만성 C형간염환자에서인터페론과리바비린병합요법에의한치료효과와 ISDR 염기서열의관련성 연세대학교대학원의학과윤준호
만성 C형간염환자에서인터페론과리바비린병합요법에의한치료효과와 ISDR 염기서열의관련성 지도예병일교수 이논문을박사학위논문으로제출함 6 년 7월일 연세대학교대학원의학과윤준호
윤준호의박사학위논문을인준함 심사위원심사위원심사위원심사위원심사위원 인인인인인 연세대학교대학원 6 년 7월일
감사의글 먼저이논문이완성되기까지많은관심과격려로지도를해주신예병일교수님께진심으로감사를드리며, 항상아낌없는지원과격려를보내주신최종환교수님과김현원교수님께도감사의말씀을드립니다. 저의미흡한논문을자상하게심사해주시고많은조언을해주신백순구교수님과최선주교수님께도감사의말씀을드립니다. 실험실생활을큰어려움없이잘할수있도록모든면에서많은도움을주신이현우선생님과손준형선생님께도감사의마음을전합니다. 도움을주신모든선생님들께앞으로더욱열심히노력하여발전된모습으로보답하고자하겠습니다. 하늘에계신아버님께서도함께기뻐하실거라생각하며다시한번감사의마음을전해드리고싶습니다. 그동안변함없는마음으로지켜봐주신장인어른과장모님께도감사드리며, 항상자신의자리에서흔들림없이열심히생활하는동생준철과정이에게도고마운마음을전합니다. 언제나변함없는마음으로저를믿고후원해준사랑하는아내은영에게그동안의모든노고에진심으로깊은감사를드립니다. 끝으로세상에나온지얼마안된아들태건과귀여운딸서진과함께조그만기쁨을나누고자합니다. 6 년 7월저자씀
차 례 그림차례 ⅰ 표차례 ⅱ 국문요약 Ⅰ. 서론 3 Ⅱ. 재료및방법 7. 재료 7. HCV RNA 분리및 cdna 제조 8 3. HCV의 ISDR과 PePHD 부위의염기서열결정 9 4. HCV RNA 정량 9 5. 통계분석 Ⅲ. 결과. 환자구분. HCV의 ISDR과 PePHD 부위의염기서열확인 3. 인터페론과리바비린병합요법의예측인자확인 8 Ⅳ. 고찰 Ⅴ. 결론 5 참고문헌 7 영문요약 4 i
그림차례 ig.. ISDR sequences(9-48) of HCV in complete response group 5 ig.. ISDR sequences(9-48) of HCV in no-response group 6 ig. 3. PePHD sequences(659-67) of HCV in complete response group and no-response group 7 ii
표차례 Table. Primer sequences to amplify ISDR and PePHD Table. Primer sequences to determine HCV RNA titer Table 3. Characteristics of the complete response group patients before IN-α and ribavirin treatment 3 Table 4. Characteristics of the no-response group patients before IN-α and ribavirin treatment 4 Table 5. Statistical analysis of Age, ALT, and HCV RNA titer 9 Table 6. Statistical analysis of ISDR 9 iii
국문요약 만성 C형간염환자에서인터페론과리바비린병합요법에의한치료효과와 ISDR 염기서열의관련성 현재만성 C형간염의치료에는인터페론과리바비린의병합요법이사용되고있으나치료비가과중하고부작용이커서환자에게큰부담이되고있다. 또한모든대상환자에서좋은결과를얻을수없으므로치료효과를볼수있는환자를선택하여치료효과의극대화를가져올수있는방안이절실히요구되고있다. 한편고빈도변이부위 (hypervariable region) 염기서열의다양성과같이치료효과를예측하기위해사용할수있는여러가지인자들에대한연구가진행되어왔으나연구자들에따라서로다른결과가보고되곤했다. 본연구의목적은한국의만성 C형간염환자에서 interferon sensitivity determining region (ISDR) 의염기서열이인터페론과리바비린병합요법의치료효과와어떤상관성을지니는지를알아보려는것이다. C형간염바이러스에는여러가지형이존재하고있고, 각형태에따라치료결과가다르게나타난다는보고가있으므로본연구에서는한국에서 C 형간염의원인으로 6-8 % 를차지하는 b형을선택하여실험을진행하였다. 또한 ISDR 염기서열과함께여러다른인자들과의비교분석을통하여치료효과를예측할수있는방법을확립하고자했다. C형간염환자들을대상으로인터페론과리바비린병합요법후치료효과를얻은군과치료효과를얻지못한군으로나누어서 HCV RNA의 ISDR 부위염기서열을포함한여러인자와의상관관계를분석하였다. 본연구결과만성 C형간염환자에서인터페론과리바비린병합요법의 iv
치료효과에대한예측인자들은환자의나이, 치료전 HCV RNA titer, ISDR 부위염기서열이사용될수있음을확인하였다. 치료효과를얻은실험군에서환자의나이가치료효과를얻지못한실험군에비해낮게확인되었으며, 치료전 HCV RNA titer도치료에효과를보인실험군에서낮게확인되었다. ISDR 부위염기서열은변이발생빈도가높을수록병합요법에의한치료가능성이높게나타남을알수있었다. 특히예측인자로확인된환자의나이와치료전 HCV RNA titer를고려하여 ISDR type과치료가능성을비교해볼때 mutant type에서인터페론과리바비린병합요법에의한치료가능성은 wild type에비해서 8. 배로확인되었다. 이상의실험결과를토대로볼때 C형간염바이러스 b 형에의한간염환자에서 ISDR 염기서열과치료전 HCV RNA titer, 환자의나이등을인터페론과리바비린의병합요법시치료효과를예측할수있는인자로이용한다면사회적경제적인손실을줄일수있는방법의하나가될것으로사료된다. 핵심되는말 : C형간염바이러스, 인터페론, 리바비린, interferon sensitivity determining region (ISDR), 예측인자 v
만성 C형간염환자에서인터페론과리바비린병합요법에의한치료효과와 ISDR 염기서열의관련성 < 지도교수예병일 > 연세대학교대학원의학과 윤준호 Ⅰ. 서론 C형간염은 Hepatitis C Virus (HCV) 에의해서매개되며, 만성간질환과관련이깊은것으로알려져있다. C형간염은급성간염발병후 5-7% 에서만성화하고, 이중 % 이상에서간경변증으로진행되며원발성간암과도높은상관관계를가지고있다,. 전세계적으로약 억 7천만명이상의 C형간염바이러스보균자가있는것으로추정되고있으며 3, 선진국만성간염의약 7%, 우리나라만성간질환의약 5-% 에서관련이있는것으로보고되어있다 4, 5. 따라서 C형간염치료는만성간질환의발생을예방하기위하여매우중요하다. C형간염의치료에는인터페론과리바비린이이용되고있다. 치료효과는인터페론을단독으로사용한치료법보다병합요법이높게나타나지만, 병합요법의경우도 47% 정도에불과한치료효과를보이고있다 6-8. 이러한치료효과의차이는 HCV의유전자형이관여한다고알려져있다 9,. HCV 의치료는경제적인비용과부작용이크다는점에서환자에게많은부담이되므로, 치료효과를예측하기위한방법들이요구되고있는상황이다. 치료효과를예측하기위한인자에대한연구는각나라연구진에따라그상관관계가다르게나타나고있다 -3. 그것은시료의수가적고, HCV 아형
에따른구분을제대로하지않았기때문으로생각되며, 지역별, 인종별에따른차이때문일수있으나지금까지의연구는단편적으로적은수의시료를이용하여단편적인인자만을찾기위한연구를진행하였기에명확한결과를얻지못한것으로판단된다. 그러므로본연구는 HCV b형만성간염환자에서인터페론과리바비린병합요법에대한치료효과예측인자를찾아내고자진행하였다. 만성 C형간염의치료효과예측을위한연구는크게환자 (host) 측면과바이러스측면으로구분할수있다. 환자측면에서고려될사항으로는환자의나이, 음주습관, 수혈경력및기타감염여부등이있고, 바이러스측면에서는치료전바이러스의농도및감염된 HCV 유전자형과이형성등이있다 4. 이중 HCV b형유전자구조에서 NS5A 영역내 codon 9-48의아미노산서열에변이가존재할수록인터페론치료반응성이향상된다고알려져있으며, 이부위는 interferon sensitivity determining region (ISDR) 으로명명되어있다 5, 6. HCV b 형의 NS5A 단백질은인터페론의항바이러스작용에필수적인 double-stranded RNA-dependent protein kinase (PKR) 와결합하여 PKR의활성도를억제하며, ISDR에다수의아미노산변이가있는경우이결합이저해된다고보고되고있다 7, 8. 이부위의변이정도와인터페론치료효과는일본인이대상인일부연구에서는긴밀한관계가있다고보고되기도했으나, 유럽과미국에서는 ISDR의변이정도와인터페론치료효과와는관련성이확실치않다고보고되는등 9- 명확한결론을내리기힘든실정이다. HCV 유전자는 9.6 kb의 positive-strand RNA를가지며약 3개의아미노산으로구성되어있다. 이유전자로부터합성된 polyprotein은세개의구조단백질 (core, E, E) 과여섯개의비구조단백질 (NS, NS3, NS4A, NS4B, NS5A, NS5B) 로구분되어기능을하게된다 3. HCV는크게여섯종의유전자형과 5개이상의아형이있으며, 유전자형과아형간
