대한소아치과학회지 35(3) 2008 을알아내는데중요한역할을할수있다. 또한치주질환을진단하고적절히치료하는데치주질환원인균의양을비교조사하는것은치주질환에있어서세균의역할을이해하는데중요하다고할수있다. 전통적중합효소연쇄반응과 real-time PCR을이용한연구에서타액과치은연하치태에

Size: px
Start display at page:

Download "대한소아치과학회지 35(3) 2008 을알아내는데중요한역할을할수있다. 또한치주질환을진단하고적절히치료하는데치주질환원인균의양을비교조사하는것은치주질환에있어서세균의역할을이해하는데중요하다고할수있다. 전통적중합효소연쇄반응과 real-time PCR을이용한연구에서타액과치은연하치태에"

Transcription

1 J Korean Acad Pediatr Dent 35(3) 2008 Real-time PCR 을이용한치주질환원인균의정량적분석 김선미 양규호 최남기 강미선 * 오종석 * 전남대학교치의학전문대학원소아치과학교실및치의학연구소및 2 단계 BK21, * 의과대학미생물학교실 국문초록 Real-time PCR 기법을이용하여구강내치태에서특정세균의존재여부를알수있을뿐아니라정량적분석이가능하게되었다. 이연구는 real-time PCR 기법을이용하여 8-18세의청소년에서치주질환원인균의조성을알아보고자전신질환이없는어린이및청소년 65명을대상으로치은연하의치태를채취하여 5종의치주질환원인균의출현율과그양을측정하고, 또한함께측정한치태지수및치은지수와의상관관계를조사하여다음과같은결론을얻었다. 1. 치태지수의평균은 1.33이었으며, 치은지수의평균은 0.97이었다. 치태지수는나이가증가할수록낮아졌다 (p<0.05). 2. 치주질환원인균의출현율은 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4%, F. nucleatum은 100% 였다. P. gingivalis, T. denticola는 10세이후출현율이증가하였고 A. actinomycetemcomitans는 8-10세군에서출현율이높았다 (p<0.05). 3. 정량적분석에서치태지수와치은지수는 F. nucleatum의양과유의한상관성이있었으며, 치태지수는치은지수와유의한상관성이있었다. T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며, T. denticola양과 A. actinomycetemcomitans도강한상관관계를가지고있었다. 주요어 : 치주질환원인균, Real-time PCR, 치태지수, 치은지수 Ⅰ. 서론치주질환은구강내에존재하는치주질환원인균및이세균들이생성하는독소들에의해서치주조직이파괴되는염증성질환이다. 구강내에는많은세균이존재하고있으나이들모든세균이치주질환에관여하지는않는다. 국소적공격형치주염과관련이있는세균은 Actinobacillus actinomycetemcomitans 1), 성인의치주질환에중요한역할을하는원인균은 red complex로분류되는 Porphyromonas gingivalis, Tannerella forsythia(bacteroides forsythus), Treponema denticola와 orange complex의하나인 Fusobacterium nucleatum 등으로알려져있다 2). 이러한치주질환원인균을발견하기위한전통적인세균배양방법은치주질환여부와관계없이 발견되지않는경우도있었다 3,4). 그러나 1990년대중반부터는분자생물학의발전으로 개의세균만있어도검출이가능한중합효소연쇄반응 (Polymerase chain reaction, PCR) 이사용되고있다. 중합효소연쇄반응은세균특이성이있는 primer를이용하여적은수의세균이있을지라도쉽게검출할수있는유용한방법으로이를이용하여구강내치태나타액으로부터직접세균을검출할수있게되었고, 치주질환원인균에대한연구가많이이루어지고있다 5-8). 하지만중합효소연쇄반응은중합반응의최종단계를알아내는것으로존재여부를조사할수있지만정량적계산은어렵다. 최근에는 real-time PCR이이용되고있는데이는지수적증식단계를조사함으로써원인균의존재여부를알수있을뿐아니라정량적분석이가능하게되었다. 이러한정량적분석은치주낭내세균의조성 교신저자 : 김선미 광주광역시동구학동 8 번지 / 전남대학교병원소아치과학교실 / Tel: / smkim1406@hanmail.net 원고접수일 : 2008 년 3 월 11 일 / 원고최종수정일 : 2008 년 4 월 21 일 / 원고채택일 : 2008 년 4 월 28 일 494

