성식물체선별백동원 최원균 강송화 신길옥 박수정 김찬민 박형철 윤대진 81 Screening of salt-tolerance plants using transgenic Arabidopsis that express a salt cress cdna library Dongwon Baek Wonkyun Choi Songhwa Kang Gilok Shin Su Jung Park Chanmin Kim Hyeong Cheol Park Dae-Jin Yun 장기간계대배양된장미배발생캘러스로부터식물체재분화및비정형체로부터새로운배발생캘러스재생이수영 도경란 천경성 김원희 권오현 이혜진 89 New embryogenesis from atypical bodies and plant regeneration from long-term subcultured embryogenic callus in rose Su Young Lee Kyoung Ran Do Kyeong-Seong Cheon Won Hee Kim O Hyeon Kwon Hye Jin Lee 희귀수종미선나무 (Abeliophyllum distichum Nakai.) 의기내증식및발근에미치는 LED (light emitting diode) 효과이나념 최용의 문흥규 94 Effect of LEDs on shoot multiplication and rooting of rare plant Abeliophyllum distichum Nakai Na Nyum Lee Yong Eui Choi Heung Kyu Moon 희귀식물제주황기의미세번식한무석 노설아 곽명철 문흥규 100 Micropropagation of a rare plant species, Astragalus membranaceus Bunge var. alpinus N. Mu Seok Han Seol Ah Noh Myung Cheol Kwak Heung Kyu Moon ON THE COVER: Morphological phenotype of salt cress cdna expression lines. (A) Abnormal flower phenotypes of PL and PL from the T. parvula cdna library. Flowers showed a multi-petaled phenotype. Stamens are replaced by petals, and the central gynoecium was repeated in the flowers. (B) Phenotype of PL Stem thickness was increased compare to WT Arabidopsis. Photos were taken after 7 weeks (p. 00)

5

6 J Plant Biotechnol (2014) 41:65 72 DOI: ISSN Review 원형질체융합을이용한감자육종 조광수 박태호 Potato breeding via protoplast fusion Kwang-Soo Cho Tae-Ho Park Received: 16 June 2014 / Revised: 20 June 2014 / Accepted: 26 June 2014 c Korean Society for Plant Biotechnology Abstract Plant cells from which the cell walls have been enzymatically or mechanically removed are called protoplasts. The protoplasts are theoretically totipotent and can be used as sources of somatic cell fusion in practical breeding programs. Wild Solanum species have often been used as sources of important agricultural traits including diverse disease resistance. However, they cannot often be directly applied to breeding programs due to their sexual incompatibility with S. tuberosum. Somatic hybridization via protoplast fusion is one of the ideal methods to overcome this limitation and to introgress certain traits into S. tuberosum. This technique has still widely been used in potato since the first fusion was reported in 1970s. Therefore, this review highlights general perspectives of protoplast fusion and discusses the application of protoplast fusion in potato breeding. 서론 원형질체 (protoplast) 는세포벽을기계적으로또는효소에의해제거한식물세포를말한다. 이론적으로원형질체는탈분화할수있는능력을가지며, 세포주기로진입하여반복적인유사분열을진행함으로써증식또는다양한기관으로재분화하는등의전형성능을갖는다. 이러한성 K.-S. Cho 국립식량과학원고령지농업연구센터 (Highland of Agriculture Research Center, National Institute of Crop Science, RDA, Pyongchang, , Republic of Korea) T.-H. Park ( ) 대구대학교원예학과, 대구대학교생명환경연구소 (Department of Horticulture and Institute of Life and Environment, Daegu University, Gyeongsan , Republic of Korea) thzoo@daegu.ac.kr 질은다양한식물종을대상으로원형질체융합을이용한실용적인육종방법을제공하며, 생식세포의수정을통해이루어지는접합자의형성전또는형성후, 정상적인접합자를형성하는데문제를발생시키는근연이종식물체간의교잡능력장벽을피해서로다른동형핵체 (homokaryon) 또는이핵접합체 (heterokaryon) 와이형세포질잡종 (alloplasmic hybrids, cybrids) 을창출할수있는기회를제공한다. 4 배체 (2n=4x=48) 인재배종감자 (Solanum tuberosum L.) 는전세계적으로생산량이네번째에이르는가장중요한작물중하나이다. 재배종감자는역병, 풋마름병, 더뎅이병등다양한병에대해감수성을보이며, 이러한병들은결과적으로감자의생산성에영향을줄뿐만아니라품질에도큰영향을미친다. 따라서다양한감자유전자원을이용한병저항성감자품종의육성은다양한병에대해저항성을달성할수있는가장현실적이며이상적인방법으로고려되고있다 (Jansky 2000). Solanum 속의야생종은이러한생물학적인요인뿐만아니라비생물학적요인과다양한농업형질에대한가치를지닌중요한유전자원으로가치를인정받고있으며 (Cardi et al. 1993; Helgeson and Haberlach, 1999), 다양한야생종들이실제감자의병저항성을증대시키기위한육종프로그램에이용되고있다. 하지만많은수의야생종들이재배종감자와생리적으로불화합성이란제한된조건에서육종에활용되고있다. 이는교배양친의배유의게놈구성비 (endosperm balance number, EBN) 에의해결정되며, 이에따른정상적인배와배유형성의여부가이종및이배수체간교잡의성공을결정하는요인이되고있다 (Ortiz and Ehlenfeldt 1992; Cho et al. 1997). 감자의육종에다양한야생종을활용하는데발생되는이러한불화합성을극복하기위한방법으로는도입유전자원의 EBN 을고려하여교배가가능한유전자원들을선재적으로교배하여재배종감자와교배가가능한새로운

7 66 J Plant Biotechnol (2014) 41:65 72 계통을육성하는방법 (bridge crosses), 재배종감자가보유하고있지못한유용형질과관련된유전자를근연야생종에서찾아클로닝하여형질전환방법을이용하여재배종감자로도입하는방법 (genetic modification, GM), 그리고앞서언급한원형질체융합을이용한체세포잡종을유도하는방법 (somatic hybridization) 이있다 (Ahn and Park 2013). 이중 bridge cross 와 GM 방법의경우, 전자는재배종감자와교배가가능한계통을육성하기위하여교배조합을구성하여후대식물체를전개하고도입하고자하는형질에대한선발과정이수차례반복되어야하며, 후자는우선적으로도입하고자하는유용형질과관련된유전자를클로닝하는작업이필수적인과정인이유로시간과노력이많이들뿐만아니라, 특히 GM 방법의경우여전히사회적으로거부감을나타내고있어, 실질적인감자육종에활용하는데많은어려움이있다. 반면에체세포잡종을이용한감자육종은 1970 년대후반감자의원형질체로부터식물체의재분화가성공적으로이루어지고체세포잡종육성프로그램에적용된이래로현재까지도여전히불화합성감자근연야생종으로부터농업적으로중요한형질을재배종감자로도입하는시도가이루어지고있다 (Shepard and Totten 1977; Binding et al. 1978; Melchers et al. 1978). 이에본논문에서는식물원형질체융합에대한전반적인연구현황과감자의근연야생종이가지고있는유용형질을원형질체융합을통하여재배종감자에도입하고자이루어진감자육종연구의실례를대상으로실제육종에이용된근연야생종, 목표형질, 선발방법등을조사하여검토한후국내에서이러한육종방법의적용가능성을논의하고자한다. 식물원형질체융합및선발방법 원형질체융합에대한이론은이미약 100 년여전에보고가되었으며, 작물을이용한체세포잡종의경우에는담배를이용한종간체세포잡종이첫번째성공사례로보고되었다 (Carlson et al. 1972). 이후다른많은식물종에서원형질체를이용하여체세포잡종창출이시도되었고이를통해성공적인체세포잡종식물체재분화가이루어졌으며, 최근까지도다양한식물종을대상으로지속적으로연구가진행되고있다 (Gamborg 2002; Eeckhaut et al. 2013; Shankar et al. 2013). 원형질체융합의방법으로는식물의종류에따라화학적융합법과전기적융합법이이용되고있으며거의유사한비율로적용되고있다. 두가지방법의장점을결합한새로운방법이개발되기도했으나, 이는운향과 (Rutaceae) 식물에서만성공적으로적용된사례로거의이용되고있 지는않다 (Olivares-Fuster et al. 2005). 또한융합대상식물들의유전적기여방식에따라대칭적원형질체융합 (symmetric fusion) 과비대칭적원형질체융합 (asymmetric fusion) 으로구분할수있다. 대칭적원형질체융합은융합대상양친간의완전한게놈이융합된형태를말하며, 이경우특정염색체간에서로거부반응을나타냄에따라유전자충돌 (gene conflict) 현상이증가하게된다. 뿐만아니라, 원하지않는유전적특성이도입되어융합식물체가비정상적으로또는매우느린속도로생장하거나거의불임인식물체로의재분화, 그리고비정상적으로다루기힘든캘러스로의분화등부정적효과가나타나기도한다 (Eeckhaut et al. 2006). 이에반해비대칭적원형질체융합은게놈분절 (genome fragmentation) 이후하나의제한된게놈이융합체로전달되게된다 (Xia 2009). 이러한비대칭융합은세포질 DNA 와핵 DNA 의융합에적용될수있으며, 특히세포질웅성불임 (cytoplasmic male sterility, CMS) 와같은형질의도입에많이이용되고있다 (Liu et al. 2005). 원형질체융합을육종에이용하기위한초기융합계통육성과정은일반적으로원형질체의분리, 분절 ( 비대칭융합의경우적용 ), 융합, 재분화그리고선발의과정을거친다 (Razdan 2003; Liu et al. 2005). 이중융합이후, 융합하고자하는서로다른식물체간의게놈이실제융합이되었는지를확인하고융합체를선발하는과정은육종을위해서가장중요하다고할수있다. 이를위해 DNA 분자표지의이용, 세포유전학적기법등다양한생명공학적기술이이용되고있다. 많이이용되는분자표지로는 RAPD (Randomly Amplified Polymorphic DNA), SSR (Simple Sequence Repeats), AFLP (Amplified Fragment Length Polymorphism), RFLP (Restriction Fragment Length Polymorphism), CAPS (Cleaved Amplified Polymorphic Sequence), SCAR (Sequence Characterized Amplified Region) 등이있으며, 이러한분자표지를적용하는데사용되는 DNA 정보는핵내 DNA 의서열뿐만아니라세포질의미토콘드리아나엽록체 DNA 의서열이활용되고있다 (Thieme et al. 2010; Patel et al. 2011; Saker et al. 2011; Wang et al. 2011a; Yu et al. 2012a). 이에더해최근에는 real time PCR, microarray, transcriptome, reverse transcription PCR, real-time reverse transcription PCR 분석등과같은전사체기반의분석기술과 (Liu et al. 2012; Yu et al. 2012b; Wang et al. 2011b, 2013) proteome 분석과같은단백질체기반의분석기술 (Gancle et al. 2006; Wang et al. 2010) 또한이용되고있다. 세포유전학적기법으로는염색체수검사, 유동세포분석법 (flow cytometry), GISH (Genomic in situ hybridization) 등이이용되고있으며 (Xu et al. 2007; Lian et al. 2011; Wang et al. 2011a; Jiang et al. 2012), 기타방법으로동위효소분석법 (isozyme analysis), 식물조직학적분석법 (histological analysis) 등이이용되고있다 (Wang et al. 2012; Yu et al. 2012a)

8 J Plant Biotechnol (2014) 41: 원형질체융합을이용한감자의육종 생식세포의융합 ( 유성생식잡종, sexual hybridization) 에반대적개념이라고할수있는체세포융합은종내또는종간두개의서로다른전체게놈을합치기위한시도로체세포로부터분리된두가지의원형질체를무성적으로융합 ( 무성생식잡종, asexual hybridization) 하는방법이다. 이러한방법은감자의육종에서유성적융합 ( 교잡에의한고전적육종 ) 과정에서나타나는불화합성과주요한형질의도입을위해이용되는이배체야생종과재배종감자의 EBN 차이에의한유성적융합의제한을극복하 기위한방법으로이용되고있다. 즉, 원형질체융합은이배체와재배종감자의이배성반수체 (dihaploid) 로부터새로운사배체 (tetraploid) 유전자원을새롭게창출하는과정에서많이이용된다. 감자에서의원형질체융합 감자의원형질체융합에는약 3-4 주간기내에서배양된식물체가이용되고있으며, 원형질체분리를위해서는효소처리에의한세포벽제거방법이주고이용되고있다. 융합의방법에는앞서언급한바와같이전기적방법 Table 1 Progress in protoplast fusion in potato during the last decade ( ) Species Aim Fusion tool Reference S. acaule Glycoalkaloid aglycone EF Rokka et al. (2005) S. berthaultii Tolerance to salinity EF Bidani et al. (2007) S. brevidens Resistance to soft rot, early blight and PLRV PEG Tek et al. (2004) S. brevidens Resistance to common scab EF, PEG Ahn & Park (2013) S. bulbocastanum Resistance to late blight PEG Boltowicz et al. (2005) S. bulbocastanum - EF Iovene et al. (2012) S. bulbocastanum S. pinnatisectum S. bulbocastanum, S. cardiophyllum, S. chacoense, S. pinnatisectum Resistance to late blight, soft rot, nematode, heat and drought EF Greplova et al. (2008) Resistance to late blight, Colorado potato beetle EF Chen et al. (2008) S. cardiophyllum Resistance to late blight EF Shi et al. (2006) S. cardiophyllum Resistance to Colorado potato beetle, PVY and late blight EF Thieme et al. (2010) S. chacoense Resistance to bacterial wilt EF, PEG Chen et al. (2013) S. chacoense - EF, PEG Cai et al. (2004) S. circaeifolium Resistance to late blight PEG Espejo et al. (2008) S. commersonnii Resistance to bacterial wilt EF Kim-Lee et al. (2005) S. etuberosum Resistance to PVY EF Tiwari et al. (2010) S. melongena Resistance to bacterial wilt EF, PEG Yu et al. (2013) S. michoacanum Resistance to late blight PEG Szczerbakowa et al. (2010) S. michoacanum Resistance to late blight EF Smyda et al. (2013) S. phureja - EF Lightbourn & Veilleux (2007) S. pinnatisectum Resistance to late blight EF Polzerova et al. (2011) S. pinnatisectum Resistance to late blight EF Sarkar et al. (2011) S. stenotomum Resistance to bacterial wilt EF Fock et al. (2007) S. tarnii Resistance to PVY and late blight EF Thieme et al. (2008) S. tuberosum - PEG Przetakiewicz et al. (2007) S. tuberosum Resistance to PVY and Pythium aphanidermatum EF Nouri-Ellouz et al. (2006) S. vernei - PEG Trabelsi et al. (2005) S. villosum Resistance to late blight PEG Tarwacka et al. (2013) * All species were fused with S. tuberosum. * Aim indicated with - was not precisely reported in the reference. * For fusion methods, EF and PEG indicate using electrofusion and polyethylene glycol as fusion agent, respectively.

9 68 J Plant Biotechnol (2014) 41:65 72 과 PEG 를이용한화학적방법이이용되고있으나, Table 1 에서제시된바와같이전기적방법이더욱보편적으로이용되고있다. 전기적방법에의한실험법 (Thieme et al. 2008; Symda et al. 2013) 과 PEG 를이용한화학적방법에의한실험법 (Trabelsi et al. 2005; Espejo et al. 2008) 은각각의문헌에제시된바와같이비교적자세히기술되어있으며, 그방법에있어서연구자에따라약간의차이를보이나대다수의연구에서보편적으로이용되고있다. 감자체세포융합의가장중요한목표는재배종감자가가지고있지않은병저항성, 환경스트레스내성과같은주요형질을야생종으로부터도입하는것이다. 이를달성하기위한가장효과적인방법으로는이배체의야생종과이배성반수체감자의대칭적융합이가장많이이용되다. 이러한방법은추가적인염색체의배가과정을거치지않고바로사배체를육성할수있게한다. 이후야생종으로부터유래된원하지않는유전적특성을배제시키기위해서는추가적인여교배 (backcross) 가요구된다. 하지만여기서요구되는여교배세대는 2-3 세대로제한된반면고전육종에의해융합이이루어질경우에는 6-7 세대까지이루어져야하는것을감안하면매우효율적이라할수있다 년대초 Chase (1963) 는감자의육종에서사배체를대신하여이배성반수체를이용하는것을제안하였다. 이후이는감자육종프로그램에서체세포융합기술이새로운품종을육성하기위한효율적수단이될수있게하였다 (Frei et al. 1998). 앞서서론에서언급했던바와같이, 감자에서원형질체를이용한체세포잡종생산이 1970 년대에성공적으로이루어진이후다양한야생종을대상으로여러유용형질들을감자에도입하고자하는시도가이루어지고있다. 하지만최근약 10 년여간이루어진감자원형질체융합사례를보면 (Table 1), 유용형질도입을위해이용된야생종의수가제한적이며, 대다수의도입형질이역병저항성을대표적으로한병저항성에국한되어있음을확인할수있다. 또한이러한방법을적용하여새로운감자품종을육성하는것이감자육종가들과상업적인감자육종기업에의해받아들여지기까지는많은시간이걸렸으며, 유럽과미국의감자육종회사에서원형질체융합을통하여성공적인감자품종육성이이루어지고있음에도불구하고, 최근한국에서체세포잡종법을이용하여감자품종을육성한예가있으나 (Kim et al. 2013), 한국을포함한중국, 인도등과같은대다수의개발도상국국가에서는그다지많이이용되고있지않다. 따라서원형질체를이용한체세포잡종의육성과고전육종방법의조합은여전히성공적인감자품종육성의기회가되고있으며, 이를통한지속적인감자의생산성증가와재배종감자의유전적다양성을확보하는기회를제공할것이다. 감자체세포융합의문제점및전망 체세포융합은다양하고폭넓은유전자원을대상으로유전적기능을결합하고자하는매우정교한방법이라할수있다. 여기에는원형질체의분리, 융합, 배양, 재분화, 선발, 체세포잡종의형질평가등을필요로하며이를이용한감자육종에는육성된체세포잡종재료를육종프로그램으로도입하는것이필요하다. 이를위해무엇보다도효율적이고효과적인체세포융합을위해서는많은비용과시간이필요할뿐만아니라장비와기술을필요로한다. 가장중요한제한적인요인으로는원형질체의분리와배양및재분화과정에서의유전자형효과 (genotype effects) 이다 (Rokka 2009). 감자의원형질체융합에대한다양한정보가생산되고있으나, 여전히그방법적인측면에서는경험에의존하는경우가많다. 지금까지많은수의계통들에반복적으로적용할수있는유전자형에독립적으로실험이가능한융합법이나재분화방법이확립되어있지않다. 융합법의경우최근까지도여전히 PEG 를이용한화학적융합법과전기적융합법이거의이용되고있으나 (Table 1), 이중전기적융합법의사용빈도가더많으며, 이는두가지의방법을비교해볼때융합효율적인측면에는큰차이를보이지않으나, 융합이후의세포성장과캘러스의분화등에서전기적융합법이더나은결과를보이기때문인것으로사료된다 (Cai et al. 2004). 결론적으로원형질체의분리, 융합, 배양, 재분화실험방법에대해서는유전자형에따라여전히최적화과정이필요하며, 많은노동력과자원을필요로한다. 추가적인문제점으로는원형질체융합체에대한빠르고효율적인선발에관한것으로대다수의융합실험에서표면적으로쉽게구별이가능한형태적표지인자가없어, 실질적인육종프로그램에서각각의목적에따른제한적인방법이적용되고있다. Table 2 에나타난바와같이, DNA 분자표지를이용한방법과세포유전학적방법이많이이용되고있으며, 대부분의연구에서는복수의방법을선택하여활용하고있다. 다만최근 10 여년전체적인흐름을고려해볼때, 감자의전체유전체해독이완료되고 (The Potato Genome Sequencing Consortium 2011) 체세포잡종선발과특성구명에많은이점이있는 DNA 기반의분자표지기술의활용빈도가더많은것을확인할수있다. 그러나이또한분석을위해서는체세포잡종개체들을대상으로재분화하는데소요되는시간이길다는점과분자표지분석에필요한충분한재료의양적확보를위하여잡종개체들을무균상태에서어느정도일정기간지속적인유지및증식이필요하다는것이다. 마지막으로원형질체를이용한체세포융합, 잡종은고전육종이나유전자변형을통한 GM 품종육성에대해대체가되는방법을의미하는것은아니다. 앞서언급한