에는염기서열의차이를보인다. HCV 감염후만성화가많은이유는 HCV 유전자이형성 (genetic heterogeneity) 과바이러스에대한 T 림프구의면역반응이활발하지않기때문인것으로추정하고있다. 뿐만아니라유전자이형성은예방백신개발을어렵게하고인터페론치료에대한반응의차이를가져오기도한다. 인터페론치료에대한비반응성과관련이있다고보고된단백질들은 (ISDR을포함하는 ) NS5A 외에외피단백질인 E와 serine protease로작용하는 NS3/4A가있다. E 단백질은 in vitro 에서 PKR의활성도를억제할수있다고보고되었으며, C 말단에있는 PKR/eIα phosphorylation homology domain (PePHD) 부위가 PKR과의상호작용에의해인터페론치료에저항성을증가시킬수있다는가설이제시되기도하였다 4, 5. 그러나몇몇연구자들에의한후속연구에서는 E PePHD 부위의아미노산변이여부가 HCV 유전자형에따른치료효과와연관성이없다고보고되었다 6-9. 최근에는 NS3/4A 단백질이 interferon regulatory factor 3 (IR-3) 의 nuclear translocation과 phosphorylation을저해할수있다고보고되기도했다 3. C형간염을치료하는궁극적인목표는 HCV를체내에서제거하여질환의진행과합병증을예방하는것이다. 인터페론을이용한 C형간염치료에따른부작용으로는백혈구감소증, 혈소판감소증, 우울증, 갑상선기능이상, 집중장애, 기억장애, 시각장애, 피로, 근육통, 두통, 오심, 구토, 피부자극, 경도의발열, 체중감소, 불면증, 청각장애, 이명등이있는데, 특히독감과유사한 (lu-like) 증상과우울증이주로나타난다 3, 3. 또한병합요법에사용하는리바비린과관련된부작용은용혈성빈혈, 피로, 소양증, 발진, 부비동염, 통풍등이있지만, 가장중요한것으로선천성기형이유발될수있으므로세심한주의가필요하다 33. 이러한여러가지부작용과치료환자의절반정도에이르는치료효과때문에치료효과를극대화시킬수있도록환자를잘선택해야할필요가있다. 3
본연구에서는연세대학교원주의과대학부속원주기독병원에내원한환자들중임상적으로만성간염이의심되는환자들을대상으로먼저 HCV 감염을확인하고, 만성 C형간염으로확진된환자의혈청을실험재료로사용하였다. C형간염바이러스감염환자의치료방법중인터페론과리바비린병합요법으로치료한다음치료효과를얻은군과치료효과를얻지못한군으로나누어실험에이용하였다. 이를위해치료전과치료후에채혈을통해얻은혈청을실험에사용하였으며, 이환자들의혈청으로부터 HCV RNA를분리한후 ISDR 부위의염기서열을확인하고다른예측인자들과의상호관계및치료효과와의상호관계를알아보고자하였다. 4
Ⅱ. 재료및방법. 재료 본실험에사용한환자들의혈청은연세대학교원주의과대학부속원주기독병원에내원한환자들중임상적으로만성간염이의심되는환자들을대상으로하였다. 검체는 HCV 항체를이용한제 3세대 ELISA 방법으로진단하여양성으로판명된환자의혈청을이용하였고, HCV b 형에의한감염환자의혈청만을선택하여실험에이용하였다. 실험군은 C형간염바이러스감염환자를대상으로인터페론 (interferon-α, Roche, 스위스 ) 과리바비린 (ribavirin, 한국유나이티드, 한국 ) 병합요법을시행하여치료효과를얻은군과치료효과를얻지못한군으로나누어비교하였고, 각각치료전과치료후에채혈한혈청을실험에사용하였다. 모든환자들에대한치료방법은인터페론을 6개월동안이틀마다 3만단위 (units) 씩피하주사하였고, 리바비린은같은기간동안하루 9 mg 씩투여하였다. 치료효과는치료기간종료후 alanine aminotransferase (ALT) 수치를측정하여 A 군은 ALT 수치가정상수준으로떨어진치료된군 (complete response, CR), B 군은 ALT 수치변화가없는치료되지않은군 (no-response, NR) 으로구분하였다. 모든환자들에대하여각각수혈경력, 나이, 성별등의기본정보를수집하였고, 인터페론과리바비린의병합치료전과치료후에각각채혈한혈청으로부터임상검사를수행하여 ALT 수치를확인하였다. 5
. HCV RNA 분리및 cdna 제조 Poel의방법에따라환자의혈청으로부터 C형간염바이러스의 RNA 를분리하였다 34. 혈청 5 μl에 RNA 추출완충용액 ( m Tris-HCl ph 7.5, 5 m EDTA,. sodium chloride, % sodium dodecyl sulfate) 5 μl와 %(w/v) proteinase K 4 μl를혼합한후 DEPC(diethyl pyrocarbonate) 를처리한재증류수 μl를첨가한다음 37 에 4분간보관하였다. 여기에 phenol : chloroform : isoamylalcohol (5:4:) 을동량섞은후관을위아래로서서히흔들어용액이잘혼합되도록하였다. 이를, g 속도로 5분간원심분리하여상층액을새로운미세원침관으로옮겨담은후다시한차례 phenol-chloroform-isoamylalcohol 추출을시행하였다. 이용액에 glycogen μg과.5배부피의 99 % 에탄올을첨가하고 -7 에보관한다음필요할때마다침전시켜실험에이용하였다. HCV의 cdna 제조는 Sambrook의방법을응용하여실시하였다 35. 먼저 -7 에보관된 RNA를꺼내어, g로 5분간원심분리한후상층액을제거하고 7 % 에탄올 ml를가하여한차례씻은후다시, g로 5분간원심분리하여상층액을제거한다음진공상태에서완전히건조시켰다. 여기에 DEPC를처리한재증류수 7 μl와 5 역전사완충용액 (5 m Tris-HCl ph 8.3, 5 m potassium chloride, 5 m dithiothreitol, 5 m magnesium chloride,.5 m spermidine) μl및 cdna 제조용 primer pmole( μl ) 을혼합한후 65 에 5분간보관하여 RNA가일차구조를이루도록하였다. RNA가변성되면 5 역전사완충용액 μl, m dntp μl, avian myeloblastosus virus (AV) 역전사효소 (Promega, adison, Wisconsin, USA) unit와 RNase inhibitor unit에 DEPC를처리한 6
증류수를합하여전체 μl가되도록한다음 37 에서 시간반응시켜 cdna가제조되도록하였다. 반응이종료된다음 95 에서 5분간방치하여효소의활성을제거하였다. 제조된 cdna는 - 에보관하였다가필요할때마다사용하였다. 3. HCV 의 ISDR 과 PePHD 부위의염기서열결정 각환자의 HCV RNA로부터제조된 cdna를주형으로 Okamoto의방법에따라 HCV typing을실시하여 b형인것을선택하였고 36, ISDR 부위와 PePHD 부위를증폭시키기위한 primer를제작하여 nested PCR을시행하였다. 염기서열확인을위하여각환자의 PCR 반응이종료된후원하는 DNA가증폭되었는지알아보기위해 agarose gel 전기영동을실시하였다. 전기영동후남은 PCR 산물은 T-vector (Promega, adison, Wisconsin, USA) 에 subcloning하여형질전환실험을시행하였고, α- complementation을통해확인된집락을채취하고이를증식시킨다음 DNA를분리하여 DNA 염기서열을결정하였다 (Table ). 4. HCV RNA 정량 HCV RNA titer를확인하기위해서인터페론과리바비린병합요법전에각각제조된 cdna를주형으로 Choo 등의방법을이용한 QC-PCR (quantitative and competitive-polymerase chain reaction) 을시행하였다 37. 실험에사용한 primer는 HCV 유전자의 5 -UTR (untranslated region) 에존재하는특정부위의염기서열을이용하였다 (Table ). 7