2 대한소아치과학회지 35(3) 2008 을알아내는데중요한역할을할수있다. 또한치주질환을진단하고적절히치료하는데치주질환원인균의양을비교조사하는것은치주질환에있어서세균의역할을이해하는데중요하다고할수있다. 전통적중합효소연쇄반응과 real-time PCR을이용한연구에서타액과치은연하치태에서치주세균의출현율은높은일치성을보였고, real-time PCR은 40분정도시간이단축되었다고보고하고있다 9). 치주상태와 P. gingivalis의관계에대해 real-time PCR을이용한연구에서치주낭의깊이와세균의양은상관성이있었으며, 치주치료후이세균의양이유의하게감소함이보고되었다 10). 이들보고들을통해치주상태의평가에 real-time PCR을이용한세균의절대적양및상대적양을측정하는것이필요하다고할수있다. 건강한정상의어린이에서치주질환으로치주조직이파괴되는경우는드물다 11). 하지만치주질환의병력이있던어린이는결국청소년기를지나성인이되어서다시치주질환을가지게될가능성이높다 12,13). 이는유치열에존재했던치주질환원인균들이치주조직에잔존하여새롭게영구치열이형성될때재집락을이루기때문이라고추정되고있다 14). 어린이및청소년의치은연하치태에서치주질환원인균의양을측정하는것은추후치주질환의예측및진단, 그리고치료효과의평가에기여할수있다. 따라서이연구는어린이및청소년의구강내치태에서 P. gingivalis, T. forsythia, T. denticola, A. actinomycetemcomitans, F. nucleatum 등 5종의치주질환원인균을 realtime PCR을이용하여출현율과양을측정하고, 측정한치태지수및치은염과의상관관계를조사하여상관성을평가해보고자하였다. Ⅱ. 연구대상및방법 1. 연구대상 2. 연구방법 1) 치태지수와치은지수의검사구강위생상태를측정하기위해서치태지수 (Plaque index of Silness and Loë) 15) 를사용하였으며측정부위는상악좌우제1대구치의협측, 상악우측중절치와하악좌측중절치의순측, 하악좌우제1대구치의설측이었다. 제 1대구치가없는경우는인접제 2유구치나제 2 소구치를검사하였다. 치태침착정도는 0-3점 (0점: 치태가없음, 1점 : 치은변연을따라탐침시묻어나는정도, 2점 : 눈에보이는상태, 3점 : 치태가많은경우 ) 으로구분하였다. 치주조직의염증상태를측정하기위해치은지수 (Gingival index of Loë) 16) 를사용하였으며, 조사치아는치태지수와같다. 탐침부위는해당면의근심, 중앙, 원심세부위였다. 치은염의정도는 0-3점 (0점: 염증소견이없음, 1 점 : 약간의발적과부종, 2점 : 탐침후출혈을동반한발적과부종, 3점 : 자연출혈을동반한염증 ) 으로구분하였다. 2) 치주질환원인균의검사 (1) 치태채취치태시료를얻기위해대상자의하악우측제1대구치또는제2유구치의근심협측부위에서멸균된이쑤시개를사용하여조심스럽게치은부위의치태를채취하였다. 채취한치태는멸균된 0.2 ml phosphate-buffered saline (PBS) 이들어있는 1.5 ml tube에수집한후 DNA 추출을위해실험실로옮겨 4 에보관하였다. (2) 치태내치주세균의 DNA 추출시료를원심분리 (12,000 rpm, 2 min) 한후다시 0.1 ml cell lysis buffer (1.0% Triton X-100, 20 mm Tris-HCl, 2 mm ethylenediaminetetraacetic acid, ph 8.0) 로현탁하고 100 에서 10분간끓여서 DNA를추출한다. 본연구대상으로는초, 중, 고교에재학중이며전신질환이없는학생 65( 남자 32명, 여자 33명 ) 명을조사대상으로하였다. 연구대상의평균연령은 12.6세였으며연령범주는혼합치열기, 영구치열기등을고려하여 4개의범주로구분하였다 (Table 1). Table 1. The distribution of the study subjects Age(year) Male Female Total (3) real-time PCR PCR 조건의표준화를위해 5종류의혐기성세균을각각의배지에혐기적으로배양한후표준균주의세균수를측정한후시료와같은방법으로 1 ml를튜브에취하여원심한후 PBS로 2 회세척하고 PBS 0.1 ml로 suspension하여 10배농축시킨후 DNA를추출한다음 10 2 ~10 8 까지 10배씩연속적으로희석하여 real-time PCR 정량에필요한표준곡선을작성하였다. 5종세균의 sense primer와 antisense primer (400 nm) 각각 1 μl, dual labelled probe (5 -FAM, BHQ-3') 가이용되었다 17) (Table 2). template DNA 3 μl에 2배의 QuantiTect Probe(Qiagen GmbH, Hilden, Germany) 12.5 μl, PCR Master Mix(HotStarTaq polymerase, QuantiTec Probe PCR buffer, dntp mix including dutp, 발색제 ROX TM, 8mM MgCl2), 3차멸균수를 6.5 μl첨가하여최종용량 25 μl가되게하였다. 그리고 36 well에분주하고 Rotor-Gene 495

3 J Korean Acad Pediatr Dent 35(3) Real-time Thermal Cycler (Corbett research, Sydney, Australia) 를이용하여중합효소연쇄반응을시행하였다. 이때사용한 real-time PCR의조건은최초변성을위해 95 에서 15분간, 이후 45번의중합효소연쇄반응 cycle은 95 에서 15초, 58 에서 1분간시행하였다. 데이터분석은 Rotor-Gene analysis software version 6.0을이용하였다. Cycle threshold (CT) 는알려진숫자의 DNA농도의대수기에서시작하며, 세균수에대한표준곡선에의해서시료당세균수가측정이되었다 (Fig. 1, 2). 3) 통계분석위데이터는 SPSS 12.0을이용하여통계학적평가를시행하였다. 치태지수와치은지수를나이군에대해서비교하기위해 ANOVA를시행하였고, 사후검정으로 Tukey s studentized range test를시행하였다. 치주질환원인균의연령에따른출현율을비교하기위해카이제곱검정을시행하였다. 그리고치태지수, 치은지수와치주질환원인균의상관성을조사하기위해 Pearson 상관계수를계산하였다. Table 2. Oligonucleotide primers and probes used for real-time PCR Oligonucleotide Primers and probes Sequences (5 to 3 ) Amplicon size (bp) P. gingivalis TACCCATCGTCGCCTTGGT (1198-F) 126 CGGACTAAAACCGCATACACTTG (1323-R) Pg 1238T FAM-GCTAATGGGACGCATGCCTATCTTACAGCT-BHQ T. forsythia ATCCTGGCTCAGGATGAACG (18-F) 225 TACGCATACCCATCCGCAA (243-R) Tf 124T FAM-ATGTAACCTGCCCGCAACAGAGGGATAAC-BHQ T. denticola AGAGCAAGCTCTCCCTTACCGT (1394-F) 105 TAAGGGCGGCTTGAAATAATGA (1498-R) Td 1444T FAM-CAGCGTTCGTTCTGAGCCAGGATCA-BHQ F. nucleatum CGCAGAAGGTGAAAGTCCTGTAT (619-F) 99 TGGTCCTCACTGATTCACACAGA(719-R) Fn 663T FAM-ACTTTGCTCCCAAGTAACATGGAACACGAG-BHQ A. actinomycetemcomitans CAGCATCTGCGATCCCTGTA (1956-F) 147 TCAGCCCTTTGTCTTTCCTAGGT (2102-R) Aa 2034 FAM-TCGAGTATTCCTCAAGCATTCTCGCACG-BHQ P. gingivalis: Porphyromonas gingivalis, T. forsythia: Tannerella forsythia, T. denticola: Treponema denticola, F. nucleatum: Fusobacterium nucleatum, A. actinomycetemcomitans: Actinobacillus actinomycetemcomitans Fig. 1. Amplification of profiles for P. gingivalis-specific PCR products. Fig. 2. Standard curve was generated from the amplication plot of P. gingivalis. A suspension of P. gingivalis cells was serially diluted and subjected to real-time PCR. 496