10 J Plant Biotechnol (2014) 41: Table 2 Approaches for somatic hybrid selection or characterization used during the last decade ( ) Tools References Isozyme analysis Trabelsi et al. (2005), Nouri-Ellouz et al. (2006) Flow cytometry analysis Cai et al. (2004), Tek et al. (2004), Trabelsi et al. (2005), Bidani et al. (2007), Greplova et al. (2008), Thieme et al. (2010), Tiwari et al. (2010), Polzerova et al. (2011), Sarkar et al. (2011), Ahn & Park (2013), Yu et al. (2013) Chromosome counting Tek et al. (2004), Boltowicz et al. (2005), Nouri-Ellouz et al. (2006), Shi et al. (2006), Przetakiewicz et al. (2007), Chen et al. (2008), Espejo et al. (2008), Szczerbakowa et al. (2010), Ahn & Park (2013), Tarwacka et al. (2013), Yu et al. (2013) SSR marker Cai et al. (2004), Tek et al. (2004), Trabelsi et al. (2005), Nouri-Ellouz et al. (2006), Bidani et al. (2007), Lightbourn & Veilleux (2007), Thieme et al. (2010), Tiwari et al. (2010), Polzerova et al. (2011), Sarkar et al. (2011), Iovene et al. (2012), Ahn & Park (2013), Chen et al. (2013), Smyda et al. (2013), Yu et al. (2013) AFLP marker Tek et al. (2004), Thieme et al. (2010), Ahn & Park (2013) RAPD marker Cai et al. (2004), Boltowicz et al. (2005), Rokka et al. (2005), Trabelsi et al. (2005), Shi et al. (2006), Przetakiewicz et al. (2007), Chen et al. (2008), Espejo et al. (2008), Greplova et al. (2008), Szczerbakowa et al. (2010), Tiwari et al. (2010), Polzerova et al. (2011), Sarkar et al. (2011), Ahn & Park (2013), Smyda et al. (2013), Tarwacka et al. (2013) RFLP marker Tek et al. (2004), Przetakiewicz et al. (2007) CAPS/SCAR marker Nouri-Ellouz et al. (2006), Sarkar et al. (2011), Smyda et al. (2013), Yu et al. (2013) DNA sequence analysis Bidani et al. (2007) Fluorescence in situ hybridization (FISH) Tek et al. (2004) Genomic in situ hybridization (GISH) Tek et al. (2004), Iovene et al. (2012), Tarwacka et al. (2013), Yu et al. (2013) 바와같이, 원형질체융합을통하여얻어진체세포잡종개체는지속적인선발과여교잡과같은고전적육종방법이적용되어야한다. 이뿐만아니라, 앞으로는형질전환방법까지도여기에함께적용하여유전자집적 (gene pyramiding, gene stacking) 의목표를달성하는데도움이되어다양한형질에대해우수한형질을보유한우량한감자품종을육성할수있을것이다. 식물체재분화효율등과같은문제점을여전히가지고있다. 따라서앞으로의연구는원형질체융합을통하여발생하는이러한문제점들을개선할뿐만아니라, 불화합성을이유로형질도입이어려웠던유전자원을활용하여농업적으로중요한더욱더다양한형질들을도입하고선발할수있는육종이이루어져야할것이다. 결론 원형질체를이용한체세포잡종육성은다양한유전체적조합을통해새로운계통을육성할수있는육종의한방법이라할수있다. 이는다른다양한육종방법과비교해보았을때매우다른특성을지니고있다. 기본적으로는불화합성유전자원의좋은형질을한개체로모을수있다는장점을가지고있으며, 특히형질전환방법을이용한육종과비교했을때클로닝되지않은다양한유전자를도입할수있는다는측면과형질전환에의해생산된 GM 작물에대한사회적, 정치적반감을회피할수있다는등의다양한장점을가지고있다. 하지만체세포잡종에의해일반적으로나타나는현상이라고할수있는불화합성유전자원간의융합에따른염색체재배열, 염색체배수성화에따른불안정한임성, 융합이후의낮은 사사 본연구는농림축산식품부, 해양수산부, 농촌진흥청, 산림청 Golden Seed 프로젝트 ( 세부과제명 : 수출용감자품종육성효율증진을위한분자표지및유용유전자개발, 세부과제번호 : SB540) 및농촌진흥청연구사업 ( 세부과제명 : 감자육종능력증진을위한감자유전자원관리, 세부과제번호 : PJ ) 에의해이루어진것임 References Ahn YK, Kim HY, Choi, HS, Kim K-T, Park HG (2001a) Production of interspecific somatic hybrids between the cultivated potato (Solanum tuberosum) and the wild species (S. brevidens). J Korean Soc Hort Sci 24:

11 70 J Plant Biotechnol (2014) 41:65 72 Ahn YK, Kang JC, Kim HY, Lee SD, Park HG (2001b) Resistance to blackleg and tuber soft rot in interspecific somatic hybrids between S. brevidens and S. tuberosum ( Superior, Dejima, and dihaploid of Superior ). J Korean Soc Hort Sci 24: Ahn Y-K, Ghislain M, Choi H-S, Park H-G (2002) Selection of somatic hybrids of potato using molecular marker and chloroplast number. Korean J Breed 34: Ahn YK, Park T-H (2013) Resistance to common scab developed by somatic hybrids between Solanum brevidens and Solanum tuberosum. Acta Agric Scand Sect B-Soil & Plant Sci 63: Bidani A, Nouri-Ellouz O, Lakhoua L, Sihachakr D, Cheniclet C, Mahjoub A, Drira N, Gargouri-Bouzid R (2007) Interspecific potato somatic hybrids between Solanum berthaultii and Solanum tuberosum L. showed recombinant plstome and improved tolerance to salinity. Plant Cell Tiss Organ Cult 91: Binding H, Nehls R, Schieder O, Sopory SK, Wenzel G (1978) Regeneration of mesophyll protoplasts isolated from dihaploid clones of Solanum tuberosum L. Physiol Plant 43:52-54 Boltowicz D, Szczerbakowa A, Wielgat B (2005) RAPD analysis of the interspecific somatic hybrids Solanum bulbocastanum (+) S. tuberosum. Cell Mol Biol Lett 10: Cai X, Liu J, Xie C (2004) Mesophyll protoplast fusion of Solanum tuberosum and Solanum chacoense and their somatic hybrid analysis. Acta Hort Sinica 31: Carlson PS, Smith HH, Dearing RD (1972) Parasexual interspecific plant hybridization. Proc Natl Acad Sci USA 69: Cardi T, Amborsio FD, Consoli D, Puite KJ, Ramulu KS (1993) Production of somatic hybrids between frost-tolerant Solanum commersonii and S. tuberosum: characterization of hybrid plants. Theor Appl Genet 87: Chase SS (1963) Analytical breeding scheme in Solanum tuberosum L.- A scheme utilizing parthenotes and other diploid stocks. Can J Genet Cytol 5: Chen Q, Li HY, Shi YZ, Beasley D, Bizimungu B, Goettel MS (2008) Development of an effective protoplast fusion system for production of new potatoes with disease and insect resistance using Mexican wild potato species as gene pools. Can J Plant Sci 88: Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126: Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29: Eeckhaut T, van Laere K, de Riek J, van Huylenbroeck J (2006) Overcoming interspecific barriers in ornamental plant breeding. In: Teixeira da Silva J (ed), Floriculture, Ornamental and Plant Biotechnology: Advances and Topical Issues, Global Science Books, London, pp Eeckhaut T, Lakshmanan PS, Deryckere D, van Bockstaele E, van Huylenbroeck J (2013) Progress in plant protoplast research. Planta 238: Espejo R, Cipriani G, Rosel G, Golmirzaie A, Roca W (2008) Somatic hybrids obtained by protoplast fusion between Solanum tuberosum L. subsp. tuberosum and the wild species Solanum circaeifolium Bitter. Rev Peru Biol 15:73-78 Fock I, Collonnier C, Lavergne D, Vaniet S, Ambroise A, Luisetti J, Kodja H, Sihachakr D (2007) Evaluation of somatic hybrids of potato with Solanum stenotomum after a long-term in vitro conservation. Plant Physiol Biochem 45: Frei U, Stattmann M, Lőssel and Wenzel G (1998) Aspects of fusion combining ability of dihaploid Solanum tuberosum L.: Influence of the cytoplasm. Potato Res 41: Gamborg OL (2002) Plant tissue culture. Biotechnology. Milestones. In Vitro Cell Dev Biol Plant 38:84-92 Gancle A, Grimplet J, Sauvage F, Ollitrault P, Brillouet J (2006) Pre-dominant expression of diploid mandarin leaf proteome in two citrus mandarin-derived somatic allotetraploid hybrids. J Agr Food Chem 54: Greplová M, Polzerová, Vlastníková H (2008) Electrofusion of protoplasts from Solanum tuberosum, S. bulbocastanum and S. pinnatisectum. Acta Physiol Plant 30: Helgeson JP, Kaberlach GT (1999) Somatic hybrids of Solanum tuberosum and related species. In: Altman A, Ziv M, Izhar S (eds), Plant biotechnology and in vitro biology in the 21 st century, Kluwer, Dordrecht, pp Iovene M, Aversano R, Savarese S, Caruso I, Di Matteo A, Cardi T, Frusciante L, Carputo D (2012) Interspecific somatic hybrids between Solanum bulbocastanum and S. tuberosum and their haploidization for potato breeding. Bio Plant 56: 1-8 Jansky S (2000) Breeding for disease resistance in potato. In: Janick J (ed), Plant breeding reviews, Wiley, New York, pp Jiang L, Cai Y, Xia G, Xiang F (2012) Introgression of the heterologous nuclear DNAs and efficacious compositions from Swertia tetraptera Maxim. into Bupleurum scorzonerifolium Willd. via somatic hybridization. Protoplasma 249: Kim SR, Ahn YK, Kim TG, Kang HS, Song SW, Kim BC, Kang SG (2013) Breeding of a new cultivar Jeseo with resistance to common scab. Kor J Breed Sci 45: Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM (2005) Bacterial wilt resistance in the progenies of the fusion hybrids between haploid of potato and Solanum commersonii. Amer J of Potato Res 82: Lakshmanan PS, Eeckhaut T, Deryckere D, van Bockstaele E, van Huylenbroeck J (2013) Asymmetric somatic plant hybridization: Status and applications. Amer J Plant Sci 4:1-10 Lian Y, Lin G, Zhao X, Lim H (2011) Production and genetic characterization of somatic hybrids between leaf mustard (Brassica juncea) and broccoli (Brassica oleracea). In Vitro Cell Dev Plant 47: Lightbourn GJ, Veilleux RE (2007) Production and evaluation of somatic hybrids derived from monoploid potato. Amer J of Potato Res 84:

12 J Plant Biotechnol (2014) 41: Liu J, Xu X, Deng X (2005) Intergeneric somatic hybridization and its application to crop genetic improvement. Plant Cell Tiss Org Cult 82:19-44 Liu C, Li S, Wang M, Xia G (2012) A transcriptomic analysis reveals the nature of salinity tolerance of a wheat introgression line. Plant Mol Biol 78: Melchers G, Sacristan MD, Holder AA (1978) Somatic hybrid plants of potato and tomato regenerated from fused protoplasts. Carlsberg Res Comm 43: Nouri-Ellouz O, Gargouri-Bouzid R, Sihachakr D, Triki MA, Ducreux G, Drira N, Lakhoua L (2006) Production of potato intraspecific somatic hybrids with improved tolerance to PVY and Pythium aphanidermatum. J Plant Physiol 163: Olivares-Fuster O, Duran-Vila N, Navarro L (2005) Electrochemical protoplast fusion in Citrus. Plant Cell Rep 24: Ortiz R, Ehlenfeldt MK (1992) The importance of endosperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 1992: Patel D, Power J, Anthony P, Badakshi F, Heslop-Harrison J, Davey M (2011) Somatic hybrid plants of Nicotiana x sanderae + N. debneyi with fungal resistance to Peronospora tabacina. Ann Bot 108: Polzerová H, Patzak J, Greplová M (2011) Early characterization of somatic hybrids from symmetric protoplast electrofusion of Solanum pinnatisectum Dun. and Solanum tuberosum L. Plant Cell Tiss Organ Cult 104: Przetakiewicz J, Nadolska-Orczyk A, Kuć D, Orczyk W (2007) Tetraploid somatic hybrids of potato (Solanum tuberosum L.) obtained from diploid breeding lines. Cell Mol Biol Lett 12: Razdan M (2003) Somatic hybridization. In: Razdan M (ed), Introduction to plant tissue culture, Science Publishers, Enfield, pp Rokka V-M (2009) Potato haploids and breeding. In: Touraev A, Forster BP, Jain SM (eds), Advances in haploid production in higher plants, Springer Science + Business Media B.V., Dordrecht, pp Rokka V-M, Laurila J, Tauriainen A, Laakso I, Larkka J, Metzler M, Pietilä (2005) Glycoalkaloid aglycone accumulations associated with infection by Clavibacter michiganensis ssp. sepedonicus in potato species Solanum acaule and Solanum tuberosum and their interspecific somatic hybrids. Plant Cell Rep 23: Sarkar D, Tiwari J, Sharma S, Sharma Poonam S, Gopal J, Singh B, Luthra S, Pandey S, Pattanayak D (2011) Production and characterization of somatic hybrids between Solanum tuberosum L. and S. pinnatisectum Dun. Plant Cell Tiss Org Cult 107: Shepard JP, Totten RE (1977) Mesophyll cell protoplasts of potato. Isolation, proliferation, and plant regeneration. Plant Physiol 60: Shi YZ, Chen Q, Li HY, Beasley D, Lynch DR (2006) Somatic hybridization between Solanum tuberosum and S. cardiophyllum. Can J Plant Sci 86: Smyda P, Jakuczun H, Dębski K, Śliwka J, Thieme R, Nachtigall M, Wasilewicz-Flis I, Zimnoch-Guzowska E (2013) Development of somatic hybrids Solanum x michoacanum Bitter. (Rydb.) (+) S. tuberosum L. and autofused 4x S. x michoacanum plants as potential sources of late blight resistance for potato breeding. Plant Cell Rep 32: Szczerbakowa A, Tarwacka J, Oskiera M, Jakuczun H, Wielgat B (2010) Somatic hybridization between the diploids of S. x michoacanum and S. tuberosum. Acta Physiol Plant 32: Tarwacka J, Polkowska-Kowalczyk L, Kolano B, Śliwka J, Wielgat B (2013) Interspecific somatic hybrids Solanum villosum (+) S. tuberosum, resistance to Phytophthora infestans. J Plant Physiol 170: Tek AL, Stevenson WR, Helgeson JP, Jiang J (2004) Transfer of tuber soft rot and early blight resistances from Solanum brevidens into cultivated potato. Theor Appl Genet 109: The Potato Genome Sequencing Consortium (2011) Genome sequence and analysis of the tuber crop potato. Nature 475: Thieme R, Rakosy-Tican E, Gavrilenko T, Antonova O, Schubert J, Nachtigall M, Heimbach U, Thieme T (2008) Novel somatic hybrids (Solanum tuberosum L. + Solanum tarnii) and their fertile BC 1 progenies express extreme resistance to potato virus Y and late blight. Theor Appl Genet 116: Thieme R, Rakosy-Tican E, Nachtigall M, Schubert J, Hammann T, Antonova O, Gavrilenko T, Heimbach U, Thieme T (2010) Characterization of the multiple resistance traits of somatic hybrids between Solanum cardiophyllum Lindl. and two commercial potato cultivars. Plant Cell Rep 29: Tiwari JK, Poonam, Sarkar D, Pandey SK, Gopal J, Kumar SR (2010) Molecular and morphological characterization of somatic hybrids between Solanum tuberosum L. and S. etuberosum Lindl. Plant Cell Tiss Organ Cult 103: Trabelsi S, Gargouri-Bouzid R, Vedel F, Nato A, Lakhoua L, Drira N (2005) Somatic hybrids between potato Solanum tuberosum and wild species Solanum vernei exhibit a recombination in the plastome. Plant Cell Tiss Org Cult 83:1-11 Wang L, Pan Z, Guo W (2010) Proteomic anlaysis of leaves from a diploid cybrid produced by protoplast fusion between Satsuma mandarin and pummelo. Plant Cell Tiss Org Cult 103: Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011a) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Reports 30: Wang J, Zhao C, Liu C, Xia G, Xiang F (2011b) Introgression of Swertia mussotii gene into Bupleurum scorzonerifolium via somatic hybridization BioMedCentral Plant Biol 11:71 Wang M, Peng Z, Hong S, Zhi D, Xia G (2012) Hybrid inflorescences derived from gamma-fusion of Arabidopsis thaliana with Bupleurum scorzonerifolium. Protoplasma 249: Wang X, Zhou J, Yang Y, Yu F, Chen J, Yu C, Wang F, Cheng Y,

13 72 J Plant Biotechnol (2014) 41:65 72 Yan C, Chen J (2013) Transcriptome analysis of a progeny of somatic hybrids of cultivated rice (Oryza sativa L.) and wild rice (Oryza meyeriana L.) with high resistance to bacterial blight. J Phyto Pathol 161: Xia G (2009) Progress of chromosome engineering mediated by asymmetric somatic hybridization. J Genet Genomics 36: Xu XY, Hu ZY, Li JF, Liu JH, Deng XX (2007) Asymmetric somatic hybridization between UV-irradiated Citrus unshiu and C. sinensis: Regeneration and characterization of hybrid shoots. Plant Cell Rep 26: Yu Y, Li Z, Wang P, Xiang F (2012a) Genetic and biochemical characterization of somatic hybrids between Bupleurum scorzonerifolium and Gentianopsis paludosa. Protoplasma 249: Yu X, Chu B, Liu R, Sun J, Brian J, Wang H, Shuijin Z, Sun Y (2012b) Characteristics of fertile somatic hybrids of G. hirsutim L. and G. trilobum generated via protoplast fusion. Theor Appl Genet 125: Yu Y, Ye W, He L, Cai X, Liu T, Liu J (2013) Introgression of bacterial wilt resistance from eggplant to potato via protoplast fusion and genome components of the hybrids. Plant Cell Rep 32:

14 J Plant Biotechnol (2014) 41:73 80 DOI: ISSN Research Article Paraquat 유도산화스트레스하의배추잎에서 Ascorbate-Glutathione 회로효소의활성도에대한산화질소 (Nitric oxide) 의효과 나호견 진창덕 Effects of nitric oxide on ascorbate-glutathione cycle enzymes activities in chinese cabbage leaves under paraquat-induced oxidative stress Ho-Gyun Na Chang-Duck Jin Received: 9 April 2014 / Revised: 19 April 2014 / Accepted: 26 May 2014 c Korean Society for Plant Biotechnology Abstract Pretreatment of chinese cabbage leaves with 100 μm sodium nitroprusside (SNP), a nitric oxide (NO) donor, effectively improved their tolerance to subsequent 2 μm paraquat (PQ)-induced oxidative damage. The fresh weight, and chlorophyll and protein contents in primary leaves treated with PQ alone were noticeably reduced over 24 h light incubation. However, these leaf injury symptoms were significantly alleviated with 100 μm SNP pretreatment for 3 h prior to PQ exposure. In additions, the increase of the contents of malondialdehyde (MDA) and H 2 O 2 due to PQ exposure were significantly inhibited by SNP pretreatment. Together with the protective effects of SNP against PQ toxicity in leaves, the changes of ascorbate-glutathione cycle enzymes activities were examined. In the PQ alone treatment, the activities of APX, DHAR, and GR after 6 h incubation were rapidly reduced and showed 19%, 50% and 39% respectively, compared with those of the control. However, the decreases in these enzyme activities were significantly inhibited by SNP pretreatment. As a result, their activities were higher than those of PQ alone treatment by 5 times, 2 times, and 1.5 times, respectively, at 6 h incubation. Thereafter, these enzymes decrease their activities gradually showing high levels than those of PQ alone. Based on the above results, it can be assumed that the activation of ascorbateglutathione cycle by SNP pretreatment in chinese cabbage H. G. Na C. D. Jin ( ) 강원대학교자연과학대학생명과학과 (Department of Biological Sciences, Kangwon National University, Chunchon, , Korea) cdjin@kangwon.ac.kr leaves exposed to PQ can prevent H 2 O 2 accumulation, thereby leading to protection against PQ-induced oxidative stress. Also, these results indicate that NO acts as an protectant against PQ stress in the leaves of chinese cabbage. Keywords Chinese cabbage, Paraquat, Oxidative stress, Ascorbate-glutathione cycle enzyme, Sodium nitroprusside 서론 최근, 식물계에서다양한생리과정에대한산화질소 (Nitric Oxide : NO) 의조절역할이여러연구에서보고되었다 (Beligni and Lamattina 2001). 즉, NO 는식물의발아, 하배축신장, 노쇠과정등생장과발달반응 (Beligni et al. 2002; Hu et al. 2007), 건조스트레스, 열스트레스, 병원균감염과같은비생물적및생물적스트레스에대한방어반응에도관여하고있음이보고되었다 (Zeier and Schreiber 1997; Mata and Lamattina 2001; Uchida et al. 2002). 제초제화합물의일종인 paraquat (PQ; 1,1'-dimethyl-4,4'-bipyridium dichloride) 는식물세포내에서엽록체막광계 I 의전자전달과미토콘드리아내막의전자전달을간섭하여 superoxide 라디칼, H 2O 2 등과같은활성형산소분자종 (activated oxygen species: AOS) 의생성및축적을유도하는작용이있어식물에산화스트레스를유도하는인위적수단으로이용되어왔다 (Dodge 1971; Martinez et al. 2001). 식물체내에축적된이들활성형산소분자종들은세포구성성분들을산화적으로파괴시켜심각한세포손상을초래하게된다 (Bowler et al. 1992; Price et al. 1994). 활성형산소분자종에의해초래되는산화스트레스에