Table. Primer sequences to amplify ISDR and PePHD Region Primer direction Sequence (5 to 3 ) Nucleotide no. ISDR Outer sense TGGATGGAGTGCGGTTGCACAGGTA 673-677 Outer antisense TGTAAAACGACGGCCAG 796-73 Inner sense TCTTTCTCCGTGGAGGTGGTATTGC 67-674 Inner antisense CAGGAAACAGCTATGACC 775-794 PePHD Outer sense TGACTACCCATACAGGCTCT 8-99 Outer antisense AAGGAAGGAGAGATTGCCAT 75-744 Inner sense AAGGTTAGGATGTATGTGGG 38-57 Inner antisnse ATTGAGGACCACCGAGTTCT 689-78 Table. Primer sequences to determine HCV RNA titer Region 5 - UTR Primer direction Outer sense Outer antisense Inner sense Inner antisense Sequence (5 to 3 ) Nucleotide no. CCACCATAGATCACTCCCCTGT 5-36 TTGAGGTTTAGGATTCGTGCTCAT 348-35 CTGTGAGGAACTACTGTCTTCA 33- ACTCGCAAGCACCCTATCAGGC 3-3 8
5. 통계분석 위의방법으로얻은여러자료들을바탕으로각인자들과 ISDR 부위의염기서열이인터페론과리바비린병합요법의치료효과와어떤상관관계를가지는지통계적으로분석하였다. 결과값은평균 ± 표준편차로표시하였고, t test와 odds ratio로검증하여 p value가.5 미만인경우를유의하다고판정하였다. 9
Ⅲ. 결과. 환자구분 HCV 유전자형이 b 형으로확인된환자 5명에대해서 6개월동안인터페론과리바비린병합요법을실시하였다. 치료종료후 ALT 수치가정상범위로변화된 명의환자들을 A군으로구분하였고, 주요임상기록및실험결과를비교하였다 (Table 3). 또한치료종료후 ALT 수치가정상으로확인되지않은 9명의환자들에대해서는 B군으로구분하여주요임상기록및실험결과를비교하였다 (Table 4). 각실험군의결과에서 ISDR 부위의변이는 type 별로구분하여비교하였고, PePHD 부위는변형된아미노산개수를비교하였다.. HCV 의 ISDR 과 PePHD 부위의염기서열확인 각군별 ISDR 부위의염기서열 (9-48) 을 DNA 염기서열결정법을통해서확인할수있었고, 염기서열결과를아미노산으로전환하여비교하였다. A 군에서는 ~ 개의아미노산이변형되어있는것을확인할수있었고 (ig. ), B 군에서는 ~8 개의아미노산이변형되어있는것을확인할수있었다 (ig. ). ISDR 부위염기서열은변이개수에따라서 type 별로구분하고, 치료효과여부에따라 type별차이가있는지를확인하였다. 또한 A, B 두군모두에서 HCV의 E PePHD (659-67) 부위의염기서열을비교분석해본결과 ~개의아미노산변형이존재하는것을확인할수있었다 (ig. 3).
Table 3. Characteristics of the complete response group patients before IN-α and ribavirin combination treatment Age Sex ALT Transfusion history HCV RNA titer * ISDR type No. of Amino Acid utations of PePHD A- 5 78 3.9 A- 35 3.7 A-3 4 6 4.6 A-4 45 8 5.48 A-5 5 9 4.4 A-6 4 43 3.75 A-7 56 67 4.4 A-8 58 86 5.6 A-9 99 5. A- 4 9 4.4 A- 3.73 A- 79 4. A-3 5 34 4.5 A-4 47 3 5. A-5 86 6. 3 A-6 5.9 3 A-7 47 94 4.8 3 A-8 46 5.44 3 A-9 5 44 5. 3 A- 47 35 4.85 3 A- 9 3.73 3 All of the samples were diagnosed by 3 rd generation ELISA. indicates history of transfusion and indicates no history of transfusion. * The unit of HCV RNA titer before treatment is log copies/ml. ISDR type : (wild type, no amino acid substitution), (intermediate type, ~3 amino acid substitutions), 3 (mutant type, 4 amino acid substitutions)
Table 4. Table 4. Table 4. Table 4. Characteristics of the no-response group patients before IN-α and ribavirin combination treatment 3 4.98 4.98 4.98 4.98 34 34 34 34 48 48 48 48 B-9 9 9 9 3 5.93 5.93 5.93 5.93 34 34 34 34 58 58 58 58 B-8 8 8 8 3 6.4 6.4 6.4 6.4 9 9 9 9 B-7 7 7 7 5.85 5.85 5.85 5.85 8 8 8 8 B-6 6 6 6 5.3 5.3 5.3 5.3 96 96 96 96 5 5 5 5 B-5 5 5 5 6.47 6.47 6.47 6.47 6 6 6 6 47 47 47 47 B-4 4 4 4 6.3 6.3 6.3 6.3 35 35 35 35 63 63 63 63 B-3 3 3 3 5.88 5.88 5.88 5.88 B- 6.3 6.3 6.3 6.3 7 7 7 7 5 5 5 5 B- 6.4 6.4 6.4 6.4 7 7 7 7 B- 5.89 5.89 5.89 5.89 67 67 67 67 59 59 59 59 B-9 9 9 9 6.3 6.3 6.3 6.3 83 83 83 83 44 44 44 44 B-8 8 8 8 5.8 5.8 5.8 5.8 4 4 4 4 B-7 7 7 7 6.33 6.33 6.33 6.33 75 75 75 75 B-6 6 6 6 4.85 4.85 4.85 4.85 58 58 58 58 57 57 57 57 B-5 5 5 5 6.76 6.76 6.76 6.76 85 85 85 85 B-4 4 4 4 6.73 6.73 6.73 6.73 4 4 4 4 B-3 3 3 3 6.5 6.5 6.5 6.5 95 95 95 95 B- 5. 5. 5. 5. 4 4 4 4 B- 4.95 4.95 4.95 4.95 38 38 38 38 B- 6.8 6.8 6.8 6.8 45 45 45 45 45 45 45 45 B-9 7. 7. 7. 7. 5 5 5 5 64 64 64 64 B-8 6.35 6.35 6.35 6.35 6 6 6 6 B-7 5.4 5.4 5.4 5.4 9 9 9 9 58 58 58 58 B-6 6. 6. 6. 6. 5 5 5 5 B-5 5.7 5.7 5.7 5.7 75 75 75 75 B-4 4.88 4.88 4.88 4.88 5 5 5 5 44 44 44 44 B-3 6. 6. 6. 6. 