4 대한소아치과학회지 35(3) 2008 Ⅲ. 연구성적 1. 치태지수와치은지수 (Table 3) 치태지수의전체평균은 1.33이었다. 나이가증가할수록치태지수가낮아지는양상이었다 (p<0.05). 치은지수의전체평균은 0.97이었다. 2. 치주질환원인균의출현율 real-time PCR을이용한치주질환원인균의출현율은 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4% 를나타내었다. 각균의연령별비교를보면 F. nucleatum은모든연령에서 100% 의출현율을보였다. P. gingivalis, T. denticola는 10 세이후출현율이증가하는양상을보였고 A. actinomycetemcomitans는어린연령군에서더많이출현하였다 (p<0.05) (Table 4). 3. 치주질환원인균의정량적조사 real-time PCR을이용한치주질환원인균의양적검사에서 F. nucleatum은모든대상자에서많은수의세균이분포하였으며다른세균보다더많은양이관찰되었다. A. actinomycetemcomitans는 출현율도적을뿐아니라양도적게분포하였다. 어린나이군부터치주질환원인균들이다양하게분포하고있었으나, 나이가증가함에따라조사한 5종의치주질환원인균의양은유의한차이를보이지않았다 (p>0.05). 한편 P. gingivalis와 T. forsythia가함께출현하는비율은 33% 였으며, T. forsythia와 T. denticola가함께출현하는경우는 20%, P. gingivalis와 T. denticola가함께출현하는경우는 18%, red complex로분류되는세종류의세균이모두출현한경우가 12% 였다 (Table 5). 4. 치주질환세균의양과치태지수, 치은지수와의상관성치태의침착정도를나타내는치태지수는 F. nucleatum의양과유의한상관성이있었으며 ( 상관계수 0.46), 치은염을나타내는치은지수또한 F. nucleatum의양과유의한상관성이있었다 ( 상관계수 0.3). 치태지수는치은지수와유의한상관성이있었다 ( 상관계수 0.7). T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며 ( 상관계수 0.81, 0.79), T. denticola양과 A. actinomectemcomitans도강한상관관계를가지고있었다 ( 상관계수 0.92). 연령별로는 11-13세군에서 P. gingivalis가 T. forsythia, T. denticola A. actinomycetemcomitans의양과강한상관관계를보이고있었다 ( 상관계수 0.94, 0.99, 0.99)(p<0.05). Table 3. Plaque index and gingival index of study population Age (year) Plaque index Gingival index Total Table 4. Prevalence of periodontopathic bacteria found in subjects(%) Age (year) P. gingivalis T. forsythia T. denticola F. nucleatum A. actinomycetem comitans * * * Total 61.5% 53.8% 29.2% 100%` 15.4% * p<0.05 P. gingivalis: Porphyromonas gingivalis, T. forsythia: Tannerella forsythia, T. denticola: Treponema denticola, F. nucleatum: Fusobacterium nucleatum, A. actinomycetemcomitans: Actinobacillus actinomycetemcomitans 497

5 J Korean Acad Pediatr Dent 35(3) 2008 Table 5. Amount of periodontopathic bacteria in the subgingival plaque real-time- PCR sample P. gingivalis T. forsythia T. denticola F. nucleatum A. actinomycetem -comitans P. gingivalis: Porphyromonas gingivalis, T. forsythia: Tannerella forsythia, T. denticola: Treponema denticola, F. nucleatum: Fusobacterium nucleatum, A. actinomycetemcomitans: Actinobacillus actinomycetemcomitans 498