15 74 J Plant Biotechnol (2014) 41:73 80 대한방어반응으로서식물은항산화방어계 (antioxidative defence system) 를발달시켜왔는데, 이항산화계의두가지중심구성요소는 superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), dehydroascorbate reductase (DHAR), glutathione reductase (GR) 등의항산화효소와 ascorbate, glutathione 등과같은항산화저분자화합물이다 (Foyer et al. 1994). 산화스트레스와관련하여식물은특히, ascorbateglutathione 대사회로를이용하여활성형산소종을제거한다는사실이여러보고에서제시되었는데 (Klapheck et al. 1990; Koshiba 1993; Ruan et al. 2005), 이 ascorbate-glutathione 회로는 APX, DHAR, GR 등의항산화효소와 ascorbate 및 glutathione 기질로구성되어있다 (Foyer and Halliwell 1976; Noctor and Foyer 1998). Ascorbate-glutathione 회로내에서 APX 는엽록체및세포질에서생성된 H 2O 2 를직접 H 2O 로전환시켜제거하며, 이과정에서 APX 에의해소모된 ascorbate 는이회로내의또다른구성효소인 DHAR 과 GR 효소의상호작용에의해재생된다 (Foyer and Halliwell 1976; Koshiba 1993). Dalton 등 (1993) 역시콩과식물의뿌리에서질소고정시발생되는 H 2O 2 제거반응으로 ascorbate-glutathione 회로가관여함을보고하였다. 특히, 형질전환식물을이용한연구에서는세포내어느하나의특정항산화효소역할보다는오히려세포내존재하는여러항산화효소의상호작용이산화스트레스에의해유도되는세포손상을방어하는데더욱중요하다는결과가보고되었다 (Slooten et al. 1995; Sen Gupta et al. 1993). 한편, 식물스트레스방어반응과관련하여 NO 의역할에많은관심이제시되고있는데, Uchida 등 (2002) 은쌀 (Oryza sativa) 유식물에염스트레스와열충격을주었을때 NO 공여체인 sodium nitroprusside (SNP) 를전처리하면처리하지않은대조구에비해살아있는잎면적비율이더높았음을보고하였고, 제초제인 diquat 에노출된감자잎절편에서도 SNP 전처리경우엽록소양이 diquat 단독처리구에비해 10 배나높은결과가발표되었다 (Beligni and Lamattina 2001). 동시에, 염과저온스트레스하에서 APX, DHAR, 및 GR 효소의활성화에의한 ascorbate 와 glutathione 분자의재생조절에 NO 가관여하고있음도보고되었다 (Ruan et al. 2005; Wu et al. 2009). 또한, Durzan (2002) 은식물이영양상태의변화, 염, 건조, 병원균공격과같은생물적, 비생물적스트레스를받았을때식물조직내 NO 의방출이증가되며, NO 가단백질, 산소분자종에빠르게반응해효소활성도를조절하는생화학적신호분자를생성한다는것을제시하였다. 따라서본연구에서는배추제 1 엽에서 PQ 유도산화스트레스에대한 NO 의생리적조절역할및그작용기작을알아보기위해배추잎의생리, 생화학적변화와함께잎조직내 H 2O 2 함량변화및 ascorbate-glutathione 회로구성효소인 APX, DHAR 및 GR 효소의활성도변화를조사하였다. 재료및방법 재료식물의생육조건 크기, 모양, 색깔이균일한배추 (Brassica campestris L. cv Seoul) 종자를선별하여 1% (v/v) sodium hypochlorite 용액에 15 분간침윤소독한후멸균증류수를이용하여세척하였다. 투명한폴리프로필렌발아통 ( cm) 에 Bio-pluge ( 홍농종묘 ) 상토를 2/3 가량넣어증류수 120 ml 로충분히적신후살균된종자를 25 개씩파종하여 wrap 을씌우고 65% 의상대습도, 25/21 C ( 낮 / 밤 ) 의온도및 18 h/6 h ( 낮 / 밤 ) 의광주기조건으로설정된 growth chamber 에서 8 일간발아생육시켰다. 파종한후 2 일째 wrap 을벗기고증류수 20 ml 주었고, 3 일째부터는매일 40 ml 씩공급해주었다. 8 일후배추유식물의제 1 엽을수확하여재료로사용하였다. Sodium nitroprusside (SNP) 전처리및 paraquat(pq) 처리 8 일간생장한배추유식물에서비슷한크기의제 1 엽을수확하여 3 그룹으로나누어서 SNP 전처리구잎은 100 μ M SNP 용액이 20 ml 담긴 petri dish 에띄우고, 증류수대조구와 2 μm PQ 단독처리구잎은증류수 20 ml 가담긴각 petri dish 에띄워, 27 C 의온도에서 3 시간광배양하였다. 3 시간광배양후 SNP 전처리구와 PQ 단독처리구는각각 2 μm PQ 용액 20 ml 가담긴 petri dish 로옮기고, 증류수대조구는계속해서증류수 20 ml 가담긴 petri dish 에띄워 24 시간광배양하였다. 이때 24 시간광배양동안 0, 6, 12, 18, 24 시간째에시료를채취하여 PQ 및 SNP 처리효과를조사하였다. 이때아래의모든측정은 3 회독립적으로반복실시하였다. Chlorophyll 및 soluble protein 함량측정 엽록소추출은 Hiscox 와 Israelstam (1979) 의방법을기초로하였다. glass cap tube 에배추제 1 엽 5 개와 DMSO (dimethylsulfoxide) 8 ml 를넣고 65 C, 55 rpm 조건의항온수조에서 2 시간동안진탕배양하여엽록소를추출한후 DMSO 용액으로총부피 8 ml 가되도록보정하였다. 이때얻어진추출액의흡광도 (A 652 ) 를측정한후 Arnon (1949) 의방정식에대입해서 chlorophyll 함량을계산하였다. 수용성단백질함량은 Bradford (1976) 의방법을기초로하여측정하였다. 배추제 1 엽 5 개를미리냉각된막자사발을이용하여 4 ml 의 0.1 M Tris-HCl buffer (ph 7.5, 1% PVPP 포함 ) 와 0.3 g 의석영사를넣고마쇄한후 4 C 에서 10,000 g 으로 20 분동안원심분리하여단백질추출용액을얻었다. 단백질추출액 0.1 ml 에 Bradford 용액 5 ml 를혼합하

16 J Plant Biotechnol (2014) 41: 여 5 분간반응을시킨후 595 nm 에서흡광도를측정하였다. 이때의흡광도를 BSA 단백질표준곡선과대조하여단백질함량을정량하였다. Malondialdehyde (MDA) 함량측정 Dhindsa 등 (1981) 의방법을기초로하여 MDA 함량을정량하였다. 배추제 1 엽 5 개를미리냉각된막자사발을이용하여 2 ml 의 0.1% trichloroacetic acid (TCA) 용액과 0.3 g 의석영사를넣고마쇄한후 4 C 에서 10,000 g 로 20 분간원심분리하여상등액을얻었다. 1 ml 상등액을취해 glass cap tube 에넣고, 2 ml 의 20% TCA (0.5% thiobarbituric acid 포함 ) 을섞은후 95 C 에서 30 분간배양한다음급속히냉각시켰다. 이혼합물을다시 microfuge (12,500 rpm, 10 min) 로원심분리한후상등액을취하여 532 nm 와 600 nm 에서흡광도를각각측정하였다. MDA 함량은두흡광도값의차이를이용해 MDA 의몰흡광계수 155 mm -1 cm -1 (Heath and Packer 1968) 로부터산출하였다. H 2 O 2 함량측정 H 2 O 2 함량은 Hung 과 Kao (2003) 의방법을기초로하여측정하였다. 10 개의배추제 1 엽을미리냉각된 mortar 와 pestle 을이용해서 3 ml 의 50 mm potassium phosphate buffer (ph 6.5, 1 mm hydroxylamine 포함 ) 와 0.3 g 의 sea sand 를넣고마쇄한후 4 C 에서원심분리 (6,000 g, 20 min) 하여상등액을얻었다. 이상등액중 2 ml 를취하여여기에 20% (v/v) H 2 SO 4 용액에녹인 1 ml 의 0.1% titanium sulfate 와혼합한후혼합물을원심분리 (6,000g, 20 min) 하여얻은상등액의흡광도를 410 nm 에서측정하였다. H 2 O 2 함량은 H 2 O 2 의몰흡광계수 0.28 μmol -1 cm -1 을이용하여산출하였다. 고마쇄한후 4 C 에서 20,000 g 로 20 분간원심분리하여상등액을취해효소원액으로사용하였다. APX 활성도측정 APX 활성도는 Asada (1984) 의방법을이용하여측정하였다. 효소활성도는 ascorbate 가산화될때 290 nm 에서의흡광도감소값 (ε 290 = 2.8 mm -1 cm -1 ) 을측정하여산출하였다. 이때효소반응은 62.5 mm K-PO 4 buffer (ph 7.0) 1.6 ml, 5 mm ascorbate 200 μl, 효소용액 200 μl 및 0.1 M H 2 O 2 50 μl 가포함된반응액에서진행되었다. GR 활성도측정 GR 활성도는 Rao 등 (1996) 의방법을따라측정하였다. 효소활성도는반응액내의 NADPH 가산화될때 340 nm 에서의흡광도감소값 (ɛ 340 = 6.2 mm -1 cm -1 ) 을측정하여산출하였다. 이때효소반응은 0.1 M K-PO 4 buffer (ph 7.8) 1.5 ml, 80 mm Na 2 -EDTA 50 μl, 20 mm GSSG 50 μl 및효소추출액 300 μl 가포함된반응액에 4 mm NADPH 100 μl 를가하여진행시켰다. DHAR 활성도측정 DHAR 활성도는 Asada (1984) 의방법을기초로측정하였다. 효소활성도는반응액내에서 glutathione 에의해 dehydroascorbate 가 ascorbate 로환원될때 265 nm 에서의흡광도증가값 (ɛ 265 = 14 mm -1 cm -1 ) 을측정하여산출하였다. 이때효소반응은 62.5 mm K-PO 4 buffer (ph 6.5, mm Na 2-EDTA 포함 ) 1.65 ml, 100 mm GSH 100 μl, 10 mm DHA 100 μl 및효소추출액 150 μl 가포함된반응액에서진행되었다. 효소추출및활성도분석 APX 효소용액은 Asada (1984) 의방법을기초로 10개의배추제1엽을냉각된막자사발에넣고, 3 ml의 0.1 M K-PO 4 buffer (ph 7.5, 1 mm Na 2-EDTA, 5 mm ascorbate 포함 ) 와 0.3 g의석영사를넣고마쇄한후 4 C에서 20,000 g로 20 분간원심분리하여얻은상등액을취해효소원액으로사용하였다. GR 효소용액은 Rao 등 (1996) 의방법을변형하여 10개의배추제1엽을냉각된막자사발에넣고, 3 ml 의 0.1 M K-PO 4 buffer (ph 7.5, 2 mm Na 2-EDTA, 1% PVPP 포함 ) 와 0.3 g의석영사를넣고마쇄한후 4 C에서 20,000 g로 20분간원심분리하여상등액을취해효소원액으로사용하였다. DHAR 효소용액은 Asada (1984) 의방법을기초로 10개의배추제1엽을냉각된막자사발에넣고, 3 ml의 70 mm K-PO 4 buffer (ph 7.8) 와 0.3 g의석영사를넣 결과및고찰 배추잎에서 paraquat (PQ) 에의한산화적손상과 SNP 효과 제초제화합물인 PQ 는엽록체틸라코이드막에서빛에너지에의해활성화된광계 Ⅰ 로부터이탈된전자를받아 PQ 라디칼로환원된다. 이 PQ 라디칼은인접해있는산소분자를다시환원시켜강력한산화제로작용하는 superoxide radical 을생성케함과동시에 superoxide radical 일부는 superoxide dismutase (SOD) 에의해또다른활성산소분자인 H 2O 2 분자로전환됨으로서산화적손상을일으키는산화스트레스유발인자로알려져있다 (Dodge 1971; Martinez et al. 2001). 본실험에서는먼저배추제 1 엽에서 PQ 독성과이에대한 NO 공여체인 sodium nitroprusside (SNP) 의생리적

17 76 J Plant Biotechnol (2014) 41:73 80 Fig. 1 Protective effect of 100 μm SNP pretreatment on the paraquat (PQ)-induced leaf damage. Detached leaves from 8-d-old chinese cabbage seedlings were pre-incubated with 100 μm SNP for 3 h and transferred into 2 μm PQ solutions for further 24 h in the light. (DW: control leaves, PQ: leaves treated with 2 μm paraquat alone, PQ+SNP: leaves pre-treated with 100 μm SNP before 2 μm PQ application) 효과를알아보았다. 대조구잎의경우광배양시간이경과함에도엽록소의파괴가거의없는반면 PQ 단독처리구잎의경우 12 시간때부터엽록소파괴로인한잎의황백화가진행되기시작하여 24 시간때에는잎이대부분황백화된것을볼수있었다. 그러나 SNP 전처리후 PQ 로처리된잎의경우모든시간대에서 PQ 단독처리구보다잎의황백화가억제된것을볼수있었다 (Fig. 1, Fig. 2B). Fig. 1 의사진결과에대한정량적인생리 생화학적분석을위해잎의생체량, 엽록소, 수용성단백질함량변화를측정하였다. 생체량의경우대조구는광배양시간이경과함에도일정한수준을나타낸반면 PQ 단독처리구에서는배양시간이경과함에따라생체량이급격히감소하는것을볼수있었다. 그러나 SNP 전처리구의경우생체량감소가억제되어 PQ 단독처리구보다높은수준을유지하면서감소하는추세를보였다 (Fig. 2A). 엽록소와수용성단백질함량변화의경우에도대조구는시간이경과함에도일정한수준을나타낸반면 PQ 단독처리구는배양시간이경과함에따라이들함량이급격히감소하는것을볼수있었다. 그러나 SNP 전처리구의경우엽록소와단백질함량의감소가효과적으로억제되어 PQ 단독처리구보다높은수준을유지하면서감소하는추세를보여 (Figs. 2B, C) 이들결과로부터 PQ 독성에대한 SNP 의방어효과를입증할수있었다. Beligni 와 Lamattina (2001) 는감자잎절편에산화스트레스유발인자로제초제인 diquat 를처리해주었을때에 SNP 로전처리한절편조직의엽록소양이 diquat 단독처리구에비해 10 배나높게나타났다는결과를보고한바있으며, Chen 등 (2004) 은 NO 가염스트레스에노출된밀유식물뿌리의산화적손상을완화시킨다는결과를제시한바있다. 이들보고및본실험에서얻어진결과는 NO 가 PQ 에의한배추잎의산화적손상에대해방어효과가있음을입증하는것이다. Fig. 2 Effects of 100 μm SNP pretreatment on 2 μm PQinduced leaf-injury symptoms in detached chinese cabbage leaves. Detached leaves were treated as the same manners shown in Figure 1. ([A]:fresh weight, [B]:chlorophyll content, [C]:soluble protein content) 배추잎의 malondialdehyde (MDA) 및 H 2 O 2 함량변화에대한 PQ 와 SNP 효과 식물이산화스트레스를받았을때나타나는또다른현상으로세포막구성지질분자의과산화반응으로인한세포막파괴가일어난다 (Dhindsa et al. 1981). 특히, 세포막손상시세포밖으로세포내용물의누출이일어나세포손상이더욱가속화된다. 그러므로세포막손상에대

18 J Plant Biotechnol (2014) 41: Fig. 3 Effect of 100 μm SNP pretreatment on the changes of malodialdehyde(mda) content in detached chinese cabbage leaves. Detached leaves were treated as the same manners shown in Figure 1 리구의경우 12 시간때의 H 2O 2 함량이대조구보다 1.5 배높게나타났다. 그러나 SNP 전처리구의경우 H 2O 2 함량증가가억제되어 12 시간때의 PQ 단독처리구값의 80% 수준을보였다. 스트레스하에서식물세포내정상적인대사가교란을받아 H 2O 2 와같은 AOS 가축적되면 H 2O 2 는세포내지질, 단백질및 DNA 와같은세포구성성분의산화적파괴와효소의불활성화를초래한다고알려졌다 (Laloi et al. 2004). 반면에식물에 NO 를처리하였을때 NO 가직접적으로 AOS 를제거하거나, 또는세포내항산화계를활성화시켜 AOS 를제거함으로서염, PQ, 중금속등에의해기원되는산화스트레스를완화시켜준다는보고가제시된바있다 (Beligni and Lamattina 1999; Laspina et al. 2005; Zhao et al. 2004; Hung et al. 2002). 이들보고와 Figure 3 과 Figure 4 의결과로부터 NO 가배추잎세포내 H 2O 2 함량증가를억제함으로서세포막지질의과산화반응을저해하여 PQ 에의한산화적손상을방어하는것으로생각되었다. Ascorbate-glutathione 회로효소의활성도변화에대한 SNP 의효과 Fig. 4 Effect of 100 μm SNP pretreatment on the changes of H 2O 2 content in detached chinese cabbage leaves. Detached leaves were treated as the same manners shown in Figure 1 한 PQ 독성및이에대한 SNP 의효과를알아보기위하여세포막지질의과산화산물인 MDA 함량변화를조사하였다 (Fig. 3). 대조구의경우광배양시간이경과함에도 MDA 함량이낮은상태로일정한수준을보인반면, PQ 단독처리구의경우 12 시간때까지 MDA 함량이급격히증가하여대조구보다 1.8 배높게나타났다. 그러나 SNP 전처리후 PQ 처리시 MDA 축적이억제되어 12 시간때의 PQ 단독처리구값의 80% 수준을보였다. 한편, 12 시간이후대조구를제외한나머지처리구에서 MDA 함량이감소하는이유는강한 PQ 독성으로인해 MDA 조차도파괴되기때문이다. 앞에서와같이 PQ 로처리된배추잎에서생체량, 엽록소, 단백질등의함량감소및 MDA 함량증가가 PQ 처리로인하여배추잎에과다하게생성되는활성산소분자종 (activated oxygen species: AOS) 때문인지를입증하기위하여 AOS 의한형태인 H 2 O 2 함량변화를조사하였다 (Fig. 4). 대조구는광배양시간이경과함에도 H 2 O 2 함량이일정한수준을보인반면, PQ 단독처 산화스트레스에대한식물의방어반응에는스트레스에의해생성된 superoxide radical 과 H 2 O 2 와같은활성산소라디칼분자의제거능력이관련되어있다고알려져왔다. 이러한식물의능력은 SOD, CAT, APX, GR 와같은대표적인항산화효소와 ascorbate, glutathione 과같은항산화저분자를이용한세포내활성산소라디칼대사의조절을통해발현되어산화적손상으로부터식물을보호한다 (Foyer et al. 1994; Mittler 2002; Hu et al. 2007). 항산화계역할과관련하여 ascorbate- 의존성 H 2 O 2 제거대사회로인 ascorbate-glutathione 회로가광합성으로인해풍부한산소환경하에있는엽록체에서최초보고된후 (Foyer and Halliwell 1976), 이회로는암발아중인피마자배유조직에서시토졸의호흡 (Klapheck et al. 1990) 및콩과식물뿌리세포에서질소고정반응중생성된 H 2 O 2 의제거수단 (Dalton et al. 1993) 으로그중요성이입증되었다. 따라서본연구에서는앞에서분석된 PQ 에의해유도된산화스트레스방어효과에대한 NO 의작용기작을알아보기위해 SNP 로전처리된배추제 1 엽에 PQ 를처리한후 ascorbate-glutathione 회로구성효소의활성도변화를조사해보았다. APX 는 ascorbate-glutathione 회로내첫번째반응단계관여효소로서 ascorbate 를환원제로이용하여 H 2 O 2 를무독성인 H 2 O 로전환시켜 H 2 O 2 를제거한다. 그리고 DHAR 은 APX 작용에의해생성된 dehydroascorbate 를 glutathione 을환원제로이용하여 ascorbate 로다시재생시켜주는과정을촉매함으로써 H 2 O 2 분해활성과연관되어있고, GR 은 dehydroascorbate 를 ascorbate 로재생시키는 DHAR 효

19 78 J Plant Biotechnol (2014) 41:73 80 Fig. 5 Effect of 100 μm SNP pretreatment on the changes of ascorbate peroxidase activities in detached chinese cabbage leaves. Detached leaves were treated as the same manners shown in Figure 1 Fig. 6 Effect of 100 μm SNP pretreatment on the changes of dehydroascorbate reductase activities in detached chinese cabbage leaves. Detached leaves were treated as the same manners shown in Figure 1 소의촉매반응에요구되는환원형 glutathione 을제공하여줌으로써 ascorbate-glutathione 회로의마지막단계를촉매하는것으로알려져있다 (Foyer and Halliwell 1976). 먼저 24 시간광배양동안 APX 활성도변화를조사한결과 (Fig. 5), 대조구의경우배양시간이경과함에도 APX 활성도가일정한수준을보인반면 PQ 단독처리구의경우배양시간 6 시간때부터 APX 활성도가급격히감소하여대조구의 19% 수준을보였다. 그러나 SNP 전처리구의경우 APX 활성도감소가효과적으로억제되어 6 시간때의효소활성도는 PQ 단독처리구보다 5 배높게나타났다. 이후광배양시간경과에따라 SNP 전처리구의 APX 활성도는 PQ 단독처리구보다높은수준을보이면서감소하는추세를보였다. APX 활성도변화와더불어 DHAR 활성도변화를조사하였다 (Fig. 6). 대조구의경우전체배양시간동안 DHAR 활성도가거의일정한수준을보이는것을볼수있었지만, PQ 단독처리구의경우배양시간 6 시간때부터 APX Fig. 7 Effect of 100 μm SNP pretreatment on the changes of glutathione reductase activities in detached chinese cabbage leaves. Detached leaves were treated as the same manners shown in Figure 1 활성도변화와유사하게 DHAR 활성도가급격히감소하여대조구의 39% 수준을나타냈다. 그러나 SNP 전처리구의경우광배양 6 시간때에 PQ 단독처리구의 DHAR 활성도보다 2 배높게나타나, PQ 처리에의한 DHAR 활성도감소가효과적으로억제된것을알수있었다. 이후광배양시간경과에따라 SNP 전처리구의 DHAR 활성도는 PQ 단독처리구보다높은수준을유지하면서감소하는추세를보였다. GR 활성도변화에서도 APX 및 DHAR 활성도변화양상과유사하여 (Fig. 7), 대조구는 24 시간배양동안 GR 활성도가일정한수준을나타낸반면, PQ 단독처리구의경우 6 시간때부터 GR 활성도가급격히감소하여대조구의 50% 수준을보였다. 그러나 SNP 전처리구의경우 GR 활성도감소가효과적으로억제되어 6 시간때의 GR 활성도는 PQ 단독처리구보다 1.5 배높게나타났다. 이후광배양시간이지남에따라 SNP 전처리구의 GR 활성도는 PQ 단독처리구보다높은수준을유지하면서감소하는추세를보였다. 형질전환된식물을이용한여러연구결과들은세포내한특정항산화효소의역할보다는오히려세포내존재하는여러항산화효소의상호협력작용이산화스트레스에의해유도되는세포손상을방어하는데더욱중요하다고제시하였다 (Slooten et al. 1995; Sen Gupta et al. 1993). 최근에 Zhang 등 (2007) 은 NO 가수분스트레스조건하에서 APX 활성도를증가시켰음을보고하였고, Wu 등 (2009) 역시 NO 가저온스트레스하의비파나무잎에서 ascorbate 함량증가와더불어 APX, DHAR 활성도증가를유도하였음을보고하였다. 또한수분스트레스로인해산화적손상을받고있는 Agropyron cristatum 잎에서내재성 NO 가 ascorbate 와 glutathione 대사의촉진을이끄는신호분자가되며, 이때 NO 가수분스트레스내성획득을위해중요한역할을한다고보고하였다 (Shan et al. 2012).