3 3 3 3 48 48 48 48 B- 5.5 5.5 5.5 5.5 85 85 85 85 B- No. of Amino Acid No. of Amino Acid No. of Amino Acid No. of Amino Acid utations of utations of utations of utations of PePHD PePHD PePHD PePHD ISDR ISDR ISDR ISDR type type type type HCV RNA HCV RNA HCV RNA HCV RNA titer titer titer titer * Transfusion Transfusion Transfusion Transfusion history history history history ALT ALT ALT ALT Sex Sex Sex Sex Age Age Age Age 3 4.98 4.98 4.98 4.98 34 34 34 34 48 48 48 48 B-9 9 9 9 3 5.93 5.93 5.93 5.93 34 34 34 34 58 58 58 58 B-8 8 8 8 3 6.4 6.4 6.4 6.4 9 9 9 9 B-7 7 7 7 5.85 5.85 5.85 5.85 8 8 8 8 B-6 6 6 6 5.3 5.3 5.3 5.3 96 96 96 96 5 5 5 5 B-5 5 5 5 6.47 6.47 6.47 6.47 6 6 6 6 47 47 47 47 B-4 4 4 4 6.3 6.3 6.3 6.3 35 35 35 35 63 63 63 63 B-3 3 3 3 5.88 5.88 5.88 5.88 B- 6.3 6.3 6.3 6.3 7 7 7 7 5 5 5 5 B- 6.4 6.4 6.4 6.4 7 7 7 7 B- 5.89 5.89 5.89 5.89 67 67 67 67 59 59 59 59 B-9 9 9 9 6.3 6.3 6.3 6.3 83 83 83 83 44 44 44 44 B-8 8 8 8 5.8 5.8 5.8 5.8 4 4 4 4 B-7 7 7 7 6.33 6.33 6.33 6.33 75 75 75 75 B-6 6 6 6 4.85 4.85 4.85 4.85 58 58 58 58 57 57 57 57 B-5 5 5 5 6.76 6.76 6.76 6.76 85 85 85 85 B-4 4 4 4 6.73 6.73 6.73 6.73 4 4 4 4 B-3 3 3 3 6.5 6.5 6.5 6.5 95 95 95 95 B- 5. 5. 5. 5. 4 4 4 4 B- 4.95 4.95 4.95 4.95 38 38 38 38 B- 6.8 6.8 6.8 6.8 45 45 45 45 45 45 45 45 B-9 7. 7. 7. 7. 5 5 5 5 64 64 64 64 B-8 6.35 6.35 6.35 6.35 6 6 6 6 B-7 5.4 5.4 5.4 5.4 9 9 9 9 58 58 58 58 B-6 6. 6. 6. 6. 5 5 5 5 B-5 5.7 5.7 5.7 5.7 75 75 75 75 B-4 4.88 4.88 4.88 4.88 5 5 5 5 44 44 44 44 B-3 6. 6. 6. 6. 3 3 3 3 48 48 48 48 B- 5.5 5.5 5.5 5.5 85 85 85 85 B- No. of Amino Acid No. of Amino Acid No. of Amino Acid No. of Amino Acid utations of utations of utations of utations of PePHD PePHD PePHD PePHD ISDR ISDR ISDR ISDR type type type type HCV RNA HCV RNA HCV RNA HCV RNA titer titer titer titer * Transfusion Transfusion Transfusion Transfusion history history history history ALT ALT ALT ALT Sex Sex Sex Sex Age Age Age Age All of the samples were diagnosed by 3 rd generation ELISA. indicates history of transfusion and indicates no history of transfusion. * The unit of HCV RNA titer before treatment is log copies/ml. ISDR type : (wild type, no amino acid substitution), (intermediate type, ~3 amino acid substitutions), 3 (mutant type, 4 amino acid substitutions)
3 9 9 9 9 48 48 48 48 -D- - - - V Y-G -YI YI YI YI-Q O-S-T N V- - - - -R- L W K- D RR RR RR RR- L 9 9 9 9 K -T- - - - - - - -K- A V 8 8 8 8 -S- - - - V A- - - -N L 7 7 7 7 -D- - - - RG RG RG RG- - - - -YI YI YI YI S-T 6 6 6 6 AYI AYI AYI AYI V 5 5 5 5 L 4 4 4 4 I- - - -D L 3 3 3 3 V R C R P 9 V 8 R 7 P N - - - -R- 6 5 4 3 VESEN VESEN VESEN VESEN GNITR GNITR GNITR GNITR RQEG RQEG RQEG RQEG ANLLW ANLLW ANLLW ANLLW ADLIE ADLIE ADLIE ADLIE HDSPD HDSPD HDSPD HDSPD TCTTH TCTTH TCTTH TCTTH PSLKA PSLKA PSLKA PSLKA -D- - - - V Y-G -YI YI YI YI-Q O-S-T N V- - - - -R- L W K- D RR RR RR RR- L 9 9 9 9 K -T- - - - - - - -K- A V 8 8 8 8 -S- - - - V A- - - -N L 7 7 7 7 -D- - - - RG RG RG RG- - - - -YI YI YI YI S-T 6 6 6 6 AYI AYI AYI AYI V 5 5 5 5 L 4 4 4 4 I- - - -D L 3 3 3 3 V R C R P 9 V 8 R 7 P N - - - -R- 6 5 4 3 VESEN VESEN VESEN VESEN GNITR GNITR GNITR GNITR RQEG RQEG RQEG RQEG ANLLW ANLLW ANLLW ANLLW ADLIE ADLIE ADLIE ADLIE HDSPD HDSPD HDSPD HDSPD TCTTH TCTTH TCTTH TCTTH PSLKA PSLKA PSLKA PSLKA ig.. ig.. ig.. ig.. ISDR sequences (9-48) of HCV in complete response group. Dashes indicate the amino acid residues identical to the sequences on the top in each panel.
4 9 9 9 9 48 48 48 48 W - - - -P- L 4 4 4 4 -V- - - - R 5 5 5 5 P 6 6 6 6 -E- - - - -GI GI GI GI- A AR AR AR AR L 7 7 7 7 -D- - - - P D -G- - - - 8 8 8 8 V RR RR RR RR- L 9 9 9 9 R - - - -R- 3 3 3 3 -V- - - - R C C 9 9 9 9 R 8 8 8 8 R 7 7 7 7 R 6 6 6 6 5 5 5 5 4 4 4 4 3 3 3 3 9 8 7 6 5 4 3 VESEN VESEN VESEN VESEN GNITR GNITR GNITR GNITR RQEG RQEG RQEG RQEG ANLLW ANLLW ANLLW ANLLW ADLIE ADLIE ADLIE ADLIE HDSPD HDSPD HDSPD HDSPD TCTTH TCTTH TCTTH TCTTH PSLKA PSLKA PSLKA PSLKA W - - - -P- L 4 4 4 4 -V- - - - R 5 5 5 5 P 6 6 6 6 -E- - - - -GI GI GI GI- A AR AR AR AR L 7 7 7 7 -D- - - - P D -G- - - - 8 8 8 8 V RR RR RR RR- L 9 9 9 9 R - - - -R- 3 3 3 3 -V- - - - R C C 9 9 9 9 R 8 8 8 8 R 7 7 7 7 R 6 6 6 6 5 5 5 5 4 4 4 4 3 3 3 3 9 8 7 6 5 4 3 VESEN VESEN VESEN VESEN GNITR GNITR GNITR GNITR RQEG RQEG RQEG RQEG ANLLW ANLLW ANLLW ANLLW ADLIE ADLIE ADLIE ADLIE HDSPD HDSPD HDSPD HDSPD TCTTH TCTTH TCTTH TCTTH PSLKA PSLKA PSLKA PSLKA ig.. ig.. ig.. ig.. ISDR sequences (9-48) of HCV in no-response group. Dashes indicate the amino acid residues identical to the sequences on the top in each panel.