6 대한소아치과학회지 35(3) 2008 Ⅳ. 총괄및고찰건강한치주조직에비하여치주병소에서흔히나타나는미생물들이치주질환병원균으로제시되어왔으며, 이러한병원균이군집한부위에서는치주파괴의위험이증가한다. 유년형치주염환자나성인형치주염환자의병소에서발견되는세균은같은사람의건강한부위에서나건강한사람에서는낮은비율로나타났다 18,19). 따라서치주질환의적절한치료를위해서는치태내특정병원균을알고이를제거하거나감소시키는것이필요하다. 치은연하치태는그람양성균과그람음성구균, 간균, 사상균으로구성되어있으며, 나선균과다양한편모를가진세균들이치태의하방성장을주도한다 20,21). 1996년세계치주학회에서는 A. actinomycetemcomitans, P. gingivalis, T. forsythia를파괴적치주질환을야기하는치주병원균으로규정하였다 22). A. actinomycetemcomitans는그람음성, 호이산화탄소성, 끝이둥근간균으로건강한상태의치주에서보다국소적유년형치주염, 사춘기전치주염에서증가함이보고되었다 1,23,24). P. gingivalis는그람음성, 혐기성, 비운동성의간균으로건강한사람이나치은염환자에서는드물고파괴성질환에서더많이나타나고특히치주질환이진행된환자에서더많이발견되었다 2,25). T. forsythia는그람음성, 혐기성, 방추형의다형성간균으로건강한부위나치은염부위보다파괴성치주질환또는치주농양부위에많이보이고비활동성병소보다는활동성병소에서더많이발견되었다 26,27). T. denticola는그람음성, 혐기성의활발한운동성을가진나선균으로건강한사람이나치은염환자보다는급성괴사성궤양성치주염에서그리고심한치주염환자에서더많이나타난다 28,29). F. nucleatum은그람음성, 혐기성, 방추형의간균으로치은연하치태에서가장흔히발견되는세균으로치주염을가진사람에게서널리퍼져있다 30). PCR에의한치주질환원인균의출현율을조사한연구를살펴보면 Ashimoto 등은치은염이있는어린이에서 P. gingivalis, T. forsythia, T. denticola, 그리고 A. actinomycetemcomitans가 8-14% 로출현한다고하였다 31). 한편 Kimura 등은 2-13세정상어린이에서치주질환의임상증상없이 A. actinomycetemcomitans 50%, T. forsythia 20% 가발견되었고 P. gingivalis와 T. denticola는발견되지않았다고하였다 32). Umeda 등 33) 은치주세균검사를시행하여어린이에서 P. gingivalis 8.9%, T. forsythia 42.9%, T. denticola 48.2%, A. actinomycetemcomitans가 1.8% 의빈도를보인다고보고하였다. 국내의정 34) 은 2-12세의어린이치주질환원인균을조사하여 P. gingivalis 95.7%, T. forsythia 44.3%, T. denticola 65.7%, A. actinomycetemcomitans가 20% 의빈도를보인다고보고하였다. 김등 35) 은다운증후군대상자에서 P. gingivalis 63%, T. forsythia 74.1%, T. denticola 40.7%, A. actinomycetemcomitans가 55.6% 의출현율을보인다고보고하였다. 치주질환의진단과추적조사에기여하는치주질환원인균의정성및정량적분석이최근에 real-time PCR을사용하여이루어지고있다 36-38). 전통적중합효소연쇄반응과 real-time PCR 두방법을비교한연구에서 Sakamoto 등은타액과치은연하치태에서 P. gingivalis, T. forsythia, T. denticola, A. actinomycetemcomitans등의치주세균의출현율에있어서높은일치성을보였다고하였다 9). 한편 Yoshida 등은치주질환이있는환자의타액과치은연하치태에서 A. actinomycetemcomitans와 P. gingivalis의수를검사함으로써전통적중합효소연쇄반응과 real-time PCR sensitivity를비교하였는데, real-time PCR이더민감했다고하였다 37). 본연구의 8-18세대상자의 real-timepcr을이용한연구에서는 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4% 를나타내어정등의보고보다낮았으나다른연구자들보다는높은출현율을보였는데대상자들의연령이증가된것과 real-time PCR이더민감한방법이라는주장도그이유의하나로설명할수있다. Suzuki 등 36) 은 T. forsythia와 F. nucleatum의치주낭내출현율과조성을평가했는데, 두균모두깊은치주낭에서잘자라며, 두균이서로공존관계를가진다고보고하였다. 본연구에서도 P. gingivalis 와 T. forsythia가함께출현하는비율은 33% 였으며, T. forsythia와 T. denticola가함께출현하는경우는 20%, P. gingivalis와 T. denticola가함께출현하는경우는 18%, red complex로분류되는세종류의세균이모두출현한경우가 12% 로나타나치주질환원인균들이서로공존하는양상을보였다. Kawada 등 10) 은치주상태와 P. gingivalis의관계에대해평가하였는데, 치주낭의깊이가 1mm 깊어질수록세균의수는 10배씩증가하였다고하였으며, 또한치주낭의깊이가증가할수록 P. gingivalis균의상대적양이 4.69% 증가하며, 치주치료후이세균의양이유의하게감소하였다고보고하였다. 이를통해치주치료를평가하는데있어치주상태와연관하여세균의절대적양및상대적양을측정하는것이중요하다고주장하였다. 본연구에서는치은지수와 F. nucleatum간에유의한상관성을보였고치태지수와치은지수간에상관성을보였는데이는 F. nucleatum의양이많을수록, 그리고치태가많이축적되어있을수록치은염이증가함을의미하였다. Asai 등 39) 은 T. denticola와치주낭의깊이가상관성이있음을보고하였고, Sawamoto 등 40) 도타액에서 P. gingivalis와 T. forsythia는건강한사람보다치주환자에서더많았으며, 초기치주치료후 P. gingivalis의수, 치주낭깊이, 탐침후출혈이감소함을보고하였다. T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며, T. denticola양과 A. actinomectemcomitans도강한상관관계를보이고있어이러한치주질환원인균의공존은추후치주질환을가지게될가능성을높일수있다고추정할수있다. 이상의연구인 real-time PCR을이용한치주질환원인균의정성및정량적검사를통해어린나이에서부터치주질환원인 499