20 J Plant Biotechnol (2014) 41: 이상의결과들을종합해볼때, PQ 에노출된배추잎에서 NO 는 APX, DHAR, GR 의활성도감소를억제함으로서 ascorbate-glutathione 회로의활성화를통해 H 2O 2 함량축적을억제하여 PQ 유도산화스트레스에대한방어효과를나타냈다고생각되었다. 그러나 NO 가어떻게 APX, DHAR, GR 의활성도감소를억제시키는지에대해서는더연구를통해밝혀져야할것으로생각된다. 적요 산화질소 (nitric oxide: NO) 공여체인 100 μm sodium nitroprusside (SNP) 를배추잎에전처리한후이어서 2 μm paraquat (PQ) 처리시, PQ 에의해유도된산화적손상에대한잎의내성이효과적으로증진되었다. 24 시간광배양기간동안 PQ 단독처리구잎에서는생체량, 엽록소및단백질함량이현저하게감소하였으나 PQ 노출전에 3 시간 SNP 전처리로이들잎손상이의미있게완화되었다. 게다가 PQ 처리에기인된 malondialdehyde (MDA) 와 H 2 O 2 함량증가도 SNP 전처리에의해유의하게억제되었다. 잎에서이들 PQ 독성에대한 SNP 의방어효과와관련하여 ascorbate-glutathione 회로구성효소의활성도변화를조사하였다. PQ 단독처리구에서 APX, DHAR 및 GR 효소활성도는배양 6 시간후에급격히감소되어대조구잎과비교시각각대조구의 19%, 50%, 39% 수준의활성도값을보였다. 그러나, 이들효소활성도값감소는 SNP 전처리에의해현저하게억제되어 6 시간배양후에 PQ 단독처리구보다각각 5 배, 2 배, 1.5 배높은값을나타내었다. 또한, 그이후 24 시간배양때까지 PQ 단독처리구보다계속높은활성도를보이면서점차로감소하였다. 이들결과로부터, PQ 에노출된배추잎에서 SNP 전처리에의한 ascorbate-glutathione 회로의활성화가 H 2 O 2 의축적을억제하며그로인해 PQ 에의해유도된산화스트레스로부터잎을방어하는것으로생각되었다. 동시에이들결과는산화질소가배추잎에서 PQ 스트레스에대한항산화방어자로서의역할을하는것을의미한다. References Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Betavulgaris. Plant Physiol 24:1-15 Asada K (1984) Chloroplasts: Formation of active oxygen and its scavenging. Methods Enzymol 105: Beligni MV, Fath A, Bethke PC, Lamattina L, Jones RL (2002) Nitric oxide acts as an antioxidant and delays programmed cell death in Aleurone Layers. Plant Physiol 129: Beligni MV, Lamattina L (1999) Nitric oxide protects against cellular damage produced by methylviologen herbicides in potato plants. Nitric Oxide 3: Beligni MV, Lamattina L (2001) Nitric oxide in plants: the history is just beginning. Plant, Cell and Environ 24: Bowler C, Montagu MV, Inze D (1992) Superoxide dismutase and stress tolerance. Annual Review of Plant Physiol and Plant Mol Biol 43: Bradford MM (1976) A rapid and sensitive method for the quantiation of microgram quantitics of protein utilizing the principle of protein-dye binding. Anal. Biochem 72: Chen M, Shen WB, Ruan HH, Xu LL (2004) Effects of nitric oxide on root growth and it's oxidative damage in wheat seedling under salt stress. J Plant Physiol and Mol Biol 30: Dalton DA, Langeberg L, Treneman NC (1993) Correlations between the ascorbate-glutathione pathway and effectiveness in legume root nodules. Plant Physiol 87: Dhindsa RS, Plumb-Dhindsa P, Thorpe TA (1981) Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J Exp 32: Dodge AD (1971) The mode of action of bipyridylium herbicides, paraquat and diquat. Endeavour 30:130 Durzan DJ (2002) Stress-induced nitric oxide and adaptive plasticity in conifers. Journal of Forest Sci 48: Foyer CH, Descourvieres P, Kunert KJ (1994) Protection against oxygen radicals: an important defence mechanism studied in transgenic plant. Plant Cell and Environ 17: Foyer CH, Halliwell B (1976) The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta 133:21-25 Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125: Hiscox JD, Israelstam GF (1979) A method for the extraction of chlorophyll from leaf tissue without maceration. CAN. J Bot 57: Hu KD, Hu LY, Li YH, Zhang H (2007) Protective roles of nitric oxide on germination and antioxidant metabolism in wheat seeds under copper stress. Plant Growth Regul 53: Hung KT, Chang CJ, Kao CH (2002) Paraquat toxicity is reduced by nitric oxide in rice leaves. J Plant Physiol 159: Hung KT, Kao CH (2003) Nitric oxide counteracts the senescence of rice leaves induced by abscisic acid. J Plant Physiol 160: Klapheck S, Zmmer I, Cosse H (1990) Scavenging of hydrogen peroxide in the endosperm of Ricinus communis by ascorbate peroxidase. Plant Cell Physiol 31: Koshiba T (1993) Cytosolic ascorbate peroxidase in seedlings and leaves of maize(zea mays). Plant Cell Physiol 34: Laloi C, Apel K, Danon A (2004) Reactive oxygen signalling: the latest news. Curr Opin Plant Biol 7: Laspina NV, Groppa MD, Tomaro ML, Benarides MP (2005) Nitric oxide protects sunflower leaves against Cd-induced oxidative stress. Plant Sci 169: Martinez CA, Loureiro ME, Oliva MA, Maestri M (2001)

21 80 J Plant Biotechnol (2014) 41:73 80 Differential responses of superoxide dismutase in freezing resistant Solanum curtilobum and freezing sensitive Solanum curtilobum subjected to oxidative and water stress. Plant Sci 160: Mata CG, Lamattina L (2001) Nitric oxide induces stomatal closure and enhances the adaptive plant responses against drought stress. Plant Physiol 126: Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: Noctor G, Foyer CH (1998) Ascorbate and glutathione: keeping active oxygen under control. Annu Rev Plant Physiol, Plant Mol Biol 49: Price AH, Taylor A, Ripley SJ, Griffiths A, Trewavas AJ, Knight MR (1994) Oxidative signals in tobacco increase cytosolic calcium. Plant Cell 6: Rao MV, Paliyath G, Ormrod DP (1996) Ultraviolet-B-and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana. Plant Physiol 110: Ruan HH, Shen WB, Liu KL, Xu LL (2005) Effects of exogenous NO donor on glutathione-dependent antioxidative system in wheat seedling leaf under salt stress. Acta Agron 31: Sen Gupta A, Heinen JL, Holaday AS, Burke JJ, Allen RD (1993) Increased resistance to oxidative stress in transgenic plants that overexpress chloroplastic Cu/Zn superoxide dismutase. Proc Natl Acad Sci USA 90: Shan C, He F, Xu G, Han R, Liang Z (2012) Nitric oxide is involved in the regulation of ascorbate and glutathione metabolism in Agropyron cristatum leaves under water stress. Biologia Plantarum 56: Slooten L, Capiau K, Van Camp W, Van Montagu M, Subesma C, Inze D (1995) Factors affecting the enhancements of oxidative stress tolerance in transgenic tobacco overexpressing manganese superoxide dismutase in the chloroplasts. Plant Physiol 107: Uchida A, Jagendorf AT, Hivino T, Takabe T (2002) Effects of hydrogen peroxide and nitric oxide on both salt and eat stress tolerance in rice. Plant Sci 163: Wu JC, Chen JQ, Liang J, Yang WB, Wu JJ, Chen LQ, Liu MQ, Chen LQ (2009) Effects of exogenous NO on ascorbateglutathione cycle in loquat leaves under low temperature stress. Chin. J. Appl. Ecol 20: Zeier J, Schreiber L (1997) Chemical composition of hypodermal and endodermal cell walls and xylem vessels isolated from Clivia miniata. Plant Physiol 113: Zhang A, Jiang M, Zhang J, Ding H, Xu S, Hu X, Tan M (2007) Nitric oxide induced by hydrogen peroxide mediates abscisic acid-induced activation of the mitogen-activated protein kinase cascade involved in antioxidant defense in maize leaves. New Phytol 175:36-50 Zhao L, Zhang F, Guo J, Yang Y, Li B, Zhang L (2004) Nitric oxide functions as a signal in salt resistance in the calluses from two ecotype of reed. Plant Physiol 134:

22 J Plant Biotechnol (2014) 41:81 88 DOI: ISSN Research Article Salt cress 유전자의형질전환을통한내염성식물체선별 백동원 최원균 강송화 신길옥 박수정 김찬민 박형철 윤대진 Screening of salt-tolerance plants using transgenic Arabidopsis that express a salt cress cdna library Dongwon Baek Wonkyun Choi Songhwa Kang Gilok Shin Su Jung Park Chanmin Kim Hyeong Cheol Park Dae-Jin Yun Received: 29 April 2014 / Revised: 2 May 2014 / Accepted: 26 May 2014 c Korean Society for Plant Biotechnology Abstract Salt cress (Thellungiella halophila or Thellungiella parvula), species closely related to Arabidopsis thaliana, represents an extremophile adapted to harsh saline environments. To isolate salt-tolerance genes from this species, we constructed a cdna library from roots and leaves of salt cress plants treated with 200 mm NaCl. This cdna library was subsequently shuttled into the destination binary vector [driven by the cauliflower mosaic virus (CaMV) 35S promoter] designed for plant transformation and expression via recombination-assisted cloning. In total, 305,400 pools of transgenic BASTA-resistant lines were generated in Arabidopsis using either T. halophila or T. parvula cdna libraries. These were used for functional screening of genes involved in salt tolerance. Among these pools, 168,500 pools were used for primary screening to date from which 7,157 lines showed apparent salt tolerant-phenotypes in the initial screen. A secondary screen has now identified 165 salt tolerant transgenic lines using 1,551 (10.6%) lines that emerged in the first D. W. Baek S. H. Kang S. J. Park D. J. Yun ( ) 경상대학교식물생명공학연구소 (Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National University, Jinju , Korea) djyun@gnu.ac.kr W. K. Choi H. C. Park 국립생태원생태보전연구본부 (Bureau of Ecological Conservation Research, National Institute of Ecology, Seochen-gun, Chungcheongnam-do , Korea) G. O. Shin C. M. Kim D. J. Yun 경상대학교응용생명과학부 (BK21plus program) (Division of Applied Life Science (BK21plus program), Gyeongsang National University, Jinju , Korea) These authors contributed equally to the work. screen. The prevalent phenotype in these lines includes accelerated seed germination often accompanied by faster root growth compared to WT Arabidopsis under salt stress condition. In addition, other lines showed non-typical development of stems and flowers compared to WT Arabidopsis. Based on the close relationship of the tolerant species to the target species we suggest this approach as an appropriate method for the largescale identification of salt tolerance genes from salt cress. Keywords Salt Cress, Thellungiella halophila, Thellungiella parvula, Arabidopsis thaliana, Large scale screening, Salt stress 적요 식물생명공학연구에있어서모델식물인 Arabidopsis thaliana ( 애기장대 ) 와아주유사한염생식물인 salt cress (Thellungiella halophila 또는 Thellungiella parvula) 는고염스트레스에대하여강한내성을가지고있다. 본연구에서는고염에저항성을가지는유용유전자를선별하기위하여, 200 mm NaCl 을처리한 T. halophila 또는 T. parvula 식물로부터 mrna 를분리하여 cdna library 를작성하였다. Full length cdna library 를 Agrobacteria-methods 형질전환방법에필요한 binary vector pool 을작성하고 Arabidopsis 에형질전환시켰다. 형질전환되어진 Arabidopsis 를항생제 Basta 선별을통하여형질전환체 pool 을구축하였다 (305,400 종자 ). 이와같은방법을통해구축되어진 pool 중에서 168,500 종자를이용하여고염스트레스조건하에서종자발아율과뿌리생장촉진되는현상이나타나는내염성형질전환체를 1 차선

23 82 J Plant Biotechnol (2014) 41:81 88 별하였다 (7,157 개체 ; 4.24%). 1 차선별된형질전환체중에서 1,551 개체를이용하여 2 차선별을수행하여내염성형질전환체 165 개체를확보하였다 (10.6%). 선별된형질전환체중대부분개체는고염스트레스에대응하여종자발아및뿌리생장모두야생형보다촉진된표현형을보였다. 그중몇몇의형질전환체는야생형에비하여특이적인기관발달현상이나타났다. 예를들면, 꽃과줄기의발달이야생형과는다른표현형을보이는형질전환체가선별되었다. 이렇게스트레스에내성을가지는형질전환체로부터유전자분리방법을통하여해당유용유전자를확보할수가있다. 본연구에서는향후 halopyte 식물체를이용하여고염뿐만아니라다양한환경스트레스 ( 건조, 냉해, 고열, 호르몬등 ) 신호전달에관여하는유용유전자를보다쉽게확보하는방법을제시함으로서, 환경재해극복에관여하는신호전달기작을보다쉽게이해할수있을것으로사료된다. 서론 고염스트레스는가뭄, 냉해, 고온과더불어식물의생장과발달을저해하는환경저해스트레스중하나이다 (Yun 2005; Zhu 2002). 토양내과다한염농도는건조한토양에서더큰스트레스요인으로작용하며, 식물의생육 생장을저해하여생산성저하에큰영향을미친다 (Parvaiz and Satyawati 2008). 국제연합식량농업기구의보고에따르면 2050 년에는세계총인구수가 90 억명에이를것으로예측하고있다. 또한비생물학적스트레스에의해전세계경작지의약 19.5% (45 Mha) 가량이영향을받으며, 관계지의절반가량이이영향권에속해있다 (Zhu 2001). 급속한인구증가와산업화로인한경작지의감소는단위면적당식량생산량을최대화하기노력으로이어져왔다. 이러한요구에의해환경스트레스신호전달과정을이해하고스트레스저항성유전자를발굴하려는연구가수행되어져왔으며다양한환경재해에서도생장이원할할수있는재해저항성식물및작물이개발되고있다. 대표적인내염모델식물인 salt cress 는비내염식물인 Arabidopsis 와유연관계가매우높은것으로알려져있다 (Gong et al. 2005; Inan et al. 2004; Wu et al. 2012). 인류가식량으로사용하는대부분의작물은비내염식물로전세계식물종의약 2% 만이고염의생육조건에서도생장이가능한내염식물로분류되어있다. 따라서극한환경에서생육이가능한내염식물의유전자기능연구가활발히진행되고있으며내염식물의유전자기능을이해함으로써비내염식물인대부분의작물의기능개선에유용하게활용되고있다. 최근 Dassanayake 등 (2013) 의보고에의하면내염식물인 salt cress 의 genome 을분석하여비내염식물인 Arabidopsis 와비교해본결과특이적으로발현이증가 하는대부분의유전자가환경스트레스신호전달이나적응에연관이있는것으로밝혀졌다. 이러한사실은극한의환경스트레스에적응하기위해서특정유전자를증폭함으로인해서일어난진화적산물이라볼수있다. 따라서비내염성인 Arabidopsis 에내염성인 salt cress 의특정기능성유전자를형질전환하여다양한환경스트레스에적응이가능한새로운기능성식물을개발할수있을가능성을제시하였다. 유전학적선별법 (Forward Genetics Screening) 은다양한유전공학기술의발달로인간을포함한대부분의모델종의 genome map 이완성됨에따라특정표현형을조절하는유전자를찾기위한방법으로널리활용되어져왔다 (Krysan et al. 1999). 특정유전자를결손또는과다발현시킴으로서다양한환경스트레스에대하여민감성또는내성을가지는식물체를선별할수있으며, 선별된식물체로부터스트레스신호전달에관련된유용유전자를분리하게되었다 (Finkelstein et al. 2002; Yamaguchi-Shinozaki and Shinozaki 2006). 예를들면대표적인고염스트레스저항성에관여하는 SOS 유전자의경우이러한유전학적선별법에의해발굴되어그기능이밝혀져있다 (Zhu 2001). 이러한방법의하나로 Arabidopsis 나다른식물의유전자 library 를과다발현 vector 에삽입하여식물체에도입함으로써특정환경스트레스에저항성을보이는식물을선별하여그유전자의기능을알수있다. 최근다양한내염성식물의유전자 library 를이용하여염저항성에관여하는유전자발굴을위한도전이계속되어왔다 (Cushman and Bohnert 2000; Lei et al. 2007; Ni et al. 2007; Du et al. 2008; Papdi et al. 2008). 본연구에서는다양한형질전환기법중에서 Floral Dipping 방법을이용하여내염식물인 T. halophila 또는 T. parvula 에서분리한 mrna 로부터합성한 cdna 를과다발현 vector 를통해비내염성식물인 Arabidopsis 에발현시킴으로써고염스트레스조건하에서생장이야생형보다잘되는형질전환체를선별하였다. 본연구에서사용한방법은고염뿐만아니라여러환경스트레스저항성에관여하는유전자를발굴하고그유전자의기능및작용기작을연구하는데있어서아주유용한방법이다. 재료및방법 식물재료및생육조건 본연구에서사용한식물은내염성식물인 T. halophila, T. parvula 와비내염성식물인 Arabidopsis thaliana (Col-0) 이다. 종자는 70% 에탄올에서 1 분간세척후 2% NaClO 용액에서 5 분간소독하였다. 소독이끝난종자는멸균된증류수를이용하여 5 회반복세척하였다. 발아를위한배지로는 1/2 MS, 2% sucrose (ph 5.7), 1.2% 또는 0.6% agar 를넣어고형화시켰다. 춘화처리를위해배지에파종

24 J Plant Biotechnol (2014) 41: 한종자를 4 일간 4 C 에서암처리한후, 22 C 장일조건 ( 낮 16 시간, 밤 8 시간 ) 인식물생장실에서배양하였다. 내염성유전자발현 library 구축 2 주된 T. halophila 의식물체 (H) 와 T. parvula 의잎 (PL) 으로부터 total mrna 를 Plant RNA purification Reagent (Invitrogen) 를이용하여분리하였다. Total RNA 의정성분석은분광흡도계의 A260/280 측정값을통하여확인하였다. Poly(A)+ mrna 는 Oligotex Direct mrna kit (Qiagen) 을이용하여순수분리하였다. Biotinylated-oligo (dt) primer (5`-[BioTEG]GGCG GCCGCACAACTTTGTACAAGAAAGTTGGGTTTTTTTTTT TTTTTTTTVN-3`) 를이용하여 cdna 의첫번째가닥을합성하였다. Superscript II 에의해 3~4 개의시토신잔기가 3` 말단에연결되며 5` 말단에는 Gateway primer (5`-TCGTCG GGGACAACTTTGTACAAAAAAGTTGGG-3`) 로디자인하였다. 합성된 cdna 의정규화를위해 500 ng 의 cdna 와 1.5 μg 의 mrna 와반응 buffer (80% formamide, 250 mm NaCl, 25 mm HEPES, 5 mm EDTA) 에서 24 시간동안반응한후 hydroxyapitite chromatography 로결합물을분리하였다. 두번째합성가닥을제작하기위해서첫번째합성가닥의 5` 말단 Gateway primer 를 PFX platinum polymerase (Invitrogen) 를이용하여 95 C 1 분, 68 C 10 분, 95 C 20 초반응을각각 3 회반복후 95 C 에서 5 초, 68 C 에서 8 분간반응하였다. Sepharose column (Invitrogen) 을이용하여사이즈가 700 bp 이상인 cdna 를정제하였다. 정제된 cdna 는 pdonr222 vector (Invitrogen) 에 Gateway BP 반응을통해삽입하였다. 클로닝된 cdna 는 Electormax DH10B T1 Phage cell 에형질전환하였다. 제작된 library 의역가는 4 X 10 6 으로확인되었다. 소량의 library 는분주하여 sequencing 을위해보관하였으며나머지 library 에 75 μg/ml 의 carbenicillin 이첨가된 100 ml 의 LB 를혼합하여 30 C 에서 14 시간배양하였다. Plasmid DNA 는 Qiagen Column 으로정제하였으며 10 mm TE buffer 에녹여사용하였다. Gateway LR 반응을통해식물형질전환 vector 인 pearlygate 100 vector 에클로닝하였으며, 클로닝된 plasmid 를 Agrobacterium 에형질전환시켰다. 식물형질전환체선별및고염스트레스저항성식물체선별 형질전환체를얻기위해 22 C 의장일조건에서 4 주간키운 Arabidopsis 를 Floral Dipping 방법 (Clough and Bent 1998; Bent 2000) 을이용하여 T. halophila 와 T. parvula cdna 과다발현 library 가클로닝된 pearlygate 100 binary vector 를가진 Argobacterium pool 을이용하여형질전환하였다. 수집된종자는 4 일간건조시킨후소독하여파종하였다. 고염스트레스에저항성을보이는형질전환체를선별하기위하여, 고염 (130 mm NaCl) 가함유된 MS 배지에종자를파종한후 7 일동안키워서야생형보다상대적으로발아및생장이빠른 seedling 을흙으로옮긴후, 종자를수확하였다. 뿌리길이는 4 일동안생장한야생형과형질전환체를정상배지와염이함유된배지에옮긴후, 수직으로세워 7 일간배양하여뿌리길이와잎의표현형을관찰하였다. Fig. 1 Diagram of salt cress cdna library and flow chart of screening strategies. (A) Flow chart exemplifying the salt tolerant mutant screening strategy using the salt cress cdna library. Construction of cdna library and transformation, selection for salt tolerant transgenic plants, gene identification, and functional analysis of target gene are illustrated schematically. (B) Schematic map of the salt cress cdna library in pearlygate 100. The cdna library is controlled by the CaMV 35S promoter. LB and RB are T-DNA border sequences, respectively. (C) The 2 nd screening of Arabidopsis transgenic lines expressing salt cress cdnas that show improved salt tolerance. The salt cress cdna library transgenic lines were screened at a concentration of 130mM NaCl for 7 days. WT Arabidopsis plant was used as negative control under salt stress. H means transgenic plants overexpressing T. halophila cdna