5 3 3 3 3 4 4 4 4 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8 9 9 9 9 Q -A 9 9 9 9 Q 8 8 8 8 7 7 7 7 6 6 6 6 A 5 5 5 5 4 4 4 4 3 3 3 3 -Q -E -A 9 8 7 6 5 4 -Q 3 -A LLSTT LLSTT LLSTT LLSTT ELSPL ELSPL ELSPL ELSPL RS RS RS RS LLSTT LLSTT LLSTT LLSTT ELSPL ELSPL ELSPL ELSPL RS RS RS RS No No No No-response group response group response group response group Complete response group Complete response group Complete response group Complete response group 3 3 3 3 4 4 4 4 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8 9 9 9 9 Q -A 9 9 9 9 Q 8 8 8 8 7 7 7 7 6 6 6 6 A 5 5 5 5 4 4 4 4 3 3 3 3 -Q -E -A 9 8 7 6 5 4 -Q 3 -A LLSTT LLSTT LLSTT LLSTT ELSPL ELSPL ELSPL ELSPL RS RS RS RS LLSTT LLSTT LLSTT LLSTT ELSPL ELSPL ELSPL ELSPL RS RS RS RS No No No No-response group response group response group response group Complete response group Complete response group Complete response group Complete response group ig. 3. ig. 3. ig. 3. ig. 3. PePHD sequences (659-67) of HCV in complete response group (n=) and no-response group (n=9). Dashes indicate the amino acid residues identical to the sequences on the top in each panel.
3. 인터페론과리바비린병합요법의예측인자확인 각군별환자의나이, 성별, ALT 수치, 수혈경험여부, 치료전 HCV RNA titer, ISDR type, PePHD 부위의아미노산변이수와치료효과와의관계를통계적으로분석하였다. 환자의나이와치료전 HCV RNA titer가낮은경우완전히치료된군 (A) 에서치료되지않은군 (B) 에비하여통계적으로유의한차이를보이는것을확인할수있었다 (Table 5). 이결과로부터인터페론과리바비린의병합치료효과예측인자로서환자의나이와치료전 HCV RNA titer의사용가능성을확인할수있었다. 그러나두실험군에서치료전 ALT 수치와 PePHD 부위의아미노산변이는통계적으로유의한차이를확인할수없었다. 다음으로 ISDR 부위의염기서열과치료효과를비교분석하기위하여 ISDR type에따라환자를구분하고치료효과와의연관성여부를 odds ratio를통해서확인하였다. 그결과아미노산변이가존재하는 intermediate type에서 wild type과비교하여치료가능성이.5배로높게나타나는것으로확인되었고, mutant type에서는치료가능성이 7.배로높게나타남을확인할수있었다. 또한환자의나이와치료전 HCV RNA titer를고려하여보정해본결과 mutant type에서의치료가능성은 8.배로더크게나타남을확인할수있었다 (Table 6). 6
Table 5. Statistical analysis of Age, ALT and HCV RNA titer before treatment : Age ALT HCV RNA titer before treatment A 3:8.3±5. * 85.±89. 4.6±.8 ** B 6:3 5.8±5.7 * 86.5±6.7 5.95±.6 ** A : complete response group. B : no-response group. The data of age, ALT and HCV RNA titer before treatment are shown in average± SD form. * P-value was.3. ** P-value was.. Table 6. Statistical analysis of ISDR ISDR Type Crude OR 95% CI Adjusted OR * 95% CI * Wild. `. Intermediate.46.64~9.39.9.59~4.5 utant 7..9~37.9 8..5~6.6 ISDR wild type has no mutation. Intermediate type has to 3 mutations and mutant type has more than 4 mutations. * After adjustment for age and HCV RNA titer before treatment. OR : odds ratio CI : 95% confidence interval 7
Ⅳ. 고찰 C 형간염바이러스는 989 년에 non-a, non-b 형으로분류된간염환 자로부터 cdna 를 cloning 하는데성공하여그정체가밝혀진 RNA 바이 러스로서, 과거에만성 non-a, non-b 형간염으로분류되었던환자의대 부분이 C 형간염으로밝혀졌다 38, 39. 급성간염의특징을보이는 A 형및 E 형바이러스와는달리 C 형간염은만성화의가능성이크며 4-4, 특히 B 형, 43, 44 간염보다도만성화경향이더큰것으로알려져있어만성 관리에중요한의미를지닌다. 간질환의 C 형간염바이러스가지속적인감염을일으키는기전과간세포를손상 시키는기전은아직완전히규명되지않고있다. 현재까지 C 형간염에효 과적인백신이개발되지않고있으므로최선의관리는감염되지않는것이 지만, 이미감염된경우에는항바이러스제를이용한치료를할수밖에없 는상황이다. C 형간염치료에이용되는대표적인항바이러스제는인터페 론이다. 인터페론을단독으로치료한경우에는약 5% 의환자에서 HCV RNA 의소실을보인다고알려져있지만 7 치료후재발이흔하게일어나기 때문에실제치료효율은 -% 정도에불과하다 45-47. 따라서만성 C 형간염의치료효과를높이기위하여인터페론외에리바비린과같은새로 운약제의병합요법이이용되고있다. 그러나이러한병합요법의경우도 47% 정도의치료효과를보이고있을뿐이다 6-8, 이와같이치료효과를보 이는경우와그렇지못한경우의가장큰원인으로는 HCV 의유전자형이 거론되고있다 9. 한국에서가장흔한 HCV 유전자형은 b 로서전체의약 6-8% 를차 지한다 48,. 그런데이유전자형은치료효과가낮은것으로보고되고있 어문제가된다. 인터페론과리바비린을이용한병합요법은환자의입장에 서볼때치료비가많이들고, 환자에게육체적인고통을요구하는여러 8
가지부작용이나타날수있다는사실이이치료방법을선택하기에큰부담으로작용하고있다. 현재까지치료효과의예측인자에대한연구는크게환자측면과바이러스측면으로진행되고있는데, 각나라연구진에따라그상관관계가다르게나타나고있으며 -3, 이차이가유전적으로종족별차이인지인종별차이때문인지는아직규명되지않고있다. ISDR은 HCV b형유전자의 NS5A 부위에위치하는서열로서인터페론에대한치료효과예측인자로서알려져있다 5. 일본에서처음발표한논문에의하면이부위의아미노산에변이가존재하게되면인터페론단독치료에의한치료효과가높게나타난다고한다. 즉 HCV b형바이러스에의한만성간염의경우 ISDR 부위의아미노산변이개수가증가할수록인터페론에의한치료효과가높게나타난다고보고되었다 5, 5. 한편미국과유럽에서이루어진연구결과에의하면 ISDR 부위의아미노산변이개수와치료효과와의연관성이낮은것으로확인되었다, 3, 46, 5-. 이러한차이점의원인을찾기위해서미국과유럽에서는대규모의코호트연구를시작하였으며, 그결과유럽과미국에서확인된 HCV type 형의경우 ISDR 부위의변이가드물게나타나는것을알수있었다 56-6. 한편각지역별로인터페론을이용한치료방식의차이때문에 ISDR과치료효과의연관성이다르게나타나는이유가될수도있다. 그러나치료방식과지역적인차이에대한원인은아직정확히모르고있다. 즉 ISDR 부위의아미노산변이개수가적은경우에는인터페론치료효과와의연관성을설명하기에는어려움이있다. 최근에는 HCV E 부위의 PePHD에서아미노산변이가발견되었고 4, 인터페론치료에대한반응예측인자로서연구되고있다 9, 6. 그러나 HCV a 형과 b 형의경우에 PePHD 부위의변이와치료효과가연관성이있는것으로보고되었고 6, 63, HCV b 형과 3a 형의경우에치료효과와의연관성이낮은것으로보고되었다 6, 64-66. 국내에서의치료효과예측인자에대한연구는 년도에 ISDR과인터페론단독치료에대한 9
상관관계여부가보고되었으나그연관성은낮은것으로확인되었다 67. 한편이논문에서이용한 C형간염환자의시료수는모두 개였으며, 이후인터페론과리바비린병합요법에의한치료방식이도입되었고현재까지병합요법에서환자의나이, 치료전 HCV RNA titer, ALT 수치, ISDR type, PePHD 부위의변이여부등여러가지예측인자들에대한종합적인분석은이루어지지않았다. 본연구에서는만성 C형간염환자에서인터페론과리바비린병합요법에대한치료효과와 ISDR을중심으로한여러가지예측인자들의상관관계를확인하고자하였다. 인터페론과리바비린을 6개월동안병합치료후치료효과를얻은군과치료효과를얻지못한군을비교한결과, 환자들의나이가적을수록, 치료전 HCV RNA titer가낮을수록치료효과가좋은것으로확인되었다. 치료전 HCV RNA titer는치료효과와연관성이깊은것으로알려져있었으며 68, 환자의나이는본실험에서두그룹간에유의한차이를보이는것으로확인되었다 (Table 5). ISDR type에대한분석결과는 mutant type의경우치료가능성이더큰것으로확인되었으며, 이러한결과는국내에서보고된결과와는다소상반된것으로볼수있다. 한편일본의경우 HCV b 형의 ISDR type과치료효과와의상관관계는유럽의경우와비교하여매우큰것으로보고되고있으며 69, 본연구결과에서는국내의 HCV b 형의경우도일본의경우와유사한특징을갖는것으로확인되었다. 이전에수행된국내연구결과와의차이점은인터페론만을이용한단독치료방법을사용하였고실험대상자의수가적은것을들수있다. 또한본실험에서 HCV E의 PePHD 부위에존재하는아미노산변이여부를확인해본결과치료효과를얻은군과치료효과를얻지못한군의관계에서통계적으로유의한차이점을확인할수없었다. 그러나특이한점은치료효과를보인실험군에서만 ~개의아미노산변이가확인되었다는점이다. PePHD에대한이전실험결과들중이부위의아미
노산들이매우보존적이라는보고가있었으며 8, 7, 본연구결과도이와유사한결과를확인할수있었다. 이부위가인터페론과리바비린병합치료효과와의연관성은통계적으로낮게나타났지만변이발생이치료효과를증가시킬가능성에대해서는더많은연구가필요하다. ISDR 부위의아미노산변이가어떤방식으로인터페론에의한치료효과에영향을주는지에대해서는아직잘모르고있다. 그러나 NS5A가 in vitro 에서 PKR과결합에의해서 PKR의활성을저해하며, 특히 ISDR 부위의변이가존재할경우 PKR 과의결합이일어나지않는다는보고가있었다 7. 만일 PKR과 NS5A의결합에의해서 PKR의기능이억제될경우항바이러스작용을제대로할수없게될것이다. 그리고 NS5A 내의 ISDR 변이정도에따라서인터페론치료에대한치료효과가향상된다는보고도있었다 9-, 57-59. 결국 ISDR 부위의변이가존재하지않는 NS5A 가인터페론에의한항바이러스작용을억제할수있다고볼수있다. 이러한특징은특히 b 형의경우 a 형보다더크게나타난다는보고도있다 7, 73. 이외에 in vitro에서 NS5A를과발현시킨 HeLa 세포에서 IL-8의발현이증가되어인터페론의작용을저해한다는보고가있었으며 74, 실제 HCV b 형간염환자들의혈청내 IL-8의농도가낮은경우인터페론치료효과가높게나타나는것이확인되기도하였다 75. 이러한사실들을종합해볼때 ISDR 부위에변이가존재하는 NS5A의경우환자측면에서일어나는항바이러스작용이잘일어날수있음을추측할수있다. 지금까지만성 C형간염환자에대한인터페론과리바비린의병합요법이시작된후인터페론의단독치료에비해치료성적이향상되었지만 HCV b 형에대한치료효율은여전히낮은상태이다. 최근인터페론의반감기를향상시킨페그인터페론 (PEG-IN) 이출시되면서페그인터페론과리바비린의병합요법이이용되어좋은치료효과를보여주고있지만몇가지문