7 J Korean Acad Pediatr Dent 35(3) 2008 균들이다양하게분포하고있음을알수있었다. 또한나이가증가함에따라치주질환원인균의출현율은증가하는양상이었으며, 연령에따른치주질환원인균의양에는유의한차이가없었지만치주질환원인균이서로상관성를가지고공존하고있음을발견하였다. 또한 F. nucleatum의양이많을수록, 그리고치태가많이축적되어있을수록치은염이증가함을나타내고있어, 추후청소년에서도정확한치주건강상태를평가함에있어 real-time PCR을이용한치주질환원인균의주기적인정성및정량적검사가도움이되리라사료된다. Ⅴ. 결론최근 real-time PCR 기법을이용하여구강내치태에서특정세균의존재여부를알수있을뿐아니라정량적분석이가능하게되었다. 이연구는 real-time PCR 기법을이용하여 8-18세의청소년에서치주질환원인균의조성을알아보고자전신질환이없는어린이및청소년 65( 남자 32명, 여자 33명 ) 명을대상으로치은연하의치태를채취하여 P. gingivalis, T. forsythia, T. denticola, A. actinomycetemcomitans, F. nucleatum 등 5종의치주질환원인균의출현율과그양을측정하고, 또한함께측정한치태지수및치은지수와의상관관계를조사하여다음과같은결론을얻었다. 1. 치태지수의평균은 1.33이었으며, 치은지수의평균은 0.97이었다. 치태지수는나이가증가할수록낮아졌다 (p<0.05). 2. 치주질환원인균의출현율은 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4%, F. nucleatum은 100% 의출현율을보였다. P. gingivalis, T. denticola는 10세이후출현율이증가하는양상을보였고 A. actinomycetemcomitans는어린연령군인 8-10세군에서출현율이높았다 (p<0.05). 3. 정량적분석에서 F. nucleatum은모든대상자에서다른세균보다많은양이관찰되었다. 연령에따른치주질환원인균의양에는유의한차이가없었지만치주질환원인균이서로상관성을가지고공존하고있었다. 4. 치태지수와치은지수는 F. nucleatum의양과유의한상관성이있었으며, 치태지수는치은지수와유의한상관성이있었다. T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며 ( 상관계수 0.81, 0.79), T. denticola양과 A. actinomycetemcomitans도강한상관관계를가지고있었다 ( 상관계수 0.92). 청소년의구강내치태에는치주질환을유발하는세균들이다양하게공존하고있었으며, 치은염을나타내는치은지수는치태지수와 F. nucleatum의양과유의한상관성이있었다. 참고문헌 1. Mandell RL : A longitudinal microbiological investigation of Actinobacillus actinomycetemcomitans and Eikenella corrodens in juvenile periodontitis. Infect Immun, 45: , Haffajee AD, Socransky SS : Microbial etiological agents of destructive periodontal diseases. Periodontol, 5:78-111, Frisken KW, Tagg JR, Laws AJ, et al. : Suspected periodontopathic microorganisms and their oral habitats in young children. Oral Microbiol Immunol, 2:60-64, Delaney JE, Kornman KS : Microbiology of subgingival plaque from children with localized prepubertal periodontitis. Oral Microbiol Immunol, 2:71-76, Slots J, Ashimoto A, Flynn MJ, et al. : Detection of putative periodontal pathogens in subgingival specimens by 16S ribosomal DNA amplification with the polymerase chain reaction. Clin Infect Dis, 20(2): , Conrads G, Mutters R, Fischer J, et al. : Reaction and dot-blot hybridization to monitor the distribution of oral pathogens within plaque samples of periodontally healthy individuals. J Periodontol, 67: , Watanabe K, Frommel TO : Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans and Treponema denticola detection in oral plaque samples using the polymerase chain reaction. J Clin Periodontol, 23: , Okada M, Hayashi F, Nagasaka N. : PCR detection of 5 putative periodontal pathogens in dental plaque samples from children 2 to 12 years of age. J Clin Periodontol, 28: , Sakamoto M, Takeuchi Y, Umeda M, et al. : Rapid detection and quantification of five periodontopathic bacteria by real-time PCR. Microbiol Immunol, 45:39-44, Kawada M, Yoshida A, Suzuki N, et al. : Prevalence of Porphyromonas gingivalis in relation to periodontal status assessed by real-time PCR. Oral Microbiol Immunol, 19: , Könönen E : Development of oral bacterial flora in young children. Ann Med, 32: ,

8 대한소아치과학회지 35(3) Sweeny EA, Alcoforado GAP, Nyman S, et al. : Prevalence and microbiology of localized prepubertal periodontitis. Oral Microbiol Immunol, 2:65-70, Sjödin B, Crossmer CG, Unell L, et al. : A retrospective radiographic study of alveolar bone loss in the primary dentition in patients with localized juvenile periodontitis. J Clin Periodontol, 16: , Watanabe K, Frommel TO : Detection of Porphyromonas gingivalis in oral plaque samples by use of the polymerase chain reaction. J Dent Res, 72: , Silness J, Löe H : Periodontal disease in pregnancy. Correlation between oral hygiene and periodontal condition. Acta Odontol Scand, 22: , Löe H : The gingival index, the plaque index and the retention index system. J Dent Res, 38: , Kato H, Yoshida A, Awano S, et al. : Quantitative detection of volatile sulfur compound producing microorganism in oral specimens using real-time PCR. Oral Dis, 11:67-71, Slots J : The predominant cultivable organisms in juvenile periodontitis. Scand J Dent Res, 84:1-10, Slots J : The predominant cultivable microflora of advanced periodontitis. Scand J Dent Res, 85: , Schroeder HE, De Boever J : The structure of microbial dental plaque. In: McHugh, W.D., ed. Dental plaque. Edinburgh: Livingstone, 49-74, Listgarten MA : Structure of the microbial flora associated with periodontal health and disease in man. A light and electron microscopic study. J Periodontol, 47:1-18, Consensus report. Anonymous. Periodontal diseases: Pathogenesis and microbial factors. Ann Periodontol, 1: , Slots J, Reynolds HS, Genco RJ : Actinobacillus actinomycetemcomitans in human periodontal disease: a cross-sectional microbiological investigation. Infect Immun, 29: , Newman MG, Socransky SS, Savitt ED, et al. : Studies of the microbiology of periodontosis. J Periodontol, 47: , Lopez NJ : Occurrence of Actinobacillus actimomycetemcomitans, Porphyromons gingivalis and Prevotella intermedia in progressing adult periodontitis. J Periodontol, 71: , Papapanou PN, Neiderud AM, Papadimitriou A, et al. : "Checkerboard" assessments of periodontal microbiota and their antibody responses: a case control study. J Periodontol, 71: , Lai CH, Listgarten MA, Shirakawa M, et al. : Bacteroides forsythus in adult gingivitis and periodontitis. Oral Microbiol and Immunol, 2: , Listgarten MA : Electron microscopic observations of the bacterial flora of acute necrotizing ulcerative gingivitis. J Periodontol, 36: , Simonson LG, Robinson PJ, Pranger RJ, et al. : Quantitative relationship of Treponema denticola to severity of periodontal disease. Infect Immun, 56: , Dzink JL, Tanner ACR, Haffajee AD, et al. : Gramnegative species associated with active destructive periodontal lesions. J Clin Periodontol, 12: , Ashimoto A, Chen C, Bakker I, et al. : Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol Immunol, 11: , Kimura S, Ooshima T, Takiguchi M, et al. : Periodontopathic bacterial infection in childhood. J Periodontol, 73:20-26, Umeda M, Miwa Z, Takeuchi Y, et al. : The distribution of periodontopathic bacteria among Japanese children and their parents. J Periodontol Res, 39: , 정우성 : 어린이의치은연하치태내치주질환원인균의출현율조사. 경희대학교대학원, 김선미, 양규호, 최남기, 등 : 다운증후군환자의치주질환원인균의출현율. 대한소아치과학회지, 32(4): , Suzuki N, Yoshida A, Saito T, et al. : Quantitative microbiological study of subgingival plaque by realtime PCR shows correlation between levels of Tannerella forsythensis and Fusobacterium spp. J Clin Microbiol, 42: , Yoshida A, Suzuki N, Nakano Y, et al. : Development of a 5' fluorogenic nuclease-based realtime PCR assay for quantitative detection of 501