25 84 J Plant Biotechnol (2014) 41:81 88 Table 1 Selection of salt-tolerance lines from salt cress cdna overexpressing Arabidopsis mutants M1 M2 Generation Total Seeds No. Tested Seeds No. Tolerant Percentage Seed No. (%) T. halophila 94,100 3, % T. parvula 211, ,050 7, % Total 305, ,500 7, % T. halophila % T. parvula 7,022 1, % Total 7,157 1, % 결과및고찰 Salt cress cdna 를과다발현시킨 Arabidopsis 형질전환체 pool 구축 고염스트레스신호전달에관여하는 T. halophila 와 T. parvula 유전자를확보하기위해서비내염성식물인 Arabidopsis 에형질전환하여고염배지조건하에서생육이가능한식물체를선별하였다. Figure 1A 는본연구에사용한연구전략을모식화하였다. 형질전환을위하여합성된 T. halophila 와 T. parvula cdna 를 Binary vector 인 pearlygate 100 vector 에 Gateway 반응을통해삽입하였다 ( 재료및방법 ). 형질전환체선별을위해제초제인 Basta 에저항성을갖는유전자를 vector 에삽입하였으며식물의 genome 내삽입을위해각각 LB 와 RB sequence 를사용하였다. T. halophila 와 T. parvula cdna 는과다발현 promoter 인 CaMV 35S promoter 의조절을받도록설계하였다 (Fig. 1B). 고염저항성유전자를갖는식물체를선별하기위한전략으로합성된 cdna 를 vector 에삽입후 Arabidopsis 에 Agrobacterium 을이용하여형질전환하였다. Basta 에저항성을보이는식물을 1 차선별한후, 고염 (130 mm NaCl) 이함유된스트레스배지에키워야생형의 Arabidopsis (WT) 보다생장이잘되는식물체를 2 차선별 (M1) 하였다 (Fig. 1C, Table 1). M1 세대 305,400 개의종자중 168,500 개의종자를 130 mm NaCl 이함유된고염배지에서배양시켜야생형보다발아율이증가된 7,157 식물체 (4.24%) 를선별하였다. 이렇게선별된 M2 종자중 1,551 식물체를고염스트레스에서발아율과뿌리생장측정하여내성을가지는 165 식물체 (10.63%) 를선별하였다 (Table 1, 2). 고염스트레스에내성을가지는형질전환체선별 고염스트레스는대부분의생육환경에서종자발아를저해하는중요한환경요소로알려져있다 (Vallejo et al. 2010). 생리학적인측면에서고염스트레스는식물생장 발육을저해하는 2 가지반응기작을통한다. 첫번째반응기작은 Table 2 Salt tolerant phenotype of Arabidopsis mutant with salt cress cdna library Plant Line Salt tolerance phenotype Developmental name Seed germination Root growth phenotype H H H H H H H H H H H H H H H H PL PL PL PL PL PL PL PL PL PL PL Late flowering PL PL Flower development PL Flower development PL PL Seed development +++; very strong salt tolerance, ++; strong salt tolerance, +; weak salt tolerance 고염스트레스에노출즉시나타나는반응으로삼투현상에의해식물체의수분포텐셜이급격히변하는현상이고, 두번째반응기작은초기이후에일어나는이온특이적반응으로식물세포내에독성을띄는나트륨의농도가증가하여이온독성이나타내는현상이다 (Bliss et al.

26 J Plant Biotechnol (2014) 41: ; Yun 2005; Munns and Tester 2008). 특히 종자 발아 단계에서 고염 스트레스에 노출되게 되면 토양으로부터 수분의 흡수를 방해하는 삼투압 스트레스와 고농도 이온 스트레스가 작용하여 결과적으로 종자 발아율을 감소시 키게 된다. 선별된 형질전환체가 고염 스트레스에 저항성을 가지 는지 확인하기 위하여, 고염 배지에서 종자의 발아율을 측정해 보았다. T. halophila 유전자가 과다발현 된 형질전 환체인 H7-9450의 4개 식물체(H 부터 H 까 지)와 야생형 식물체(WT)를 각각 130 mm NaCl과 150 mm NaCl이 함유된 고염배지에 종자를 파종하여 발아시켰다 (Fig. 2). 7일이 지난 후 H7-9450의 4개 형질전환체는 모두 야생형보다 고염배지에서 발아율이 증가 되어지는 사실 을 확인하였다. H , -2, -3, -4 식물체는 130 mm NaCl 이 함유된 배지에서 종자 발아율이 각각 약 39%, 36%, 26%, 60% 로 야생형보다 각각 35%, 32%, 22%, 56% 증가되었 다. 또한 150 mm NaCl 배지에서 H , -2, -3, -4 식물 체의 발아율은 각각 약 7%, 13%, 7%, 5%로 발아가 억제 된 야생형보다 높은 발아율을 보였다(Fig. 2B). T. parvula의 잎에서 분리한 유전자가 과다발현 된 형질 전환체인 PL 식물체와 야생형을 각각 130 mm NaCl과 150 mm NaCl이 함유된 고염배지에 종자를 파종 하여 발아시켰다(Fig. 3). 7 일이 지난 후 PL 형 질전환체는 야생형보다 고염배지에서 발아율이 증가 되 어지는 사실을 확인하였다. PL 식물체는 130 mm NaCl이 함유된 배지에서 종자 발아율이 약 82%로 야생 형보다 71% 증가된 발아율을 보였다. 또한 150 mm NaCl 배지에서 발아율이 약 41%로 발아가 억제된 야생형보다 Fig. 2 Seed germination of transgenic lines overexpressing T. halophila cdnas under salt stress conditions. (A) WT Arabidopsis and seeds representing four lines of the primary transformant H were germinated on 1/2 MS agar medium without NaCl (0 mm NaCl) or with NaCl (130 mm NaCl or 150 mm NaCl). About 35 seeds from each of the four lines were then tested again to probe for segregation. Photos were taken after 7 days (B) Rosette leaf growth is shown for experiment (A). Bars represent the means ± standard error of three replicates with 35 seeds per replicate. Asterisks represent significant differences from the WT (*; 0.01< p-value 0.05, **; p-value 0.01, Student s t-test) Fig. 3 Seed germination of transgenic lines overexpressing T. parvula cdna under salt stress conditions. (A) WT Arabidopsis and PL were germinated on 1/2 MS agar medium without NaCl (0 mm NaCl) or with NaCl (130 mm NaCl or 150 mm NaCl). About 35 seeds of each line were then tested individually revealing segregation of the phenotype. Photos were taken after 7 days. (B) Rosette leaf growth is shown for experiment (A). Bars represent the means ± standard error of three replicates with 35 seeds per replicate. Asterisks represent significant differences from the WT (*; 0.01< p-value 0.05, **; p-value 0.01, Student s t-test)

27 86 높은 발아율을 보였다(Fig. 3B). 현재까지 보고 되어진 고염 스트레스 내성 형질전환체 들의 경우 세포막에 위치하는 이온 수송체 이거나 스트 레스 신호전달 기작을 조절하는 단백질들이 잘 알려져 있다. 본 연구에서 선별한 형질전환체로부터 T. halophila 와 T. parvula 유전자를 분리하게 되면, 이미 밝혀진 신호 전달 기작과 유사한 기작을 통해 고염 스트레스에 저항 성을 보일 가능성이 있다. 뿐만 아니라 다른 환경재해 극 복 신호전달 기작과의 상관관계를 연구하는데 있어서 더 욱 박차를 가할 수 있을 것이라 사료된다. 고염 스트레스 내성 및 뿌리 발달에 관여하는 형질전환체 선별 종자 발아율과 뿌리 길이 측정은 대표적인 염 내성 돌연 변이체 식물을 선발하는 방법으로 알려져 있다(Zhu et al. 1998). 선별된 PL 형질전환체는 130 mm NaCl와 150 mm NaCl 고염배지에서 각각 약 90%, 81% 의 종자 J Plant Biotechnol (2014) 41:81 88 발아율로 야생형보다 각각 약 78%, 76% 의 높은 발아율 을 보였다(Fig. 4A, 4B). 특이하게도 PL 형질전환 체의 뿌리는 일반 생장조건에서 야생형보다 뿌리 생장이 약 56% 저해받는 것을 확인 할 수 있었다(Fig. 4C, 4D). 이 러한 사실은 T. parvula 유전자가 식물의 뿌리 발달 및 생 장에 영향을 주는 것이라 추측 가능하다. 하지만 흥미롭 게도 고염 스트레스 조건하에서는 PL 형질전환 체의 뿌리는 야생형의 뿌리에 비해 염에 의한 독성에 영 향을 받지 않는다는 사실을 확인할 수 있다(Fig. 4C, 4D). PL 형질전환체의 뿌리 생장은 일반 생장조건에 서는 야생형보다 저해를 받지만, 150 mm NaCl이 함유된 고염배지에서는 야생형의 뿌리와 비슷하게 자란다. 그리 고 175 mm NaCl이 함유된 고염배지에서는 야생형의 뿌 리는 거의 자라지 못할 뿐만 아니라 잎도 백화현상이 생 기는 반면에, PL 형질전환체의 뿌리는 고염에 대해 저항성을 보이면서 생장을 하며 잎에서도 백화현상 이 일어나지 않는다. 이러한 결과는 T. parvula의 유전자 Fig. 4 Tolerance by T. parvula cdna overexpressed under salt stress conditions. (A) WT Arabidopsis and seeds representing four lines of the primary transformant H were germinated on 1/2 MS agar medium without NaCl (0 mm NaCl) or with NaCl (130 mm NaCl or 150 mm NaCl). About 35 seeds from each of the four lines were then tested again to probe for segregation. Photos were taken after 7 days. (B) Rosette leaf growth is shown for experiment (A). Bars represent the means ± standard error of three replicates with 35 seeds per replicate. Asterisks represent significant differences from the WT (*; 0.01< p-value 0.05, **; p-value 0.01, Student s t-test). (C) WT and PL were grown on 1/2 MS agar medium for 4 days, and then transferred to 1/2 MS agar without NaCl (0 mm NaCl) or with NaCl (150 mm NaCl or 175 mm NaCl), and incubated for 7 days. (D) Comparison of root-elongation in relationship to different concentration of NaCl in WT and PL plants. Bars represent the means ± standard error of three replicates with 16 seedlings per replicate

28 J Plant Biotechnol (2014) 41: 가고염에대해서내성을가지는아주특이한유용유전자일가능성이제시된다. 지금까지보고되어진경우를보면, 고염스트레스에내성을가지는특정유용유전자는다른환경재해극복에중요한기능을하며, 식물발달에서도핵심유전자로서의기능을한다 (Kim et al. 2013). 따라서 salt cress 의유용유전자역시다양한환경스트레스에적응하는데필요한핵심인자이면서동시에식물발달에서도중요한기능을하는유전자가존재한다는사실을확인할수있다. 식물발달과정에서비정상적표현형을보이는형질전환체선별 선별된형질전환체들은고염스트레스에저항성을보이는것뿐만아니라야생형과비교하여비정상적인생장표현형을보이는형질전환체들도있었다. 대표적으로 PL 와 PL 그리고 PL 는식물체생장에있어야생형과는전혀다른표현형을보이는것으로관찰되었다 (Fig. 5). 이들형질전환체들은모두 M2 seed 를형성하지않는불임성의표현형을보여유전자기능을연구하는데제한점이있었다. 꽃의분열조직은바깥쪽부터꽃받침, 꽃잎, 수술, 심피의 4 종류의조직으로구성되어져있으며 ABC 모델에의해발생이조절된다. 이를구성하는유전자그룹중 AGAMOUS 는클래스 C 유전자로서수술과심피의발달을조절한다. 따라서 AGAMOUS 유전자가결손되게되면꽃받침, 꽃잎, 꽃받침순으로 수술과심피가생성되지않아불임의표현형을나타낸다고알려져있다 (Yanofsky et al. 1990; Drews et al. 1991). 이중 PL 와 PL 은매우유사한표현형을보였는데 (Fig. 5A), 애기장대의 AGAMOUS 돌연변이체와유사하게꽃의기관형성에서꽃받침이생성되어야할부위에서꽃받침이아닌꽃잎이형성되어있음을알수있었다. 따라서 PL 와 PL 로부터유전자를분리및기능해석을통하여, 동일한기관발달기작에관여하는 AGAMOUS 와상반적인유전자이거나또는 AGAMOUS 와는다른발달기작에관여하는유전자일것으로사료된다. 또한 PL 형질전환체는고염스트레스에대한저항성은보이지않았지만야생형에비해줄기조직이두껍게발달하고장각의발달이불안정하여불임으로종자를생성하지못하였다 (Fig. 5B). 본연구에서보고하는결과처럼 Arabidopsis 에서 salt cress 의 cdna 과다발현형질전환체 pool 은고염뿐만아니라다양한환경스트레스저항성유전자발굴이외에도식물발달및생장관련유전자를연구하는데사용될수있을것이라기대되어진다. 사사 본연구는교육부의재원으로한국연구재단의기초연구사업 (MSIP; 2013R1A2A1A , NRF-2013R1A1A ; 백동원 ) 과농촌진흥청차세대바이오그린 21 사업 (SSAC, grant#: PJ009557) 의지원을받아수행된것이다. References Fig. 5 Morphological phenotype of salt cress cdna expression lines. (A) Abnormal flower phenotypes of PL and PL from the T. parvula cdna library. Flowers showed a multi-petaled phenotype. Stamens are replaced by petals, and the central gynoecium was repeated in the flowers. (B) Phenotype of PL Stem thickness was increased compare to WT Arabidopsis. Photos were taken after 7 weeks Bent AF (2000) Arabidopsis in planta transformation. Uses, mechanisms, and prospects for transformation of other species. Plant Physiol 124: Bliss RD, Platt-Aloia KA, Thomson WW Osmotic sensitivity in relation to salt sensitivity in germinating barley seeds. Plant, Cell and Environment 9: Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: Cushman JC, Bohnert HJ (2000) Genomic approaches to plant stress tolerance. Curr Opin Plant Biol 3: Dassanayake M, Oh D-H, Hass J, Hernandez A, Hong H, Ali S, Yun D-J, Bressan RA, Zhu J-K, Bohnert HJ, Cheeseman JM (2013) The genome of extremophile crucifer Thellungiella parvula. Nature Genetics 43: Drews GN, Bowman JL, Meyerowitz EM (1991) Negative regulation of the Arabidopsis homeotic gene AGAMOUS by the APETALA2 product. Cell 65: Du J, Huang Y-P, Xi J, Cao M-J, Ni W-S, Chen X, Zhu J-K, Oliver

29 88 J Plant Biotechnol (2014) 41:81 88 DJ, Xiang C-B (2008) Functional gene-mining for salttolerance genes with the power of Arabidopsis. Plant J 56: Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell(Suppl) 14:S15-S45 Gong Q, Li P, Ma S, Indu Rupassara S, Bohnert HJ (2005) Salinity stress adaptation competence in the extremophile Thellungiella halophila in comparison with its relative Arabidopsis thaliana. Plant J 44: Inan G, Zhang Q, Li P, Wang Z, Cao Z, Zhang H, Zhang CQ, Quist TM, Goodwin SM, Zhu JH, Shi HJ, Damsz B, Carbaji T, Gong Q, Ma S, Fredricksen M, Galbraith DW, Jenks MA, Rhodes D, Hasegawa PM, Bohnert HJ, Joly RJ, Bressan RA, Zhu J-K (2004) Salt Cress. A Halophyte and Cryophyte Arabidopsis Relative Model System and Its Applicability to Molecular Genetic Analyses of Growth and Development of Extremophiles. Plant Physiol 135: Kim WY, Zahir Ali, Park HJ, Park SJ, Cha JY, Javier Perez- Hormaeche, Francisco Javier Quinter, Shin G, Kim MR, Zhang Qiang, Li Ning, Park HC, Lee SY, Ray A. Bressan, Jose M. Pardo, Hans J. Bohnert & Yun DJ (2013) Release of SOS2 kinase from sequestration with GIGANTEA determines salt tolerance in Arabidopsis. Nature Communications 4:1352 Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an Insertional mutagen in Arabidopsis. Plant Cell 11: Lei Z-Y, Zhao P, Cao M-J, Cui R, Chen Z, Zing L-Z, Zhang Q-F, Oliver DJ, Xiang C-B (2007) High-throughpur binary vectors for plant gene function analysis. J Integr Plant Biol 49: Munns R, Tester M Mechanisms of salinity tolerance. Annual Review of Plant Biology 59: Ni WS, Lei Z-Y, Chen X, Oliver D-J, Xiang C-B (2007) Construction of a plant transformation-ready expression cdna library for Thellungiella halophila using recombination cloning. J. Integr. Plant Biol 49: Papdi C, Abrham E, Joseph MP, Popescu C, Koncz C, Szabados L (2008) Functional identification of Arabidopsis stress regulatory genes using the controlled cdna overexpression system. Plant Physiol 147: Parvaiz A, Satyawati S (2008) Salt stress and phyto-biochemical responses of plants a review. Plant Soil Environ. 54:88-99 Vallejo AJ, Yanovsky MJ, Botto JF (2010) Germination variation in Arabidopsis thaliana accessions under moderate osmotic and salt stresses. Ann of Botany 1-10 Wu HJ, Zhang Z, Wang JY, Oh DH, Dassanayake M, Liu B, Huang Q, Sun HX, Xia R, Wu Y, Wang YN, Yang Z, Liu Y, Zhang W, Zhang H, Chu J, Yan C, Fang S, Zhang J, Wang Y, Zhang F, Wang G, Lee SY, Cheeseman JM, Yang B, Li B, Min J, Yang L, Wang J, Chu C, Chen SY, Bohnert HJ, Zhu JK, Wang XJ, Xie Q (2012) Insights into salt tolerance from the genome of Thellungiella salsuginea. Proc Natl Acad Sci USA. 109: Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory newtorks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 53: Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldmann KA, Dyerowitz M (1990) The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346:35-39 Yun D-J (2005) Molecular mechanism of plant adaption to high salinity. Korean J Plant Biotechnol 32:1-14 Zhu J-K, Liu J, Xiong L (1998) Genetic analysis of salt tolerance in Arabidopsis: Evidence for a critical role of Potassium nutrition. Plant Cell 10: Zhu J-K (2001) Plant salt tolerance. Trends Plant Sci 6:66-71 Zhu J-K (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:

30 J Plant Biotechnol (2014) 41:89 93 DOI: ISSN Research Article 장기간계대배양된장미배발생캘러스로부터식물체재분화및비정형체로부터새로운배발생캘러스재생 이수영 도경란 천경성 김원희 권오현 이혜진 New embryogenesis from atypical bodies and plant regeneration from long-term subcultured embryogenic callus in rose Su Young Lee Kyoung Ran Do Kyeong-Seong Cheon Won Hee Kim O Hyeon Kwon Hye Jin Lee Received: 12 May 2014 / Revised: 20 May 2014 / Accepted: 20 June 2014 c Korean Society for Plant Biotechnology Abstract Long-term subcultured rose embryogenic calluses, which had been maintained for more than 5 to 6 years since the first embryogenesis from calluses induced from in vitro roots of rose, were identified as potential material for the development of transgenic plants. The first embryogenic calluses from Sweet Yellow and two breeding lines (KR and KR056006) were obtained in 2007 and 2009, respectively. Subsequently, we found that plants regenerated from longterm embryogenic calluses (LEC). Whereas the LEC from Sweet Yellow takes 3 to 4 months to regenerate plants, those of the two breeding lines take 4 to 5 months. This period of time is the same as that taken for plants to regenerate from the first embryogenic callus. New embryogenesis was observed from atypical bodies (ABs) that appeared during the process of long-term subculture. We found that it is possible to use the AB as a material for new embryogenesis. Keywords Atypical body, Embryogenic callus, Long-term subculture, New embryogenesis regeneration, Rose 서언 형질전환기술을이용하여개발된품종이처음실용화되었던 1996 년에 1.7 백만 ha 이었던 GMO 품종의전세계재 S. Y. Lee ( ) K. R. Do K. S. Cheon W. H. Kim O. H. Kwon H. J. Lee 농촌진흥청국립원예특작과학원 (National Institute of Horticultural & Herbal Science, Rural Development Administration, Suwon , Korea) lsy @korea.kr 배면적이 2012 년에는 1996 년의 100 배인 170 백만 ha 로증가되었고, 2009 년말세계 3 대절화류의하나인장미에서화색변형형질전환품종 APPLAUSE 가일본의 Suntory 사에서상업화되어 2013 년 3 월현재일본의홋카이도등 8 개지역 240 개점포에서시판될정도로 (Lee 2013) 이제는형질전환기술이신품종개발을위한육종기술의하나로정착되었다고단언해도과하지않을것이다. 그런데이형질전환기술을이용하여신품종을개발하기위해서는식물체재분화기술이확립되어야만하는데장미의경우잎이나뿌리등기관절편체로부터직접식물체를재분화시키거나체세포배발생캘러스를경유하여식물체를재분화시키는많은연구보고가있다 (Dubois and de Vries 1995; Dohm et al. 2001; Hsia and Korban 1996; Ibrahim and Debergh 2001; Kamo et al. 2005; Kim et al. 2003; Marchant et al. 1996; Pati et al. 2004; Zakizadeh et al. 2008). 본연구팀에서도장미기내뿌리로부터배발생캘러스의유도및증식에관한연구보고를한바있고 (Lee et al. 2008, 2010a), 이체세포배 ( 배발생캘러스포함 ) 를절편체로이용한형질전환기술을개발한바있다 (Lee et al. 2010b, 2013). 유전자가전이된장미형질전환식물체를획득하고자할때현재까지알려진가장효율적인재료는체세포배발생캘러스이다 (Firozabody et al. 1994; Tanaka 2009). 이는체세포배발생캘러스를구성하고있는각각의세포가독립적으로행동하여세포하나하나가체세포배로발달할수있고, 기관분화나조직으로부터분화한캘러스로부터획득된식물체와는달리식물체일부분만유전자가전이된키메릭형질전환체를획득할가능성이매우낮을뿐아니라 (Li et al. 2002) 유전자가전이된체세포배발생캘러스가 2 차배발생캘러스를분화시킬수있어형질전환체를

31 90 J Plant Biotechnol (2014) 41:89 93 대량획득할수있는장점때문이다. 이와같이배발생캘러스는형질전환식물체를개발하기위한유용한재료이지만장미를비롯하여배발생캘러스를이용하여형질전환체를개발한연구에서이용했던재료는새로운절편체로부터새롭게유도한배발생캘러스이었다. 그런데매번절편체로부터배발생캘러스를유도하여형질전환재료로사용하는것은시간소모적일뿐아니라형질전환식물체의균일한획득을어렵게하므로최근에는형질전환체획득이보편화된알팔파및잔디등에서배발생캘러스를유지증식하여재료로이용할필요성이대두되고있다 (Chai et al. 2011; Liu et al. 2009). 이에본연구팀에서도장미형질전환체개발을위한재료로서장기간유지증식해온배발생캘러스의이용가능성을검토하고자국내육성장미품종및계통유래기내뿌리로부터유도후 5~6 년이상유지증식된배발생캘러스로부터식물체재분화능력유지및유지증식배지에서발생된비정형체로부터새로운배발생캘러스의유도를확인한바이를보고하고자한다. 재료및방법 체세포배발생캘러스계대배양 2007 년과 2009 년에국내육성장미품종 Sweet Yellow 및 KR 와 kr 등국내육성 2 계통의기내식물체뿌리를 5 또는 11 mg L -1 2,4-D, 30 g L -1 sucrose 가첨가되고 7 g L -1 plant agar 로고형화된 Schenk & Hildebrandt (SH) 배지 (Schenk and Hildebrandt 1972)(pH 5.7) 에서 2~8 주배양한후식물생장조절제가첨가되지않은 SH 배지또는 3 mg L -1 2,4-D 및 300 mg L -1 proline, 30 g L -1 sucrose 가첨가되고 2.4 g L -1 phytagel 로고형화된 SH 배지 (ph 5.7) 에서배발생캘러스유도후직경 1.5 ~ 2 cm 의원형으로모아 3 ~6 주간격으로계대배양하였고, 계대배양중발생된비정형체는분리하여동일한배지에배양하였다. 장기간계대배양된체세포배발생캘러스로부터식물체재분화 장기간유지증식해온배발생캘러스를체세포배발아배지 (SH basal salts mg L -1 IBA + 1 mg L -1 BAP + 30 g L -1 maltose + 4 g L -1 agarose, ph 5.7) 나체세포배성숙배지 (SH basal salts + 1 mg L -1 2,4-D + 1 mg L -1 ABA + 1 mg L -1 BAP mg L -1 GA g L -1 sucrose + 4 g L -1 agarose, ph 5.7) 로옮겨신초원기를유도하였다. 신초원기로부터건실한지상부생장을위해신초생장 (MS basal salts + 2 mg L -1 BAP mg L -1 NAA + 30 g L -1 sucrose + 8 g L -1 plant agar, ph 5.8) 배지에서배양하였다. 비정형체로부터배및배발생캘러스재생현미경관찰 조직절편을채취하여 2.5% glutarldehyde 에넣은즉시조직에포함되어있는기포를제거하였다. 모든과정은 4 C 에서진행되었으며 90 분간 1 차고정처리후 0.1 M phosphate buffer (ph 7.2) 로 15 분간격으로 4 ~5 회세척하였다. 2 차고정으로는 1% osmium tetroxide 로 4 C 에서 90 분간처리한후, 0.1 M phophate buffer (ph 7.2) 로 20 분간격으로 4~5 회세척한후마지막 phosphate buffer 에서하룻밤을경과하였다. 탈수는다음날아침에시작한후 40% ethanol, 60% ethanol, 80% ethanol, 90% ethanol, 95% ethanol 로각각 5 분씩그리고 100% ethanol 로 5 분, 15 분, 30 분간탈수하였다. 탈수후에는 epon 의조직내침투를더용이하게하기위해 ethanol 과 propylene oxide 를 1:1 로섞은용액에 sample 을넣고, 15 분간경과시킨후순수 propylene oxide 에 15, 15, 30 분간침지하였다. 최종적으로 epon 에매몰 (embedding) 하기위하여 propylene oxide 와 epon 을 2:1 및 1:1 로섞은용액에각각 3 시간동안처리한후순수 epon 에서하룻밤을경과시켰다. 다음날새로운 epon 으로바꾸어 15 분간처리한후 epon+d.m.p 30 (epon 의 1.5% 첨가 ) 을시료절편과함께 silicon mold 에넣어서 60 C 에 4 일간처리하였다. 처리구마다 10 ~ 15 개의 epon block 을만들고, 이중임의로 2 개의 epon block 을선택하여초미세절편기 (Ultracut R, Leica Co) 를이용하여 1,500 nm 의두께로시료를절단하여 slide glass 위에증류수 1 방울을떨어뜨려치상하고, 60 C 에서 5 시간이상건조시킨후염색하였다. 염색과정은제작된조직절편은 0.5% periodic acid (H 5 IO 6 ) 용액에 30 분간담근후증류수로 10 분간 2~3 번세척, Schiff's reagent 에 15 분간처리, 1% sodium bisulfite 용액에 5 분간처리, 흐르는물로 30 분간세척하는순서로실시하였다. 염색이끝난시료를영구보존하기위하여 60 C 열판에서 5 시간이상건조후 hystomount 를떨어뜨리고 cover glass 로덮고다시건조후 cover glass 주위에붙어있는 hystomount 를깨끗이제거하고광학현미경 (Axioskop 2, Carl Zeiss Co.) 으로검경하였다. 결과및고찰 장기간계대배양된체세포배발생캘러스로부터식물체재분화 장미형질전환체를개발하기위한유전자도입재료로서장기간유지증식된장미배발생캘러스의이용가능성을조사하고자 2007 년및 2009 년에각각처음으로기내뿌리로부터유도된후 (Fig. 1A, 1D, 1G) 5 ~ 6 년이상유지증식배지에서계대배양해온 (Fig. 1B, 1E, 1H) 장미 스위트옐로우 품종및 KR 와 KR 계통유래배

32 J Plant Biotechnol (2014) 41: A B C D E F G H I Fig. 1 Plant regeneration from long-term maintained embryogenic calluses after the first embryogenesis from in vitro roots of two breeding lines [KR (A to C) and KR (D to F)] and cv. Sweet Yellow (G to I) in Rosa hybrida L. A, D, and G: the first embryogenesis from in vitro roots; B, E, and H: embryogenic calluses maintained for more than 5 to 6 years; C, F, and I: plant regeneration from embryogenic calluses maintained for more than 5 to 6 years 발생캘러스로부터식물체의재분화능력을확인하였다. 수수미숙배유래체세포배발생캘러스의장기간유지증식과정에서캘러스의형태가달라진다고보고한 Lambé 등 (1999) 의연구와같이본연구팀에서도장기간유지증식한장미배발생캘러스도계대배양되면서캘러스의형태가변형되는것을관찰할수있었다. 또한배발생캘러스유지증식을위한배지에배양했음에도불구하고배발생캘러스외에도미숙배또는성숙배및자엽전개배도관찰할수있었다. 장기간계대배양된배발생캘러스로부터 Figure 1C, Figure 1F 및 Figure 1I 와같은신초의모습을갖춘식물체로재분화되기까지의기간은품종또는계통에따라차이가있었다. 스위트옐로우 품종은 3 ~4 개월, KR 및 KR 은 4 ~5 개월이소요되었다. 이는각품종및계통의기내뿌리로부터유도된캘러스로부터배발생이후최초재분화식물체획득까지소요된기간과동일한양상이었다 (Lee et al. 2010a). 반면, 장기간계대배양된배발생캘러스로부터재분화식물체획득비율은각품종및계통의기내뿌리로부터유도된캘러스로부터배발생이후최초재분화식물체획득할때와마찬가지로품종과계통간차이는없었다. 배발생캘러스를장기간유지증식했을때재분화능력유지가능기간은작물, 품종, 계대배양을거친캘러스의상태에따라다를수있을것이다. 연구보고에의하면 maritime pine 은 34 주 (Breton et al. 2006), alfalfa 는 7 개월 (Tian et al. 2002), durum wheat 는 10 개월 (Borrelli et al. 1991), Zoysia japonica 는 18 개월 (Liu et al. 2009), pearl millet 은 2 년 (Lambé et al. 1999), fox grapes 은 2 년이상 (Motoike et al. 2001), sugarcane 은 40 개월 (Brisbe et al. 1994), Betel nut palm (Wang et al. 2010) 과 Zoysia matrella (Chai et al. 2011) 는 4 년, 장미 Kardinal 품종은 4 ~5 년이상 (Kamo et al. 2005) 까지배발생캘러스의식물체재분화능력이유지되었다고한다. 본연구에서는장미 스위트엘로우 의경우 6 년이상까지재분화능력이퇴화되지않은것을확인하였다. Liu et al. (2009) 에의하면장기간계대배양된배발생캘러스의재분화능력은계대배양배지조성에따라달라질수있다고한다. 그들은 18 개월까지만식물체재분화능력이유지되었던 Zoysia japonica 종자유래 compact type 캘러스의경우계대배양배지내 CuSO 4 첨가에의해 36 개월까지재분화능력이향상되었다고하였다. 본연구재료인 스위트옐로우 및 KR 등 2 계통배발생캘러스는현재까지식물체재분화능력이퇴화되지않았지만향후재분화능력이퇴화될경우에는배지조성의변화를검토할필요가있을것이다. 유전자도입재료로는체세포배발생캘러스보다는체세포배가더유용하다. 그러므로체세포배에서직접 2 차체세포배를증식하는기술은획기적이라할수있을것이다. Hua et al. (2010) 은자엽전개단계의 Hevea brasiliensis 체세포배의하부를잘게절단하여 2 차배증식이가능하였다고보고한바있으므로장미도향후의연구에서는배발생캘러스유지증식과정에서발생하는자엽전개단

33 92 J Plant Biotechnol (2014) 41:89 93 A B AB NE AB NEC AB AB AB Fig. 2 New embryogenesis on atypical bodies appeared during the process of long-term subculture of embryogenic calluses Rosa hybrida cv. Sweet Yellow. AB, atypical body; NE, new embryo; NEC, new embryogenic callus 계의배로부터바로 2 차체세포배를재생시키는연구검토가필요할것이다. A B AB 비정형체로부터새로운배발생캘러스재생 NEC NE 본연구에서장미체세포배발생캘러스의유지증식을위한계대배양과정에서배지내첨가된 2,4-D 의영향때문인지새로운배발생캘러스외에도부정근및뿌리가비대한형태의비정형체가간간히발생하는것을관찰할수있었다. 이비정형체의정확한조직학적특성을파악하고자현미경관찰을실시한결과 Figure 3D 의오른쪽하단과같이뿌리및잎등과같은기관에서나타나는통도조직이잘발달하고있었다. 이들을배발생캘러스유지증식배지와동일한배지에배양한결과, Figure 2A, 2B, 3A 및 3C 와같이비정형체위에새로운배및배발생캘러스가유도되는것이확인되었고, 현미경하에서도새로운배의관찰을확인할수있었다. 본연구팀이이전에보고한장미체세포배발생캘러스유도연구에서기내식물체뿌리보다배발생캘러스에서유도된뿌리즉부정근이새로운배발생캘러스유도에효과적이라는것을보고한바있다 (Lee et al. 2010a). 그런데비정형체가부정근이비대한형태의모양인것으로볼때비정형체를배발생캘러스유도배지에배양하여배발생캘러스유도효율증진에대한검토가이루어질필요가있을것으로생각된다. 본연구는 Kamo et al. (2005) 이 4 ~5 년이상장기간유지해온장미배발생캘러스재분화능력에관한보고보다더장기간인 5 ~6 년이상계대배양된장미배발생캘러스의재분화에관한보고로써 6 년이상장기간계대배양된체세포배발생캘러스로부터식물체재분화능력을확인한보고로서는세계최초이며, 계대배양중발생하는비정형체가배및배발생캘러스를재생시킬수있는재료로이용가능함을제시하였다. 또한본연구에서보고된장기간계대배양된장미배발생캘러스는장미형질전환기술을이용하여전통적인육종방법으로개발하기어려운장미신품종을개발할수있는유용한재료가 C AB NEC Fig. 3 Microscopic observation of new embryogenesis from atypical bodies appeared during the process of long-term subculture of embryogenic calluses Rosa hybrida cv. Sweet Yellow. AB, atypical body; NE, new embryo; NEC, new embryogenic callus; VT: vascular tissue 될수있을것으로기대한다. 적요 장미형질전환체를개발하기위한유전자도입재료로써 5~6 년이상장기간유지증식된장미배발생캘러스의이용가능성이확인되었다 년및 2009 년에각각처음으로기내뿌리유래캘러스로부터유도된후유지증식배지에서계대배양해온장미 스위트옐로우 품종및 KR 와 KR 계통유래배발생캘러스로부터식물체의재분화능력을확인하였다. 장기간계대배양된배발생캘러스로부터신초의모습을갖춘식물체로재분화되기까지소요기간및재분화율은 스위트옐로우 품종은 3 ~4 개월, KR 및 KR 은 4 ~5 개월로, 이들배발생캘러스가기내뿌리로부터처음으로배발생된후최초신초재분화때와동일한양상이었다. 또한체세포배발생캘러스의유지증식을위한계대배양과 D AB VT

34 J Plant Biotechnol (2014) 41: 정에서발생되는비정형체위에새로운배및배발생캘러스가유도되었다. 이비정형체는새로운배발생캘러스를유도할수있는재료로서이용될수있을것이다. 사사 본연구는차세대바이오그린 21 사업 ( 과제번호 : PJ ) 의지원으로수행되었습니다. References Borrelli GM, Lupotto E, Locatelli F, Wittmer G (1991) Long-term optimized ermbryogenic cultures in drum-wheat (Triticum drum Desf). Plant Cell Rep 10: Breton D, Harvengt L, Trontin JF, Bouvet A, Favre JM (2006) Long-term subculture randomly affects morphology and subsequent maturation of early somatic embryos in maritime pine. Plant Cell Tiss Organ Cult (2006) 87: Brisibe EA, Miyake H, Taniguchi T, Maeda E (1994) Regulation of somatic embryogenesis in long-term callus-cultures of sugarcane (Saccharum officinarum L.). New Phytol 126: Chai M, Jia YF, Chen S, Gao ZS, Wang HF, Liu LL, Wang PJ, Hou DQ (2011) Callus induction, plant regeneration, and long-term maintenance of embryogenic cultures in Zoysia matrella [L.] Merr. Plant Cell Tiss Organ Cult 104: Dohm A, Ludwig C, Nehring K, Debener T (2001) Somatic embryogenesis in roses. Acta Hort 547: Dubois LAM, de Vries DP (1995) Preliminary report on the direct regeneration of adventitious buds on leaf explants of in vivo grown glasshouse rose cultivars. Garrenbauwissenschaft 60: Firozabody E, Moy Y, Courtneygutterson, N, Robinson K (1994) Regeneration of transgenic rose (Rosa hybrida) plants from embryogenic tissues. Bio/Technology 12: Hsia C, Korban SS (1996) Organogenesis and somatic embryogenesis in callus of Rosa hybrida and Rosa chinensis minima. Plant Cell Tiss Org Cult 44:1-6 Hua YW, Huang TD, Huang HS (2010) Micropropagation of self-rooting juvenile clones by secondary somatic embryogenesis in Hevea brasiliensis. Plant breeding 129: Ibrahim R, Debergh PC (2001) Factors controlling high efficiency adventitious bud formation and plant regeneration in vitro leaf explants of roses (Rosa hybrida L.). Sci Hort 88:41-57 Kamo K, Jones B, Bolar J, Smith F (2005) Regeneration from long-term embryogenic callus of the Rosa hybrida cultivar Kardinal. In Vitro Cell Dev Biol Plant 41:32-36 Kim CK, Chung JD, Lee SO, Oh JY (2003) Somatic embryogenesis from in vitro grown leaf explants of Rosa hybrida L. J Plant Biotechnol 5: Lambé P, Mutambel HSN, Deltour R, Dinant M (1999) Somatic embryogenesis in pearl millet (Pennisetum glaucum): Strategies to reduce genotype limitation and to maintain long-term totipotency. Plant Cell Tiss Organ Cult 55:23-29 Lee SY (2013) Review in research and the related industry on the recent transgenic flowers. In: KBCH, KRIBB (eds) Biosafety white paper 2013: Lee SY, Han BH, Kim YS (2010a) Somatic embryogenesis and shoot development in Rosa hybrida L. Acta Hort 870: Lee SY, Jung JH, Kim JH, Han BH (2008) In vitro multiple shoot proliferation and plant regeneration in rose. J Plant Biotechnol 35: Lee SY, Lee JL, Kim JH, Ko JY, Kim ST, Lee EK, Kim WH, Kwon OH (2013) Production of Somatic Embryo and Transgenic Plants Derived from Breeding Lines of Rosa hybrida L. Hort Environ Biotechnol 54: Lee SY, Lee JL, Kim WH, Kim ST, Lee EK (2010b) Acquirement of transgenic rose plants from embryogenic calluses via Agrobacterium tumefaciens. J Plant Biotechnol 37: Li, X., S.F. Krasnyanski, and S.S. Korban Somatic embryogenesis, secondary somatic embryogenesis, and shoot organogenesis in Rosa. J. Plant Physiol. 159: Liu L, Fan XL, Zhang JW, Yan ML, Bao MZ (2009) Long-term cultured callus and the effect factor of high-frequency plantlet regeneration and somatic embryogenesis maintenance in Zoysia japonica In Vitro Cell Dev Biol_Plant 45: Marchant R, Davey MR, Lucas JA, Power JB (1996) Somatic embryogenesis and plant regeneration in floribunda rose (Roas hybrida L.) cvs. Trumpeter and Glad Tidings. Plant Sci 120: Motoike SY, Skirvin RM, Norton MA, Otterbacher AG (2001) Somatic embryogenesis and long term maintenance of embryogenic lines lines from fox grapes. Plant Cell Tiss Organ Cult 66: Pati PK, Sharma M, Sood A, Ahuja PS (2004) Direct shoot regeneration from leaf explants of Rosa damascena Mill. In Vitro Cell Dev Biol Plant 40: Schenk RU, Hildebrandt AC (1972) Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can J Bot 50: Tanaka Y (2009) Flower color modification by genetic engineering Plant Science Conference: 9 Tian LN, Brown DCW, Watson E (2002) Continuous long-term somatic embryogenesis in alfalfa. In Vitro Cell Dev Biol Plant 38: Wang HC, Chen JT, Chang WC (2010) Morphogenetic routes of long-term embryogenic callus culture of Areca catechu. Biologia Plantarum 54:1-5 Zakizadeh H, Debener T, Sriskandarajah S, Frello S, Serek M (2008) Regeneration of miniature potted rose (Rosa hybrida L.) via somatic embryogenesis. Eur J Hort Sci 73:

35 J Plant Biotechnol (2014) 41:94 99 DOI: ISSN Research Article 희귀수종미선나무 (Abeliophyllum distichum Nakai.) 의기내증식및발근에미치는 LED (light emitting diode) 효과 이나념 최용의 문흥규 Effect of LEDs on shoot multiplication and rooting of rare plant Abeliophyllum distichum Nakai Na Nyum Lee Yong Eui Choi Heung Kyu Moon Received: 11 June 2014 / Revised: 14 June 2014 / Accepted: 25 June 2014 c Korean Society for Plant Biotechnology Abstract This study was conducted to elucidate the effect of light sources and explant types on in vitro shoot multiplication and rooting of a rare and endangered plant Abeliophyllum distichum. Both apical buds and axillary buds were used as explants under 4 different light sources, cool white florescent light (F), 100% blue light-emitting diode (LED) (B), 50% blue and 50% red LED mixture (BR), and 100% red LED (R). Clear difference was observed in terms of shoot proliferation by light sources types but not by position-dependent explant types. Multiple shoot induction rates were enhanced under both B and BR light sources. Spontaneous rooting was induced in shoot induction medium under B light source. Both the rates of rooting and numbers of roots per explant were higher in apical bud explants compared to axillary bud explants. Interestingly R light source stimulated shoot elongation but inhibited root development. Therefore, our results suggest that the use of apical bud explants under B or BR light sources is suitable for in vitro micropropagation of a rare and endangered plant species, Abeliophyllum distichum. Keywords Micropropagation, Lighting effect, Explants position, Conservation N. N. Lee H. K. Moon ( ) 국립산림과학원산림생명공학과 (Division of Biotechnology, Korea Forest Research Institute, Suwon , Korea) hkmoon@forest.go.kr Y. E. Choi 강원대학교산림자원학과 (Depart. of Forestry, Kangwon Nat l University, Chuncheon , Korea) 서론 미선나무는물푸레나무과에속하며충북의진천과괴산에서자라는낙엽활엽관목으로높이가 1.5 m 에달한다. 세계적으로 1 속 1 종밖에없는식물로천연기념물제 147, 220, 221 호로지정, 보호되고있을정도로극히제한된지역에서만생육하는대표적인희귀수종중하나이다 (Lee 1976; 1990). 기내배양은삽목과같은전통적인무성번식법의대안으로유용한수단이되어왔으며 (Chen et al., 2006; Kartsonas and Papafortiou 2007). 액아 (axillary bud), 혹은정아 (apical bud) 를이용한미세번식 (micropropagation) 기술이가장보편적인방법으로사용되었다. 이러한기술은국외에서 Ceropegia candelabrum 등다수의희귀약용식물에서효과적인번식법으로사용되었으며 (Beena and Martin, 2003), 국내에서도망개나무등여러희귀식물의미세번식기술이개발되었다 (Youn et al. 1992; Moon et al. 2006; Park et al. 2003; Han et al. 2004). 광 (light) 은식물광합성의에너지원으로써식물의생존및물질생산에필수적이며, 생장과형태형성및색소형성등에관여하는조절인자로써기능을가진다. 특히광질, 광량그리고광주기등이식물의형태, 기관생장및물질생성에밀접하게관여하는것으로알려져있다 (Kozai et al. 1995; Han et al. 2001; Lee et al. 2007). LEDs (light-emitting diode) 는형광등의대체광원으로최근조직배양에응용하여좋은결과를얻고있다 (Shin et al. 2008; Gupta and Jatothu 2013). 여러가지장점으로는, 1) 청색과적색의방사최고점이엽록소 a, b 의최대흡수점과밀접하게일치하고, 파장이최대의광합성효율을지니는점, 2) 내구성이매우높아장기간사용이가능하여

36 J Plant Biotechnol (2014) 41: 비용이절감되는점, 3) 거의열을발산하지않아배양실냉방으로인한전기료가절약되고, 4) 대량번식실용화에적합하며, 5) 소형이어서다루기가쉽다는장점등이있다 (Nhut et al. 2003). 이러한 LED 의장점으로인해메리골드와살비아 (Heo et al. 2002) 등여러식물에서다양하게적용되어왔다 (Choi 2003; Lian et al. 2002; Han et al. 2000; Eun et al. 2000). 또한, 광질에따른연구로광합성기구의발달, 전분생합성, 엽록소및엽록체의발달, 기공세포의개폐, 광형태형성등에미치는영향도밝혀진바있다 (Gupta and Jatothu 2013). 미선나무의조직배양은액아배양의선행연구 (Moon et al. 1999) 가있으나, 기내식물의생장과발근에미치는광질의연구는아직까지수행되지못했다. 본연구는새로운식물배양용광원으로부각되고있는 LED 광원이미선나무의기내생장에미치는영향을조사하였다. LED system 은 GFPR-1600C (Good Feeling ( 주 )) 로 100% 적색광 LED (R), 50% 적색광 LED+50% 청색광 LED 청색 (BR) 및 100% 청색광 LED (B) 로사용하였다. 분광특성은각각적색광 660 nm, 청색광 450 nm 의파장영역에서광합성유효광량자유입밀도 (PPFD, Photosynthetic Photon Flux Density) 가최대치를나타내는단색 LED 광원이며, 대조광으로는냉백색의형광등 (F) 을사용하였다. 이들광원의 PPFD 는모두 40 µmol/m 2 /s 로조정하였으며, 배양환경은 24±1 C, 16h 일장조건에서 4 주간배양하였다. 통계분석 본실험의모든데이터는통계프로그램 SPSS 12.0 을이용하여산출하였다. 각처리간유의성검정을위해서는 one-way ANOVA 를실시하였고, 유의성이있는경우 Duncan s multiple range test 로차후검증을실시하였다. 통계적유의성은 P < 0.05 로설정하여분석하였다. 재료및방법 선행연구 (Moon et al., 1999) 를통해기내에서약 1 개월의배양주기로 MS 기본배지에서유지하고있는미선나무배양체를실험재료로사용하였다. 절편체는정아가있는줄기와정아가없는줄기로나누어마디는 2 ~3 개, 잎은 3~4 개가붙도록 2.5 cm 길이로절단하였다. 줄기유도는 MS (Murashige and Skoog 1962) 배지에 BA 1.0 mg/l 처리하였고, 발근유도는 1/2 GD (Gresshoff & Doy 1972) 배지에 IBA 0.5 mg/l 처리하였다. 탄소원으로는 3% sucrose, 배지의경화는 0.3% gelrite 로하였다. 산도 (ph) 를 5.7 로맞추고고압멸균하였다. 250 ml 배양병 ( mm) 에 30 ml 씩분주한다음처리당 20 개씩 5 반복으로실험하였다. 결과 줄기증식정아와액아절편체를각각의광질하에서 4 주간배양한결과는 Table 1 및 Figure 1 과같다. 증식에있어절편에따른뚜렷한차이는관찰되지않았으나광질에따라서는차이가있었다. 두가지절편에서청색광 (B) 및혼합광 (BR) 에서증식이촉진되는것으로나타났으며, 정아절편에서는형광등과적색광보다유의적인차이를보였다 (Table 1). 액아절편에서는청색광에서만유의적인차이를보였고, 절편당 4.1 개의줄기가유도되어가장좋은결과를보였다. Table 1 Effect of explant position and LEDs on shoot multiplication and elongation. Cultures were maintained on MS medium supplemented with 1.0 mg/l BA Explants Lighting X No. of shoots/explant Shoot length (cm) Rooting (%) No. of roots/explant Apical bud F 1.8±1.2 a Y 2.4±0.9 a - - B 3.4±1.9 b 2.2±0.7 a BR 3.6±1.3 b 2.1±0.9 a - - R 2.0±0.8 a 3.7±0.8 b - - Axillary bud F 2.4±0.8 a 2.9±0.7 a - - B 4.1±1.5 b 2.9±0.7 a BR 2.6±1.0 a 3.0±0.8 a - - R 2.5±0.8 a 3.4±0.8 b - - X F- Fluorescent light; B- 100% blue LED; BR- 50% blue + 50% red LED; R- 100% red LED. Y Mean( ± SD) separation within column by Duncan s multiple range test (P=0.05)

37 96 J Plant Biotechnol (2014) 41:94 99 Fig. 1 Shoot growth pattern under different lightings : F - cool white fluorescent light; B-100% blue LED; BR - 50% blue LED + 50% red LED ; R- 100% red LED Table 2 Effect of explant position and LEDs on in vitro rooting. Cultures were maintained on half-strength GD medium supplemented with 0.5 mg/l IBA Explants LightingX Rooting (%) Apical bud F b 3.1±0.9 b 26.4±9.1 b 5.28±0.6 c 1.0± ±0.2 ab B b 3.3±1.3 b 27.7±5.8 b 5.92±1.2 d 1.0± ±0.4 ab BR 85.0 a 2.3±1.0 a 26.4±6.5 b 3.35±0.5 b 1.0± ±0.4 a R b 3.0±0.9 b 9.90±2.0 a 2.70±0.5 a 1.0± ±0.6 b F 95.0 a 1.9±0.9 a 22.5±7.3 b 4.97±1.3 c 1.2±0.4 b 1.8±0.2 a Axillary bud No. of roots/explant Y Fresh weight of root (mg) Root length (cm) No. of shoots/explant Shoot length (cm) B 85.0 a 2.0±0.9 a 24.2±6.5 b 3.75±0.9 b 1.1±0.2 a 2.2±0.4 b BR 90.0 a 1.9±0.7 a 35.7±9.3 c 3.76±0.8 b 1.0±0.0 a 2.1±0.5 ab R 95.0 a 2.8±1.0 b 9.80±2.3 a 2.30±0.6 a 1.0±0.2 a 3.3±0.7 c X F- Fluorescent light; B- 100% blue LED; BR- 50% blue + 50% red LED; R- 100% red LED. Mean( ± SD) separation within column by Duncan s multiple range test (P=0.05) Y 줄기의 생장은 적색광에서 촉진되었으며 다른 광질과 유의적인 차이를 보였다. 전반적으로 형광등, 청색광 및 혼합광에서 줄기의 생장과 함께 잎의 발달이 정상적으로 이루어진 반면, 적색광에서는 줄기의 신장이 촉진되나 잎의 발달은 저조하게 나타났다. 어느 절편에서나 절편 의 기부에서는 약 0.3 cm의 캘러스가 형성되었고 특히 청 색광에서는 일부 절편에서 발근이 이루어 졌다. 발근유도 대체적으로 정아지 절편이 액아지 절편보다 양호한 발근 을 보였다(Table 2 및 Fig. 2). 그러나 정아지의 혼합광에 서는 다른 광질보다 저조한 발근을 나타내어 유의적인 차이를 보였다. 뿌리 수에 있어서도 광질에 관계없이 정 아지 절편이 액아지 절편보다 양호하게 나타났으나 정아 지의 청색광에서는 뿌리 수가 저조하고 반면 액아지의 적색광에서는 뿌리수가 양호하게 나타났다. 적색광에서 유도된 뿌리는 생장이 매우 저조하여 뿌리 생중량 및 길 이생장에 있어 다른 광질보다 매우 저조하였다. 뿌리의 발달은 혼합광의 액아 절편에서 가장 양호하여 유의적인 차이를 나타내었고, 뿌리의 생장은 형광등 하 에서 가장 좋아 다른 광질과 유의적인 차이를 보였다. 한 편 발근 배지에서 줄기의 생장은 주로 1개의 줄기로 자 랐고, 적색광에서 줄기 신장이 촉진되었다. 다만 적색광 에서는 증식시험에서 관찰된 것처럼 잎의 발달이 저조하 고 일부 절편에서는 정단괴저가 생기는 단점이 있었다. 이상의 결과로 볼 때 미선나무의 기내발근은 정아지를 절편으로 청색광에서 배양함이 좋을 것으로 나타났다. 고찰 기내배양에서 LED를 이용한 광질의 효과는 식물에 따라 매우 다르며 주로 초본 식물을 재료로 많은 연구가 수행

38 J Plant Biotechnol (2014) 41: Fig. 2 Root induction under different lightings : F - cool white fluorescent light; B-100% blue LED; BR - 50% blue LED + 50% red LED ; R- 100% red LED 되었다. 감자의기내배양에서청색광은액아수를증가시켰는데이는광도에따라차이가있으며, 적색광은정아우세 (apical dominance) 를감소시켰으나광도와는무관하였다 (Seabrook 2005). Muleo 등 (2001, 2006) 은 Prunus cerasifera 에서대체적으로청색광은액아의형성을촉진한반면, 적색광은액아에서줄기의발달을촉진한다고하였다. 또한청색광은마디수를증가시켰으나절간신장을억제하였고, 적색광은절간신장이촉진되는결과를보였다고하였다. 도라지에서청색광은형광등과비슷한생장을보인반면적색광은초장을 3 배이상증가시켜도장된상태를보였다 (Eun et al. 2000). Budiarto (2010) 은적색광보다는청색광에서 Anthurium 의더많은줄기를얻었고, Lin 등 (2010) 은청색광에서 Dendrobium officinale PLBs 줄기형성을촉진함을, Heo 등 (2002) 은청색광에서 marigold 의최고줄기신장을얻었다. 그러나포도에서청색광처리는생중량혹은건증량의유의적인증가가없어식물에따른차이를보여주었다 (Heo et al. 2006). Kim 등 (2004c) 은적색광에서절간길이의촉진효과를보인반면, Hahn 등 (2000) 은 Rehmannia glutinosa 의줄기생장에서적색광의억제효과를얻었다. 본실험에서청색광은줄기유도를촉진하는유의적인효과를보여절편당 3 ~4 개의줄기가유도되었다. 줄기신장은광질에따른차이가없었다 (Table 1). 혼합광의효과는절편에따라다르게나타나정아절편은혼합광 (BR) 하에서최대줄기수를얻은반면, 액아절편에서는청색광하에서가장좋은결과를보였다. 대체적으로미선나무의건전한줄기생장및잎의발달은청색광및혼합광에서관찰되었다. 단일 LED 광원보다는혼합광의효과가많이발표되고있는데, Nhut 등 (2000, 2003) 은청색광과적색광의혼용처리로생중량및건중량의증가를가져왔으며, Lin 등 (2010) 은혼합광에서 Upland cotton 의줄기생장촉진으로최대생중량, 건중량을나타냈다. Shin 등 (2008) 도혼합광하에서잎의발달, 뿌리형성, 생중량, 건중량, 잎의면적이커짐을관찰했다. Kim 등 (2004a; 2004b; 2004c) 은이러한차이는청색과적색의광수용체 ( 크립토크롬혹은피토크롬 ) 의서로다른종류의시너지상호작용으로인해줄기신장의촉진혹은억제가나타나며, 이것은식물종에따라달라지는것으로추론하였다. 광질에따른발근및식물생장역시식물에따라반응이다르게보고된다. 덩굴용담에서청색광은발근을억제한반면적색광은발근을촉진하였고 (Moon and Park 2008), 도라지에서는적색광에서뿌리의생장이억제되었다 (Eun et al. 2000). 정등 (2009) 은가시오갈피의배양에서적색, 청색 LED 및형광등하에서발근율이 90% 이상으로높고, 특히청색광에서는뿌리가굵고솜털같은세근이발달되나, 원적색광 (far-red LED) 에서는발근율이 48% 로낮고, 뿌리의생육또한저조하여광질에따른차이를보여주었다. 본실험에서광질에따른발근효과는대체적으로정아지절편에서양호하여미선나무의발근시에는고려해야될내용으로생각되며, 특히적색광단일 LED 하에서는뿌리의형성및발달이저조하여피해야할것으로나타났다. Morrow (2008) 는 LED 의광파장이식물의광수용체에일치할때형태형성의적정반응을가져올수있다고하였는데, 그러나광질의효과는식물종, 식물의발달단계, PPF 와같은환경조건, 배지의조성, 환기조건에따라달라지기때문에기내배양의형태형성을조절하는광질의효과는여전히모호하다고볼수있다 (Gupta and Jatothu 2013). 이상의결과를볼때미선나무의기내배양은단일청색광 LED 혹은청색광및적색광의혼합광 LED 에서증식효과를가져올수있으며, 발근은형광등및청색광

39 98 J Plant Biotechnol (2014) 41:94 99 단일 LED 하에서효과적임을보여주었다. 그러나이러한효과는절편에따라반응이다르게나타나서광원의선택과함께절편체도고려해야함을시사하며미선나무는증식및발근에서액아지보다는정아지를절편으로하고특히발근유도시단일적색광이부적합한것으로나타났다. 한편 Nhut 등 (2003) 은혼합광 LED 에서생장이촉진된식물이차후토양이식후에도생장이좋은것으로관찰하였는데이러한결과는앞으로미선나무에서도검토해야될내용이다. 적요 희귀멸종위기식물인미선나무를재료로기내증식및발근에미치는광질및절편체 ( 정아지및액아지 ) 효과를조사하였다. 광질은냉백색형광등 (F), 100% 청색광 LED (B), 혼합광 (BR; 50% blue LED+50% red LED) 및 100% 적색광 (R) 을사용하였다. 줄기의증식은절편체종류에따른뚜렷한차이를보이지않았으나광질에따른차이를보였다. 전반적으로줄기의증식은청색광및혼합광에서촉진되는것으로나타났으며, 특히청색광에서는일부절편에서발근이이루어졌다. 줄기의생장역시광질에따른현저한차이가없었다. 적색광에서줄기신장이촉진된반면잎의발달은저조하였다. 발근은전반적으로광질에관계없이정아지가액아지보다양호하였고, 뿌리수도증가하였으나혼합광에서는발근이억제되었다. 한편적색광에서는뿌리의발달이매우부진하여다른광질과유의적인차이를보였다. 발근유도시줄기는주로단일줄기로자랐다. 이상의결과를볼때 LED 를이용한미선나무의기내번식은정아지를절편으로청색광및혼합광 LED (BR) 하에서배양함이좋은것으로나타났다. References Beena MR, Martin KP In vitro propagation of the rare medicinal plant Ceropegia candelabrum L. through somatic embryogenesis. In Vitro Cell Dev Biol-Plant 39: Budiarto K Spectral quality affects morphogenesis on Anthurium plantlet during in vitro culture. Agrivita 32: Chen UC, Hsia CN, Yeh MS, Agrawal DC, Rsay HS In vitro micropropagation and ex vitro acclimation of Bulpleurum Kaoi an endangered medicinal plant native to Taiwan, In Vitro Cell Dev Biol-Plant 42: Choi YW Effect of red, blue and far-red LEDs for night break on growth, flowering, and photosynthetic rate in Perilla ocymoides. J Kor Soc Horticul Sci 44: Eun JS, Kim YS and Kim YH Effects of light emitting diodes on growth and morphogenesis of in vitro seedlings in Platycodeon grandiflorum. Korean J Plant Tiss Cult 27:71-75 Gresshoff PM, Doy CH Development and differentiation of haploid Lycopersicon exculentum (tomato). Plant (Berl.) 107: Gupta SD, Jatothu B Fundamentals and applications of light-emitting diodes (LEDs) in in vitro plant growth and morphogenesis. Plant Biotechnol Rep 7: Hahn EJ, Kozai T., Paek KY Blue and red light-emitting diodes with or without sucrose and ventilation affect in vitro growth of Rehmannia glutinosa plantlets. J Plant Biol 43: Han EJ, Kozai T and Paek KY Blue and red light emitting diodes with or without sucrose and ventilation affects in vitro growth of Rehmania glutinosa plantlets. J Plant Biol 43: Han JS, Kim SK, Kim SW and Kim YJ Effects of shading treatments and harvesting methods on the growth of Eleutherococcus senticosus Maxim. Korean J Medi Crop Sci 9:1-7 Han MS, Moon HK, Kang YJ, Kim WW, Kang BS, Byun KO Micropropagation of an endangered species, Stellera rosea N. by tissue culture. Korean J Plant Biotechnol 31(1):31-35 Heo JW, Lee CW, Chakrabarty D and Paek KY Growth responses of marigold and salvia bedding plants as affected by monochromic or mixture radiation provided by a Light- Emitting Diode (LED). Plant Growth Regul 38: Heo JW, Shin KS, Paek KY Light quality affects in vitro growth of grape Teleki 5BB7. J Plant Biol 49: Jeong JH, Kim YS, Moon HK, Hwang SJ, Choi YE Effects of LED on growth, morphogenesis and eleutheroside contents of in vitro cultured plantlets of Elutherococcus senticocus Maxim. Korean J Medicinal Crop Sci 17(1):39-45 Kartsonas E, Papafotiou M Mother plant age and seasonal influence on in vitro propagation of Quercus euboica Pap., an endemic, rare and endangered oak species of Greece. Plant Cell Tiss Org Cult 90: Kim HH, Goins GD, Wheeler RM, Sager JC. 2004a. Green light supplementation for enhanced lettuce growth under red and blue light emitting diodes. HortSci 39: Kim HH, Goins GD, Wheeler RM, Sager JC. 2004b. Stomatal conductance of lettuce grown under or exposed to different light qualities. Ann Bot 94: Kim HH, Goins GD, Wheeler RM, Sager JC. 2004c. Effects of LEDs on net photosynthetic rate, growth and leaf stomata of Chrysanthemum plantlets in vitro. Sci Hortic 101: Kozai T, Watanabe K and Jeong BR Stem elongation and growth of Solanum tuberosum L. in vitro in response to photosynthetic photon flux, photoperiod and difference in photoperiod and dark period temperatures. Sci Horticul 64:1-9 Lee TB Studies on conservation of endemic species- Abeliophyllum distichum N. Nature Conservation 12:6-10 Lee TB Conservation of threatened plants in Korea. Bull Kwanak Arboretum 3: Lee SW, Kim GS, Lee MJ, Hyun DY, Park CG, Park HK and Cha SW Effect of blue and yellow polyethylene shading net