제점이제시되고있다. 즉약제의반감기가길어지면서치료효과가좋아지기는했지만새로운약제사용으로인한가격상승, 주사제이므로사용이편리하지않은점, 부작용이개선되지않은점등이그것이다. 아직도치료에대해서반응이없는환자가 45% 내외로높고 76 이들에대한효과적인치료법이없다는점이문제점으로제시되고있다. 결국효과적인치료제및치료법의등장이절실히요구되고있다. 치료효율의향상을위한한방법으로치료가능한예측인자들을비교하여치료전에치료의가능성을확인할수있는방법을제시할수있다면경제적사회적으로많은도움이될것이다. 본연구에서는 5명의치료자를대상으로각각의치료예측인자와치료효과의연관성을비교해보았다. 그리하여 b형만성 C형간염환자에서인터페론과리바비린병합요법의치료효율을향상시킬수있는예측인자들의확인을통해서치료대상자를선별할수있는방법을찾아내고자했다. 연구결과환자의나이, 치료전 HCV RNA titer, ISDR type은각각독립적으로예측인자로서의가능성을확인하였지만, 실제임상에적용하기위해서는 3가지예측인자들의종합적인연관성여부가통계적으로확인되어야할것이다. 이를위해서는좀더큰집단에서의연구가이루어져야할필요가있으며, 치료지침이될수있는기준이확립되어야할것이다. 본연구결과는 HCV b형만성 C형간염환자에서인터페론과리바비린병합요법의치료효율을향상시킬수있는예측인자들의확인을통해서치료대상자의선별에유용한참고자료로활용될수있으리라사료된다.
Ⅴ. 결론 HCV b형만성 C형간염환자들을대상으로인터페론과리바비린을 6 개월동안병용투여한후치료효과를얻은군과치료효과를얻지못한군의혈청을대상으로 HCV RNA의 PePHD와 ISDR 부위의염기서열을비교분석하여다음과같은결과를얻었다.. 환자의나이, 치료전 HCV RNA titer, ISDR type 은 HCV b 형만성 C 형간염에서인터페론과리바비린병합요법치료효과의예측인자로 이용될수있다.. HCV E의 PePHD 부위아미노산변이는치료효과를얻은 A 군에서총 8 명의환자에서 ~개의변이가발견되었으며, 치료효과를얻지못한 B 군에서는아미노산변이가확인되지않았으나통계적으로유의한차이는없었다. 3. 인터페론과리바비린병합요법치료효과에대한예측인자로서환자의나이, 치료전 HCV RNA titer를고려하여볼때 mutant ISDR type의 odds ratio는 8. 이었고, 95 % confidence interval은.5~6.6 로확인되었다. 이상의결과들로부터 HCV b형만성 C형간염환자에대하여인터페론과리바비린병합요법의치료효과에대한예측인자들은환자의나이, 치료전 HCV RNA titer, ISDR type 이사용될수있음을확인할수있었다. 치료효과를얻은실험군에서환자의나이가치료효과를얻지못한실험군에비해낮게나타났으며, 병합치료전 HCV RNA titer도치료효과를 3
얻은실험군에서낮게나타났다. ISDR type에따라서환자들의치료효과를구분하여볼때, mutant type에서병합요법에의한치료가능성이높게나타남을알수있다. 특히예측인자로확인된환자의나이와치료전 HCV RNA titer를고려하여 ISDR type과치료가능성을비교해볼때 mutant type에서인터페론과리바비린병합요법에의한치료가능성은 wild type에비해서 8. 배로확인되었다. 4
참고문헌. Alter J, argolis HS, Krawczynski K, Judson N, ares A, Alexander WJ, et al. The natural history of communityacquired hepatitis C in the United States. The Sentinel Counties Chronic non-a, non-b Hepatitis Study Team. N Engl J ed 99;37:899-95.. Takahashi, Yamada G, iyamoto R, Doi T, Endo H, and Tsuji T. Natural course of chronic hepatitis C. Am J Gastroenterol 993;88:4-43. 3. Lauer G and Walker BD. Hepatitis C virus infection. N Engl J ed ;345:4-5. 4. Kim BS and Park Y. Prevalence of hepatitis c virus related to liver diseases in Korea. Gastroenterologia Japonica 993;8:7-. 5. Alter J, Kruszon-oran D, Nainan OV, cquillan G, Gao, oyer LA, et al. The prevalence of hepatitis C virus infection in the United States, 988 through 994. N Engl J ed 999;34:6-56. 6. Lai Y, Kao JH, Yang P, Wang JT, Chen PJ, Chan KW, et al. Long-term efficacy of ribavirin plus interferon alfa in the treatment of chronic hepatitis C. Gastroenterology 996;:37-3. 7. chutchison JG, Gordon SC, Schiff ER, Shiffman L, Lee W, Rustgi VK, et al. Interferon alfa-b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. 5
Hepatitis Interventional Therapy Group. N Engl J ed 998;339:485-. 8. Poynard T, arcellin P, Lee SS, Niederau C, inuk GS, Ideo G, et al. Randomised trial of interferon alphab plus ribavirin for 48 weeks or for 4 weeks versus interferon alphab plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group (IHIT). Lancet 998;35:46-43. 9. artinot-peignoux, arcellin P, Pouteau, Castelnau C, Boyer N, Poliquin, et al. Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. Hepatology 995;:5-56.. Chang YJ and Byun KS. Treatment of chronic hepatitis C. Korean J Gastroenterol 4;44:3-37.. Khorsi H, Castelain S, Wyseur A, Izopet J, Canva V, Rombout A, et al. utations of hepatitis C virus b NS5A 9-48 amino acid sequence do not predict the response to recombinant interferon-alfa therapy in rench patients. J Hepatol 997;7:7-77.. Squadrito G, Orlando E, Cacciola I, Rumi G, Artini, Picciotto A, et al. Long-term response to interferon alpha is unrelated to 'interferon sensitivity determining region' variability in patients with chronic hepatitis C virus-b infection. J Hepatol 999;3:3-7. 6
3. Chung RT, onto A, Dienstag JL, and Kaplan L. utations in the NS5A region do not predict interferon-responsiveness in American patients infected with genotype b hepatitis C virus. J ed Virol 999;58:3-358. 4. Davis GL. Prediction of response to interferon treatment of chronic hepatitis C. J Hepatol 994;:-3. 5. Enomoto N, Sakuma I, Asahina Y, Kurosaki, urakami T, Yamamoto C, et al. utations in the nonstructural protein 5A gene and response to interferon in patients with chronic hepatitis C virus b infection. N Engl J ed 996;334:77-8. 6. Enomoto N, Sakuma I, Asahina Y, Kurosaki, urakami T, Yamamoto C, et al. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus b. Sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J Clin Invest 995;96:4-3. 7. Gale, Jr., Blakely C, Kwieciszewski B, Tan SL, Dossett, Tang N, et al. Control of PKR protein kinase by hepatitis C virus nonstructural 5A protein: molecular mechanisms of kinase regulation. ol Cell Biol 998;8:58-58. 8. Gale, Jr., Kwieciszewski B, Dossett, Nakao H, and Katze G. Antiapoptotic and oncogenic potentials of hepatitis C virus are linked to interferon resistance by viral repression of the PKR protein kinase. J Virol 999;73:656-656. 9. Kurosaki, Enomoto N, urakami T, Sakuma I, Asahina Y, Yamamoto C, et al. Analysis of genotypes and amino acid 7
residues 9 to 48 of the NS5A region of hepatitis C virus in relation to the response to interferon-beta therapy. Hepatology 997;5:75-7.. Komatsu H, ujisawa T, Inui A, iyagawa Y, and Onoue. utations in the nonstructural protein 5A gene and response to interferon therapy in young patients with chronic hepatitis C virus b infection. J ed Virol 997;:36-365.. Chayama K, Tsubota A, Kobayashi, Okamoto K, Hashimoto, iyano Y, et al. Pretreatment virus load and multiple amino acid substitutions in the interferon sensitivity-determining region predict the outcome of interferon treatment in patients with chronic genotype b hepatitis C virus infection. Hepatology 997;5:745-7.. ajor E and einstone S. The molecular virology of hepatitis C. Hepatology 997;5:57-8. 3. orns X and Bukh J. The molecular biology of hepatitis C virus. Genotypes and quasispecies. Clin Liver Dis 999;3:693-76, vii. 4. Taylor DR, Shi ST, Romano PR, Barber GN, and Lai. Inhibition of the interferon-inducible protein kinase PKR by HCV E protein. Science 999;85:7-. 5. Taylor DR, Tian B, Romano PR, Hinnebusch AG, Lai, and athews B. Hepatitis C virus envelope protein E does not inhibit PKR by simple competition with autophosphorylation sites in the RNA-binding domain. J Virol ;75:65-73. 6. Abid K, Quadri R, and Negro. Hepatitis C virus, the E 8