9 J Korean Acad Pediatr Dent 35(3) 2008 Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. J Clin Microbiol, 41: , Lyons SR, Griffen AL, Leys EJ : Quantitative realtime PCR for Porphyromonas gingivalis and total bacteria. J Clin Microbiol, 38: , Asai Y, Jinno T, Igarashi H, et al. : Detection and quantification of oral treponemes in subgingival plaque by real-time PCR. J Clin Microbiol, 40: , Sawamoto Y. Sugano N, Tanaka H, et al : Detection of periodontopathic bacteria and an oxidative stress marker in saliva from periodontitis patients. Oral Microbiol Immunol, 20: ,

10 대한소아치과학회지 35(3) 2008 Abstract QUANTITATIVE DETECTION OF PERIODONTOPATHIC BACTERIA USING REAL-TIME PCR Seon-Mi Kim, Kyu-Ho Yang, Nam-Ki Choi, Mi-Sun Kang*, Jong-Suk Oh* Department of Pediatric Dentistry, School of Dentistry, Chonnam National University and Dental Research Institute and second stage of BK 21, *Department of Microbiology, College of Medicine, Chonnam National University The detection of special bacteria of oral plaque and quantitative analysis are possible through the real-time PCR technique. The aim of this study was to investigate the prevalence and the amount of five periodontopathic bacteria using real-time PCR, and evaluate the relationship among amount of bacteria, plaque index and gingival index. Sixty five subjects ranging from 8 to 18 years old were enrolled. Plaque index and gingival index were examined and five periodontopathic bacteria were surveyed in subgingival plaque samples. The results were analyzed by ANOVA and Pearson's correlation. Results: The prevalence of P. gingivalis was 61.5%, T. forsythia was 53.8%, T. denticola was 29.2%, A. actinomycetemcomitans was 15.4% and F. nucleatum was 100%. Plaque index and gingival index have a significant relationship with the amount of F. nucleatum. The amount of T. forsythia has a strong relationship with the amount of T. denticola and A. actinomycetemcomitans(p<0.05). Key words : Periodontopathic bacteria, Real-time PCR, Plaque index, Gingival index 503

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 구강미생물 7 주차 병원성세균 (pathogenic bacterium) 사람에게감염하여질병을일으키는세균 김희은교수 가천대학교보건과학대학치위생학과 구강미생물의구성 구강내에존재하는대부분의세균은그람양성또는그람음성으로분류» 연쇄상구균 (Streptococcus) 은구강미생물의주요한부분차지 치아우식증, 화농성구강감염증, 감염성심내막염등 Need to know biofilm

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

<31352DB1E8C1A4C0BABCB1BBFDB4D42E687770>

<31352DB1E8C1A4C0BABCB1BBFDB4D42E687770> 대한치주과학회지 ;:- 사람치은섬유아세포에서의 Tannerella forsythia 전세균, 막단백질, 당지질에의한염증성사이토카인발현 김정은, 이성훈, 최봉규, 구기태, 김태일, 이용무, 구영, 정종평, 류인철. 서울대학교치의학대학원치주과학교실및치학연구소. 서울대학교치의학대학원구강악안면감염-면역학전공및치학연구소 Pro-inflammatory cytokine

More information

Oral hygiene Instruction Manual ( 구강위생교육지침 ) 이매뉴얼은전북대학교치과병원치주과에내원하는치주염환자들을대상으로시행되는구강위생교육에대해정의하고, 그내용을구체적으로명시하여충실한교육이이루어질수있도록치주과학교실에서제작하였다. 이매뉴얼을기본으로하여

Oral hygiene Instruction Manual ( 구강위생교육지침 ) 이매뉴얼은전북대학교치과병원치주과에내원하는치주염환자들을대상으로시행되는구강위생교육에대해정의하고, 그내용을구체적으로명시하여충실한교육이이루어질수있도록치주과학교실에서제작하였다. 이매뉴얼을기본으로하여 Oral hygiene Instruction Manual ( 구강위생교육지침 ) 이매뉴얼은전북대학교치과병원치주과에내원하는치주염환자들을대상으로시행되는구강위생교육에대해정의하고, 그내용을구체적으로명시하여충실한교육이이루어질수있도록치주과학교실에서제작하였다. 이매뉴얼을기본으로하여각종사진판넬, 치주질환의이해를돕는파워포인트프리젠테이션, 모형덴티폼, 칫솔등을이용하여환자교육에사용하도록한다.

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

2) 소독제 본 연구에 사용한 소독제는 78% ethanol 스펀지와 1 : 100 으로 희석된 고준위 소독액 중 하나인 High level disinfectant (New Genn, England)이다. 2. 연구 방법 연구에 사용된 미생물학적 검사법은 식품의약품안전

2) 소독제 본 연구에 사용한 소독제는 78% ethanol 스펀지와 1 : 100 으로 희석된 고준위 소독액 중 하나인 High level disinfectant (New Genn, England)이다. 2. 연구 방법 연구에 사용된 미생물학적 검사법은 식품의약품안전 ISSN (print) 1226-8496 J Korean Acad Pediatr Dent 40(4) 2013 http://dx.doi.org/10.5933/jkapd.2013.40.4.268 The Effectiveness of Clinical Sterilization Methods in Dental Air/water Syringes Seyoung Shin,

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

ABSTRACT QLF Concept and Clinical Implementation Department of Preventive Dentistry and Public Oral Health, College of Dentistry, Yonsei University Baek Il Kim, D.D.S., Ph.D. The leading paradigm of dentistry

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 3~26 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 11 2016. 06. 23 2016. 06. 26 ABSTRACT e- 비즈니스연구