40 J Plant Biotechnol (2014) 41: on growth characteristics and ginsenoside contenets in Panax ginseng C. A. Meyer. Korean J Med Crop Sci 15: Lian ML, Murthy HN and Paek KY Effects of light emitting diodes (LEDs) on the in vitro induction and growth of bulblets of Lilium oriental hybrid Pesaro. Sci Horticul 94: Lin Y, Li J, Li B, He T, Chun Z Effects of light quality on growth and development of protocorm-like bodies of Dendrobium officinale in vitro. Plant Cell Tiss Org Cult 105: Moon HK and Park SY Effect of different light sources and ventilation on in vitro shoot growth and rooting of a rare and endangered species, Tsuru-rindo (Tripterospermon japonicum). J Plant Biotech 35: Moon HK, Park SY, Kim YW and Kim CS Growth of Tsuru-rindo (Tripterospermum japonicum) cultured in vitro under various sources of light-emitting diode (LED) irradiation. J Plant Biol 49: Moon HK, Suk GY, Kwon YJ, Son SH Micropropagation of a rare species, Abeliophyllum distichum Nakai. via axillary bud culture. Korean J Plant Tiss Cult 26(2): Morrow RC LED lighting in horticulture. HortSci 43: Muleo R., Morini S, Casano S Photoregulation of growth and branching of plum shoots: physiological action of two photosystems. In Vitro Cell Dev Biol-Plant 37: Muleo R., Morini S Light quality regulates shoot cluster growth and development of MM 106 apple genotype in in vitro culture. Sci Hort 108(4): Murashige T, Skoog F A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: Nhut DT, Hong LTA, Watanabe H, Goi M, Tanaka M Growth of banana plantlets cultured in vitro under red and blue light-emitting diode (LED) irradiation source. Acta Hort 575:7-23 Nhut DT, Takamura T, Watanabe H, Okamoto K, Tanaka M Response of strawberry plantlets cultured in vitro under superbright red and blue light-emitting diodes (LEDs). Plant Cell Tiss Org Cult 73:43-52 Park SY, Ahn JK, Lee WY High frequency shoot induction from root segments of Albizzia coreana. J Kor For Soc 92(6): Seabrook JEA Light effects on the growth and morphogenesis of potato (Solanum tuberosum) in vitro: a review. Amer J Potato Res 82: Shin KS, Murthy HN, Heo JW, Hahn EJ, Paek KY The effect of light quality on the growth and develop of in vitro cultured Doritaenopsis plants. Acta Physiol Plant 30: Youn Y, Lee SK, Park JI In vitro propagation of a rare species-berchemia berchemiaefolia. Res Rep For Gen Res Inst Kor 28:63-67

41 J Plant Biotechnol (2014) 41: DOI: ISSN Research Article 희귀식물제주황기의미세번식 한무석 노설아 곽명철 문흥규 Micropropagation of a rare plant species, Astragalus membranaceus Bunge var. alpinus N. Mu Seok Han Seol Ah Noh Myung Cheol Kwak Heung Kyu Moon Received: 2 June 2014 / Revised: 14 June 2014 / Accepted: 26 June 2014 c Korean Society for Plant Biotechnology Abstract In order to develop an efficient in vitro micropropagation technique for a rare plant species, Astragalus membranaceus Bunge var. alpinus N., shoot proliferation and in vitro or in vivo rootings were conducted and hyperhydrated leaf generated from cultures was histologically observed. During shoot induction, no distinct effect on multiple shoot induction was found between BA and kinetin treatment. BA enhanced the number of internodes, whereas kinetin stimulated shoot elongation. Hyperhydrated leaf composed of bigger cells and retarded palisade parenchyma and showed irregular cell arrangement compared to normal leaf. Especially starch content in hyperhydrated leaf was significantly reduced. The best rooting rate was achieved by B5 medium among three different medium (B5, MS and WPM) and 0.1mg/L IBA treatment induced the highest rooting ratio (80%). No statistical difference was induced by explant types (apical bud or axillary bud) in terms of rooting ratio. In vivo cutting induced rooting rate up to 65% by 0.5% IBA/Talc powder treatment. Although in vivo rooting rate was less efficient compared to in vitro rooting, better survival rate was observed after soil acclimatization. Present study M. S. Han 국립산림품종관리센터 (Korea Forest Seed & Variety Center, Chungju Suanbo Korea) S. A. Noh H. K. Moon ( ) 국립산림과학원 (Korea Forest Research Institute, Suwon Korea) hkmoon@forest.go.kr M. C. Kwak 경기도산림환경연구소 (Gyounggido Forestry Environment Research Center, Osan Korea) suggested that above micropropagation techniques can be used for rapid multiplication as well as in vitro or in vivo conservation of the species. Keywords Shoot proliferation, In vitro or in vivo rooting, Hyperhydration, Histological comparison 서론 콩과에속하는제주황기 (Astragalus membranaceus Bunge var. alpinus N) 는다년생초본식물로한라산해발 1,600 m 이상의고산지대에드물게자라는제주특산식물가운데하나이다. 키는 10 ~ 30 cm 정도자라며꽃은 7 월에서 8 월까지황백색으로핀다. 9 월에익는열매는협과 ( 꼬투리로맺히는과실 ) 로잔털이있으며, 긴타원형인꼬투리에보통 2 개의종자가들어있다 (Lee 1993). 우리나라에는황기 (Astragalus membranaceus B.), 제주황기 (A. membranaceus var. alpinus N.) 등 6 종 3 변종이있으며, 황기와제주황기가약용으로쓰인다 (Toh CA 1971). 황기는면역촉진, 간장보호제, 발한억제제, 이뇨제, 신장염, 당뇨병, 백혈병, 암의치료제로전통적인의약품으로사용되어왔으며 (Erison et al. 2010), 여러종이의약용껌 (gum) 의생산과직물산업에사용되었다. 일부종은마초 (forage) 의생산에도이용되었으며, A. cicer 의마초의질은알팔파와비슷한것으로보고되었다 (Towsend 1970). 국내에서도황기는예로부터강장 ( 强壯 ), 익기 ( 益氣 ), 지한 ( 止汗 ), 소종 ( 消腫 ) 등에효능이있어한방에서뿌리를약재로사용하였으며 (Baek NI et al. 1996), 주로중부지역에서재배되고있다. 최근들어삼계탕등보양식의수요가많아지면서 1 년

42 J Plant Biotechnol (2014) 41: 근을수확하기때문에종자의수요가급증하고있으나. 황기는습해에약하여강우가많은해에는대부분고사되기때문에종자채취가매우어렵다. 또한단명종자로채종후 1 년이상이경과하면종자의발아율이현저히감소하는단점도있다 (Kim YG et al. 2001a and references). 황기는두과식물중에서경실종자이므로기계적휴면을하여, 녹협기에는발아율이 90% 이상이나황협기에는 20% 정도로낮아지며, 등숙이진전되어종피가경화될수록발아율은낮아진다. 또한저장기간이길어지거나환경이나빠지면경화종자가증가하고활력이떨어지는것으로보고되었다 (Kim YG et al. 2011a, b). 황기는약용식물로널리재배되어왔기때문에일반적인번식및재배기술이확립되어있으나, 제주황기는한라산에서만분포하는특성으로인해아직까지뚜렷한증식방법조차구명되지못하고있다. 또한고산지대에서만자라기때문에산림생태계의훼손으로인해멸종위기에직면할수있는식물가운데하나로산림청에서지정보호하고있다 (Lee YM and Lee WY 1997). 따라서한라산에서만특이적으로자생하는특산식물인제주황기의기내증식방법의확립은산림유전자원의확보차원뿐만아니라자생지복원측면에서도중요한내용이다. 조직배양기술은소멸해가는유전자원의증식및보존방법으로유용한수단이되어왔으며 (Faisal et al. 2007; Kartonas and Papafotiou 2007), 국내에서도여러수종에서연구가발표되었다 (Youn et al. 1992; Moon et al. 1997, 1999, 2008; Han et al. 2004, 2010). 외국에서는몇종류의황기에대한조직배양결과가발표된바있으나 (Hou and Jia, 2004; Erisen et al., 2010) 아직까지제주황기의조직배양기술은확립되어있지않다. 본연구는자생지에서멸종위기에처해있는제주황기의자생지복원및유전자원의보존을목적으로기내번식방법을개발하고자하였다. 재료및방법 식물재료 국립산림과학원난아열대연구소로부터분양받은제주황기종자를시료로사용하였다. 종자는 4 C 에저온저장하였다가수돗물에 24 시간침지하여최아 ( 催芽 ) 를촉진시킨다음기내파종하였다. 종자의표면살균은무균상에서 70% 에탄올로 1 분, 2% 의차아염소산나트륨 (2% NaClO) 로 10 분동안침지시킨후멸균증류수로 4 ~5 회세척하였다. 소독된종자를 MS (Murashige and Skoog 1962) 기본배지에서발아시키고 4 ~5 주간의계대배양주기로 2 년이상유지하였다. 줄기증식 절편은액아마디를약 2 cm 길이로절단하여 MS 배지에 BA 및 kinetin 을각각농도별 (0, 0.1, 0.5, 1.0, 2.0 및 5.0 mg/ l) 로처리하여증식시험하였다 (Fig. 1). 배지는 mm 의유리시험관에 8 ml 씩분주하여 121 C 에서 20 분간고압멸균후사용하였다. 절편은처리당 10 점씩치상하여 3 반복하였다. 배양은 1 일 16 시간조명 (40 μm m -2 s -1 ), 25±2 C 로유지되는배양실에서실시하였다. 4 주간배양후신초가 0.5 cm 이상자란것을정상줄기로다경및길이를측정하였다. 이하의실험에서배지의준비와배양환경은동일하게실시하였다. 기내및기외발근유도 기내발근을위하여잎의발달이양호한건전한줄기를발근재료로사용하였다. 적정기내발근배지를구명하기위하여 B5 (Gamborg et al., 1968), MS 및 WPM (Lloyd G. and McCown B., 1981) 기본배지 (sucrose 3%, gelrite 0.3%) 를사용하였다. 다음발근적정배지로선정된 B5 배지에 IBA 를농도별 (0, 0.1, 0.2 및 0.5 mg/l) 처리하고정아지및액아지를절편으로발근에미치는 IBA 농도및절편체위치효과를조사하였다 (Fig. 3). 절편은 IBA 농도별및절편체위치별로 20 점씩 2 반복을두었다. 배양 4 주후성적조사를실시하여뿌리가 1 개이상나온것을발근된것으로간주하고뿌리수및길이를측정하였다. 발근식물체는수돗물로 agar 를조심스럽게제거하고인공배양토 (peatmoss: perlite: vermiculite = 1:1:1,v/v/v) 에이식하여순화실에서순화하였다. 한편기외발근유도는정아지가있는건전한줄기를절편으로시험하였다. 기외삽목은 Kwon 등 (1994) 의방법을다소변형하여 3 ~4 cm 길이의줄기절단하부에 IBA/Talc 를 0, 0.5, 1.0 및 2.0% 로분의 ( 粉衣 ) 처리한다음인공혼합상토 (peatmoss : perlite : vermiculite=1:1:1, v/v/v) 에이식하였다. 삽목후충분히관수하고 1 일 16 시간조명 (20μ mol m -2 s -1 ), 온도 25±2 C 로유지되는순화실에서 6 주간공중습도를높게유지하면서배양하였다. 6 주후발근율을조사하였다. 세포조직학적분석 기내줄기증식과정에서나타나는과수화 (hyperhydration) 를관찰하기위하여정상적인잎과과수화된잎의조직검경을통해세포구조를비교관찰하였다. 조직검경은 Yeung (1999) 의방법을따랐다. 조직의샘플고정은 2.5% glutaraldehyde 와 1.6% paraformaldehyde buffer, 0.05M phosphate buffer (ph 6.8) 에 4 C 에서 24 시간고정하였다. 다음알코올시리

43 102 J Plant Biotechnol (2014) 41: 즈로탈수시키고 Technovit 7100 (Kulzer, Germany) 으로포매하였다. 절삭은 Reichert-Jung 2040 Autocut rotary microtome 의유리칼로 3 µm 두께로수행하였다. 이절편을 toluidine blue O 로염색하여 Leica DMR 광학현미경으로관찰하고 IM-50 software 를이용디지털카메라 (Leica DC 300F) 로촬영하였다. 최소 15 개의절편을비교하여조사하였다. 통계분석 본실험의모든데이터는통계프로그램 SPSS 12.0 을이용하여산출하였다. 각처리간유의성검정을위해서는 one-way ANOVA 를실시하였고, 유의성이있는경우 Duncan s multiple range test 로차후검증을실시하였다. 통계적유의성은 P < 0.05 로설정하여분석하였다. 결과및고찰 기내발아 MS 배지에치상된종자는배양후 5 일경부터발아하기시작하였고, 줄기신장이신속하게이루어졌으나 4 주후의발아율이 23% 로저조하였다 (data 미제시 ). Erisen 등 (2010) 은 A. cariensis 의기내배양에서종피 (seed coat) 무처리종자는 10% 정도발아되고종피를절단한종자는 100% 발아된다고하여종피의절단처리가발아의주요요인이라고하였다. 제주황기의저조한발아율은종피문제로인한기계적발아억제로추정되며, 차후발아율향상을위하여종피처리실험이수행되어야할것으로사료된다. 증식에미치는 BA 및 kinetin 효과 액아마디를절편으로 BA 와 kinetin 을각각농도별로처리하여배양한결과는 Figure 1 과같다. 제주황기는정아우세현상이뚜렷하여모든처리구에서절편당한개의줄기가유도되었고간혹 2 개의줄기로자라는것이관찰되었다. 따라서제주황기의기내증식은다경유도를통한증식보다는마디절편으로나누어증식함이효과적인것으로나타났다. 전반적으로 BA 는줄기마디수의형성을촉진한반면 kinetin 은줄기의신장을촉진하는경향을보였다 (Fig. 1). 기내배양에서싸이토키닌 (cytokinin) 은정아의생장을억제하여측아의발달을촉진하여다경유도를하는것으로알려져있으며, 특히 BA 는활성이높아다양한식물의기내증식에많이사용되어왔다 (George, 1993). 하지만제주황기에서는 BA 및 Kinetin 처리로다경줄기가유도되지않아식물종에따른차이를보여주었다. Fig. 1 Effect of cytokinins on shoot proliferation of Astragalus membranaceus Bunge var. alpinus N. Data were collected from the in vitro grown shoots after 4 weeks in culture. The column show mean±se from three separate measurements of twenty individual shoots 줄기의신장에있어 BA 처리는 2.1 ~ 2.5 cm 의생장을보인반면 kinetin 처리시에는 1.9 ~ 3.9 cm 의생장을보였다. 특히 0.5 mg/l kinetin 처리시 3.9cm 로서가장좋은생장을보였다 (Fig. 1). 생장조절제무처리시는 2.4 cm 로 BA 처리와비슷한생장을보였다. 절간마디수에있어서는 BA 처리시 3.2 ~ 3.9 개, kinetin 처리시 2.6 ~ 3.0 개가형성된반면에 MS 기본배지에서는 2.8 개의절간마디가생성되었다. Moon 등 (1999) 은미선나무의기내증식에서절간마디를이용하는방법이효율적임을시사한바있는데, 이러한결과는제주황기에서도적용가능한방법으로나타났다. 한편증식중인식물체의일부잎에서과수화 (hyperhydration) 가관찰되었다. 과수화된잎은정상적인잎에비하여두껍고휘어져있으며투명하였다. 세포조직학적관찰결과과수화된잎은모든세포의크기가크고책상조직의발달이부진하였다. 또한, 정상적인잎에비하여책상조직과해면조직그리고표피세포모두불규칙하고세포간극의크기가큰것으로관찰되었으며세포내의전분축적량은현저히감소되어있었다. 또한잎의주맥 (main vein) 이중심에서다소옆으로벗어난곳에위치하였다 (Fig. 2). 이러한과수화된식물은정상적인기내증식을저해하고특히발근이어려운것으로나타나제주황기의기내배양시고려해야될내용으로생각되었다. 과수화현상은여

44 J Plant Biotechnol (2014) 41: Fig. 3 Effect of various medium on in vitro rooting. Data are the mean±se from 3 separate measurements of twenty individual plants. Mean(±SE) separation within column by Duncan s multiple rage test at P=0.05 Fig. 2 Anatomical comparison of normal leaf (A) and hyperhydrated leaf (B) derived from in vitro shoot of Astragalus membranaceus Bunge var. alpinus N. Bars are 200μm 러식물에서발근, 순화및생산성저하의주원인이되며 (Olmos and Hellín 1998; Jausoro et al. 2010), 배지의조성, 용기, 배양환경등의외부적요인에의하여빈번히발생하는것으로알려져있다 (Debergh et al. 1992). George (1993) 는과수화의억제를위한방법으로 1) 통기가잘되는배양용기의사용, 2) 발근유도시배양병의하단을차게 (cooling) 유지시키는방법, 3) Agar 등경화제의농도와 sucrose 등탄소원의농도를높이는방법, 4) Agar, gelrite 등서로다른경화제를사용하는방법, 5) 반고체배지를사용하는것보다액체배지에서다공성 (porus) 지지물을사용하여줄기를배양시키는방법을제시하였다. 제주황기의기내배양에서관찰된과수화는빈도가 10% 미만으로크게문제시되지는않았으나발근유도시에는발근이억제되었기때문에고려해야될내용으로생각된다. 기내발근유도 적정배지선정을위한발근시험결과는 Figure 3 과같다. 4 주간의배양결과 MS 배지는 6.7% 로발근율이저조했으며, WPM 은 33% 의발근율을나타냈다. B5 에서는가장좋은 43% 의발근율을보였다. 특히 B5 배지에서는다른두배지보다발근이 1 주이상빠르게이루어지는장점도 Fig. 4 Explant bud position (A- apical bud explant ;B- axillary bud explant) for in vitro rooting 있었고뿌리수도많아서제주황기의적정발근배지로생각되었다. 뿌리의형성은줄기기부에캘러스형성없이직근의형태로유도되었고, 뿌리수는 2 ~7 개로개체간차이가있었다. 한편발근개체는세근의발달이이루어지지않았고절편에따라서는발근부위가적색을띠기도하였다. 콩과식물인가시아카시아 (Acacia nilotica (L.) Willd. ex Del) 의기내발근에서 B5 배지가사용된바있으며 (Samake et al. 2011), Chen 등 (2014) 은애기장대와토마토의뿌리형성에 B5 배지가효과적이라고하였다. B5 배지조성이 MS 나 WPM 와다른특징은비타민 Thiamine HCl 의함량이 10 배가량높다는것인데, 이러한함량변화가콩과식물인제주황기의발근에중요한영향을미쳤으리라추정된다.

45 104 J Plant Biotechnol (2014) 41: Fig. 5 Induction of in vitro root by different IBA treatment IBA 농도및절편체위치효과 IBA 농도및절편의위치에따른발근시험결과는 Figure 6 과같다. 발근율은 IBA 처리농도및절편체의위치에따라차이가있어 40 ~ 80% 까지발근율차이를보였다. 발근은 0.1 mg/l IBA 조건에서가장좋았으며, 이농도에서뿌리수및뿌리의생장이가장양호하였다. 다른농도에서는무처리와비교하여발근에통계적인유의차가없었으나뿌리수및뿌리의생장은 IBA 처리및절편위치에따라차이를보였다 (Fig. 5, 6). 따라서제주황기의기내발근은 0.1 mg/l IBA 처리가적정조건으로나타났다. 기내발근에영향하는오옥신의효과는다수의식물에서보고된바있으며, 여러종류의황기기내배양에서도관찰되었다. A. polemoniacus 는 MS 기본배지혹은 2.0 mg/l 처리에서 (Mirici 2004), A. cicer 은 1/2 MS+0.25 ~ 0.5 mg/l NAA 를 (Basalma et al. 2008), A. adsurgens 는 1/2 MS+0.2 ~ 1.0 mg/l NAA 처리가효과적인것으로보고하였다. Uranbey 등 (2003) 은 A. cicer 에서 1/2 MS+1.0 mg/l NAA 처리로 40% 의발근을보고하였고, A. cariensis 에서는 MS+0.5 mg/l IBA 가적정발근조건으로나타나식물에따른차이를보여주었다 (Erisen et al. 2010). 한편 Hou 와 Jia (2004) 는 A. melilotoides 의기내배양에서 IBA 가 NAA 보다발근에효과적이며, MS uM IBA 처리로 81% 의발근율을얻었다고하였다. 이러한결과들은황기의종류에따라적정배지및오옥신의처리조건이다름을보여주는것이다. 한편제주황기의기내발근은앞서언급했듯이과수화된줄기를피하고건전한줄기를사용하여 B5 배지에저농도 IBA 처리로효과적인기내발근이가능하다고생각된다. Fig. 6 Effect of shoot position and IBA on in vitro rooting of Astragalus membranaceus Bunge var. alpinus N. A-apical bud explant; B-axillary bud explant. Data are the mean±se from 3 separate measurements of twenty individual plants. Mean(±SE) separation within column by Duncan s multiple rage test at P=0.05 기외발근유도 정아가있는건전한줄기를재료로 IBA 농도별분의처리후기외삽목한결과는 Figure 7 과같다. 발근율은무처리에서 57%, 0.5% IBA 처리시 65% 까지발근되었으며, Fig. 7 Effect of different IBA levels influencing on ex vitro rooting. The same letters are not significantly different according to Duncan s multiple range test at P=0.05