envelope protein, and alpha-interferon resistance. Science ;87:5. 7. Berg T, as arques A, Hohne, Wiedenmann B, Hopf U, and Schreier E. utations in the E-PePHD and NS5A region of hepatitis C virus type and the dynamics of hepatitis C viremia decline during interferon alfa treatment. Hepatology ;3:386-395. 8. Polyak SJ, Nousbaum JB, Larson A, Cotler S, Carithers RL, Jr., and Gretch DR. The protein kinase-interacting domain in the hepatitis C virus envelope glycoprotein- gene is highly conserved in genotype -infected patients treated with interferon. J Infect Dis ;8:397-44. 9. Sarrazin C, Kornetzky I, Ruster B, Lee JH, Kronenberger B, Bruch K, et al. utations within the E and NS5A protein in patients infected with hepatitis C virus type 3a and correlation with treatment response. Hepatology ;3:36-37. 3. oy E, Li K, Wang C, Sumpter R, Jr., Ikeda, Lemon S, et al. Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science 3;3:45-48. 3. Cotler SJ, Wartelle C, Larson A, Gretch DR, Jensen D, and Carithers RL, Jr. Pretreatment symptoms and dosing regimen predict side-effects of interferon therapy for hepatitis C. J Viral Hepat ;7:-7. 3. Haeuber D. Recent advances in the management of biotherapyrelated side effects: flu-like syndrome. Oncol Nurs orum 989;6:35-4. 9
33. Chutaputti A. Adverse effects and other safety aspects of the hepatitis C antivirals. J Gastroenterol Hepatol ;5 Suppl:E56-63. 34. Van der Poel CL, Cuypers HT, Reesink HW, Weiner AJ, Quan S, Di Nello R, et al. Confirmation of hepatitis C virus infection by new four-antigen recombinant immunoblot assay. Lancet 99;337:37-39. 35. Sambrook J, ritsch E, aniatis T. Amplification of DNA generated by reverse transcription of mrna. In: Sambrook J, ritsch E, aniatis T eds. olecular Cloning, A laboratory anual. New York, Cold Spring Harbor Laboratory; 989a. p.4.-4.. 36. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, et al. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 99;73(Pt3):673-679. 37. Choo SH, So HS, Cho J, and Ryu WS. Association of hepatitis C virus particles with immunoglobulin: a mechanism for persistent infection. J Gen Virol 995;76(Pt 9):337-34. 38. Villarejos V, Visona KA, Eduarte CA, Provost PJ, and Hilleman R. Evidence for viral hepatitis other than type A or type B among persons in Costa Rica. N Engl J ed 975;93:35-35. 39. Jeffers LJ, Hasan, De edina, Reddy R, Parker T, Silva, et al. Prevalence of antibodies to hepatitis C virus among patients with cryptogenic chronic hepatitis and cirrhosis. 3
Hepatology 99;5:87-9. 4. Uchida T, Shimojima, Gotoh K, Shikata T, Tanaka E, and Kiyosawa K. "Silent" hepatitis B virus mutants are responsible for non-a, non-b, non-c, non-d, non-e hepatitis. icrobiol Immunol 994;38:8-85. 4. Uchida T, Shimojima S, Gotoh K, Shikata T, and ima S. Pathology of livers infected with "silent" hepatitis B virus mutant. Liver 994;4:5-56. 4. Linnen J, Wages J, Jr., Zhang-Keck ZY, ry KE, Krawczynski KZ, Alter H, et al. olecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 996;7:-58. 43. Alberti A, Chemello L, Cavalletto D, Tagger A, Dal Canton A, Bizzaro N, et al. Antibody to hepatitis C virus and liver disease in volunteer blood donors. Ann Intern ed 99;4:-. 44. Esteban JI, Lopez-Talavera JC, Genesca J, adoz P, Viladomiu L, uniz E, et al. High rate of infectivity and liver disease in blood donors with antibodies to hepatitis C virus. Ann Intern ed 99;5:443-4. 45. Davis GL, Balart LA, Schiff ER, Lindsay K, Bodenheimer HC, Jr., Perrillo RP, et al. Treatment of chronic hepatitis C with recombinant interferon alfa. A multicenter randomized, controlled trial. Hepatitis Interventional Therapy Group. N Engl J ed 989;3:5-56. 46. Hofgartner WT, Polyak SJ, Sullivan DG, Carithers RL, Jr., and 3
Gretch DR. utations in the NS5A gene of hepatitis C virus in North American patients infected with HCV genotype a or b. J ed Virol 997;:8-6. 47. Poynard T, Leroy V, Cohard, Thevenot T, athurin P, Opolon P, et al. eta-analysis of interferon randomized trials in the treatment of viral hepatitis C: effects of dose and duration. Hepatology 996;4:778-789. 48. Lee DS, Sung YC, and Whang YS. Distribution of HCV genotypes among blood donors, patients with chronic liver disease, hepatocellular carcinoma, and patients on maintenance hemodialysis in Korea. J ed Virol 996;:-6.. Yeh BI, Kim HW, Kim HS, Lee JY, Lee KH, Lee K, et al. The prediction of interferon-alpha therapeutic effect by sequence variation of the HCV hypervariable region. Yonsei ed J 999;4:43-438. 5. Enomoto N, Sakuma I, Asahina Y, Kurosaki, urakami T, Yamamoto C, et al. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus b. Sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. Journal of Clinical Investigation 995;96:4-3. 5. Enomoto N, Sakuma I, Asahina Y, Kurosaki, urakami T, Yamamoto C, et al. utations in the nonstructural protein 5A gene and response to interferon in patients with chronic hepatitis C virus b infection. New England Journal of edicine 996;334:77-8. 3