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w 497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병

More information

歯14.양돈규.hwp

歯14.양돈규.hwp : The Korean Journal of Counseling and Psychotherapy 2003. Vol. 15, No. 3, 615-631. 1 2 3 1,410.,, ( ),., ( 69%),.,, ( ), ( ).,,.., ( ).,. :,,. :, (390-711) 21-1, : 043-649-1362 E-mail : ydk9498@hanmail.net

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

약수터2호최종2-웹용

약수터2호최종2-웹용 Contents 06 08 11 14 17 17 18 19 23 28 28 33 37 41 45 45 51 56 59 64 66 72 80 26 29 31 34 35 35 38 39 40 42 43 43 46 46 47 49 50 51 52 53 54 56 57 59 60 61 62 69 73 74 77 78 79 14 15 25 36 48 06 07 08

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

ISSN Implantology 2016; 20(3): 124~131 임플란트지대주재료에따른구강세균부착 이성훈 1, 신현승 2, 박정철 2, 조인우 2, 송영균 3 단국대학교치과대학 1 구강미생물학교실, 2 치주과학교실, 3 치과보철학교실 The Ad

ISSN Implantology 2016; 20(3): 124~131 임플란트지대주재료에따른구강세균부착 이성훈 1, 신현승 2, 박정철 2, 조인우 2, 송영균 3 단국대학교치과대학 1 구강미생물학교실, 2 치주과학교실, 3 치과보철학교실 The Ad ISSN 1229-5418 Implantology 2016; 20(3): 124~131 임플란트지대주재료에따른구강세균부착 이성훈 1, 신현승 2, 박정철 2, 조인우 2, 송영균 3 단국대학교치과대학 1 구강미생물학교실, 2 치주과학교실, 3 치과보철학교실 The Adhesion of Oral Bacteria on Saliva-Coated Abutments

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

Young-Mi Chung, Seong-Nyum Jeong 는파괴적인치주질환이다. 또한치태침착수준과일치하지않는치주염진행과심도를갖는다 [2]. 급진성치주염에서환자의감수성결정인자들에대한많은연구가있다. Hodge 등 [3] 은전반형급진성치주염에서흡연력보다유전적인자가더중요하다

Young-Mi Chung, Seong-Nyum Jeong 는파괴적인치주질환이다. 또한치태침착수준과일치하지않는치주염진행과심도를갖는다 [2]. 급진성치주염에서환자의감수성결정인자들에대한많은연구가있다. Hodge 등 [3] 은전반형급진성치주염에서흡연력보다유전적인자가더중요하다 Original Article ORAL BIOLOGY RESEARCH 2013; 37(1): 14-19 한국인급진성치주염환자의치아상실및부착상실평가에관한연구 정영미ㆍ정성념 * 원광대학교치과대학대전치과병원치주과학교실 The evaluation of tooth loss and periodontal attachment loss in aggressive periodontitis

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

대한치주과학회지 : Vol. 37, No. 2, 2007 치주낭측정시 probe 굵기에따른환자의통증과측정값의비교분석 김수한, 홍기석 *, 정진형, 임성빈 단국대학교치과대학치주과학교실 I. 서론 임상적으로치주질환의심도를평가하는가장유효하며보편화된기구는치주낭측정기 (prob

대한치주과학회지 : Vol. 37, No. 2, 2007 치주낭측정시 probe 굵기에따른환자의통증과측정값의비교분석 김수한, 홍기석 *, 정진형, 임성빈 단국대학교치과대학치주과학교실 I. 서론 임상적으로치주질환의심도를평가하는가장유효하며보편화된기구는치주낭측정기 (prob 대한치주과학회지 : Vol. 37, No. 2, 2007 치주낭측정시 probe 굵기에따른환자의통증과측정값의비교분석 김수한, 홍기석 *, 정진형, 임성빈 단국대학교치과대학치주과학교실 I. 서론 임상적으로치주질환의심도를평가하는가장유효하며보편화된기구는치주낭측정기 (probe) 이다 1,2). 치주질환은치주환자마다개개치아의다양한부위에서발생하며한구강내에서도부위마다질환의심도가다르게진행되므로

More information

歯제7권1호(최종편집).PDF

歯제7권1호(최종편집).PDF ********* (*, **, *** ).., 2002, 7, 1, 1-12. 2-5 80.,.,..,,... :,,. (naming).., (word finding), (lexical look- up), (lexical retrieval), (word recall) (Fried- Oken, 1987). (pause),,, (naming error) (Snyder

More information

hwp

hwp 심사위원 심사위원 심사위원 인 인 인 - i - - ii - - iii - - iv - - v - Ⅰ. 서 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - 항목 건강하지못하다 주관적구강상태 보통이다

More information

00약제부봄호c03逞풚

00약제부봄호c03逞풚 경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 93~116 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 12 2016. 06. 20 2016. 06. 26 ABSTRACT e-

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

ISSN (print) J Korean Acad Pediatr Dent 40(2) 2013 ORAL FINDINGS AND TREATMENT OF A PATIENT WI

ISSN (print) J Korean Acad Pediatr Dent 40(2) 2013 ORAL FINDINGS AND TREATMENT OF A PATIENT WI http://dx.doi.org/10.5933/jkapd.2013.40.2.133 ISSN (print) 1226-8496 ORAL FINDINGS AND TREATMENT OF A PATIENT WITH CYCLIC NEUTROPENIA Eun-Joo Kang, Nam-Ki Choi, Seon-Mi Kim Department of Pediatric Dentistry,

More information

서론

서론 - i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability 27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 구강미생물 13 주차 김희은교수 가천대학교보건과학대학치위생학과 Key point 치주질환진행과정 Specific plaque hypothesis 1 Actinobacillus actinomycetemcomitans 2 Porphyromonas gingivalis 3 Prevotella intermedia 4 Bacteroides forsythus 5

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

,......

,...... The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of

More information

ISSN Case Report Effect of supportive periodontal treatment in the oral lichen planus patient

ISSN Case Report Effect of supportive periodontal treatment in the oral lichen planus patient http://dx.doi.org/10.14368/jdras.2015.31.2.134 ISSN 2233-4084 Case Report Effect of supportive periodontal treatment in the oral lichen planus patients Eun-Young Kwon*, Jeomil Choi, Ju-Youn Lee Department

More information

특수교육논총 * ,,,,..,..,, 76.7%.,,,.,,.. * 1. **

특수교육논총 * ,,,,..,..,, 76.7%.,,,.,,.. * 1. ** 특수교육논총 *. 257..,,,,..,..,, 76.7%.,,,.,,.. * 1. ** (eun67@dankook.ac.kr) .,,,,,,,,,, (,, 2014)., (,, 2007)....,,,, (,, 2014).. (2003)...,,, (Baron-Cohen, O Riordan, Stone, Jone, & Plaisted, 1999; Hobson,

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770>

< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770> 임상검사와정도관리 : 제 3 권제 2 호 2009 J Lab Med Qual Assur 2009; 3:275-9 275 SLAN real-time PCR 장비를이용한 Artus HBV LC PCR kit 의평가 김민기 이동영 장윤환 이진경 홍석일 홍영준 원자력병원진단검사의학과 Evaluation of Artus HBV LC PCR kit using SLAN

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

01. 본문(283-).hwp

01. 본문(283-).hwp Kor J Oral Maxillofac Pathol 2013;37(6):303-310 흡연이구강병관련세균과 Human Papillomavirus 의검출에미치는영향 손화경 1), 김주영 2), 박정란 1), 김진 2) * 백석대학교치위생학과 1), 연세대학교치과대학구강병리학교실 구강종양연구소 2) The Impact of Smoking in

More information

ABSTRACT Development of statistical method to modeling tooth healthspan curves in Korean Jung Hoi In Department of Dentistry The Graduate School, Yonsei University Development of statistical method to

More information

조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a

조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a 조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

ISSN 제 3 호 치안정책연구 The Journal of Police Policies ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE

ISSN 제 3 호 치안정책연구 The Journal of Police Policies ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE 11-1320082-000013-09 ISSN 1738-2963 2015 제 3 호 치안정책연구 The Journal of Police Policies 2015. 12 ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE : 통학버스를중심으로 차례 전병주 * 최은영 ** Ⅰ. 서론 1) Ⅱ. 이론적배경 Ⅲ. 연구방법 Ⅳ. 연구결과

More information

ePapyrus PDF Document

ePapyrus PDF Document 경희의학 : 제 32 권제 1 호 특 집 J Kyung Hee Univ Med Cent : Vol. 32, No. 1, 2017 치주질환과전신질환 Periodontitis and Systemic Disease 홍지연 경희대학교치과대학치주과학교실 서 사회, 경제적발전과의료기술의발달로평균수명이늘어나면서세계적으로노인인구비중의급격한증가가나타나고, 대부분의선진국가는고령화사회로변화하는추세를보이고있다.

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

(국).fm

(국).fm Biomaterials Research (2008) 12(3) : 102-108 Biomaterials Research C The Korean Society for Biomaterials 호주산 Propolis 의항균활성과치주조직에미치는영향 Antimicrobial Activity and the Effect on Periodontium of Australian

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

歯5-2-13(전미희외).PDF

歯5-2-13(전미희외).PDF The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

포유6월c03逞풚

포유6월c03逞풚 포유6월(최종) 2010.6.3 9:17 AM 페이지1 세상을 희망으로 채워주는 사랑과 나눔 이야기 www.khnmc.or.kr 6 新 메디컬 허브 경희대학교 동서신의학병원 2010 의과대학, 한의과대학, 치과대학 부속병원이 질환 별로 새롭게 융합된 新의학으로 21세기 의료 서비스의 패러다임을 바꿉니다. 내 치아로 100살까지 건강하게 연령별 치아 관리와 치주질환

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

다문화 가정의 부모

다문화 가정의 부모 영유아아동정신건강연구 Korean Journal for Infant Mental Health 2013, Vol. 6, No. 1, 57-84 영유아기정서및행동문제에대한 부모와일반교사의인식및지원욕구조사 - 57 - 영유아아동정신건강연구 6 권 1 호 - 58 - 영유아기정서및행동문제에대한부모와일반교사의인식및지원욕구조사 - 59 - 영유아아동정신건강연구 6 권

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

Treatment and Role of Hormaonal Replaement Therapy

Treatment and Role of Hormaonal Replaement Therapy Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal

More information

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera

More information

untitled

untitled 제 1 세부과제 안전한 예방접종 실천을 위한 전략 및 교육, 홍보 자료 개발 제 1 장. 서 론 제 1 절. 연구의 필요성 국가적인 차원에서 예방접종 사업은 전염병 관리를 위한 가장 중요한 방역 사업 중 하나로, 대다수의 전염병 발생률은 각종 전염병의 백신이 나온 후로 현저히 감소하였으며, 인류 역사상 가장 많은 생명을 전염병으로부터 구원해주었다. 그러나,

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: * Review of Research

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   * Review of Research Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.79-102 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.79 * Review of Research Trends on Curriculum for Students with Severe and multiple

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between

More information

590호(01-11)

590호(01-11) T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,

More information

5. .......hwp

5. .......hwp X i D i ) 8 6 4 2 0-2 -4 1987 1988 1990 1992 1994 1996 1998 2000 2002 year 12 8 4 0-4 -8 1987 1988 1990 1992 1994 1996 1998 2000 2002 year 45 40 35 30 25 20 15 1987 19 90 1994 1998 2002 year ln W X 30

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 대한구강내과학회지 Vol. 33, No. 1, 2008 한국인소아의타액에서 Helicobacter pylori 의검출 조선대학교치과대학구강내과학교실 유지원 이장근 이영수 윤창륙 안종모 Helicobacter pylori(h. pylori) 는위 십이지장궤양및위암의발생과관련되어있으며, 감염은대부분유년기에발생되어나이가먹어감에따라증가한다. 감염경로에있어서구강은매우중요한역할을하기때문에소아의타액에서

More information