5. Squadrito G, Leone, Sartori, Nalpas B, Berthelot P, Raimondo G, et al. utations in the nonstructural 5A region of hepatitis C virus and response of chronic hepatitis C to interferon alfa. Gastroenterology 997;3:567-57.. Zeuzem S, Lee JH, and Roth WK. utations in the nonstructural 5A gene of European hepatitis C virus isolates and response to interferon alfa. Hepatology 997;5:74-744.. Odeberg J, Yun Z, Sonnerborg A, Weiland O, and Lundeberg J. Variation in the hepatitis C virus NS5a region in relation to hypervariable region heterogeneity during interferon treatment. J ed Virol 998;56:33-38.. ckechnie V, ills PR, and ccruden EA. The NS5a gene of hepatitis C virus in patients treated with interferon-alpha. J ed Virol ;6:367-378. 56. Pawlotsky J, Germanidis G, Neumann AU, Pellerin, rainais PO, and Dhumeaux D. Interferon resistance of hepatitis C virus genotype b: relationship to nonstructural 5A gene quasispecies mutations. J Virol 998;7:795-85. 57. Saiz JC, Lopez-Labrador X, Ampurdanes S, Dopazo J, orns X, Sanchez-Tapias J, et al. The prognostic relevance of the nonstructural 5A gene interferon sensitivity determining region is different in infections with genotype b and 3a isolates of hepatitis C virus. J Infect Dis 998;77:839-847. 58. Sarrazin C, Berg T, Lee JH, Teuber G, Dietrich C, Roth WK, et al. Improved correlation between multiple mutations within the NS5A region and virological response in European patients 33
chronically infected with hepatitis C virus type b undergoing combination therapy. J Hepatol 999;3:4-3. 59. Sarrazin C, Berg T, Lee JH, Ruster B, Kronenberger B, Roth WK, et al. utations in the protein kinase-binding domain of the NS5A protein in patients infected with hepatitis C virus type a are associated with treatment response. J Infect Dis ;8:43-44. 6. Witherell GW and Beineke P. Statistical analysis of combined substitutions in nonstructural 5A region of hepatitis C virus and interferon response. J ed Virol ;63:8-6. 6. Chayama K, Suzuki, Tsubota A, Kobayashi, Arase Y, Saitoh S, et al. Association of amino acid sequence in the PKReI phosphorylation homology domain and response to interferon therapy. Hepatology ;3:38-44. 6. Saito T, Ito T, Ishiko H, Yonaha, orikawa K, iyokawa A, et al. Sequence analysis of PePHD within HCV E region and correlation with resistance of interferon therapy in Japanese patients infected with HCV genotypes a and b. Am J Gastroenterol 3;98:377-383. 63. Watanabe H, Nagayama K, Enomoto N, Itakura J, Tanabe Y, Sato C, et al. Amino acid substitutions in PKR-eI phosphorylation homology domain (PePHD) of hepatitis C virus E protein in genotype a/b and b in Japan and interferon efficacy. Hepatol Res 3;6:68-74. 64. Berg T, arques A, Hohne, Wiedenmann B, Hopf U, and Schreier E. utations in the E-PePHD and NS5A region of 34
hepatitis C virus type and the dynamics of hepatitis C viremia decline during interferon alfa treatment. Hepatology ;3:386-395. 65. Polyak SJ, Nousbaum JB, Larson A, Cotler S, Carithers R.L, Jr., and Gretch DR. The protein kinase-interacting domain in the hepatitis C virus envelope glycoprotein- gene is highly conserved in genotype -infected patients treated with interferon. J Infect Dis ;8:397-44. 66. Sarrazin C, Kornetzky I, Ruster B, Lee JH, Kronenberger B, Bruch K, et al. utations within the E and NS5A protein in patients infected with hepatitis C virus type 3a and correlation with treatment response. Hepatology ;3:36-37. 67. Bae SH, Park Y, Yoo DG, Choi JY, Byun BH, Yang J, et al. utations of hepatitis C virus b NS5A 9-48 amino acid sequence is not a predictive factor for response to interferonalpha therapy and development of hepatocellular carcinoma. J Korean ed Sci ;5:-58. 68. Yeh BI, Han KH, Lee HW, Sohn JH, Ryu WS, Yoon DJ, et al. actors predictive of response to interferon-alpha therapy in hepatitis C virus type b infection. J ed Virol ;66:48-487. 69. Nakano I, ukuda Y, Katano Y, Nakano S, Kumada T, and Hayakawa T. Why is the interferon sensitivity-determining region (ISDR) system useful in Japan? J Hepatol 999;3:4-. 7. Hung CH, Lee C, Lu SN, Lee J, Wang JH, Tung HD, et al. 35
utations in the NS5A and E-PePHD region of hepatitis C virus type b and correlation with the response to combination therapy with interferon and ribavirin. J Viral Hepat 3;:87-94. 7. Gale J, Jr., Korth J, and Katze G. Repression of the PKR protein kinase by the hepatitis C virus NS5A protein: a potential mechanism of interferon resistance. Clin Diagn Virol 998;:57-6. 7. Paterson, Laxton CD, Thomas HC, Ackrill A, and oster GR. Hepatitis C virus NS5A protein inhibits interferon antiviral activity, but the effects do not correlate with clinical response. Gastroenterology 999;7:87-97. 73. Polyak SJ, Paschal D, cardle S, Gale J, Jr., oradpour D, and Gretch DR. Characterization of the effects of hepatitis C virus nonstructural 5A protein expression in human cell lines and on interferon-sensitive virus replication. Hepatology 999;9:6-7. 74. Polyak SJ, Khabar KS, Paschal D, Ezelle HJ, Duverlie G, Barber GN, et al. Hepatitis C virus nonstructural 5A protein induces interleukin-8, leading to partial inhibition of the interferon-induced antiviral response. J Virol ;75:695-66. 75. ihm U, Herrmann E, Sarrazin U, von Wagner, Kronenberger B, Zeuzem S, et al. Association of serum interleukin-8 with virologic response to antiviral therapy in patients with chronic hepatitis C. J Hepatol 4;4:845-85. 36
76. Hadziyannis SJ, Sette H, Jr., organ TR, Balan V, Diago, arcellin P, et al. Peginterferon-alphaa and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern ed 4;4:346-3. 37
Abstract The relationship between ISDR sequences and interferon- ribavirin combination therapy in chronic hepatitis C patients Joonho Yoon Department of edicine The Graduate School, Yonsei University (Directed by Professor Byung-Il Yeh) Interferon-α (IN-α) and ribavirin combination therapy is a treatment currently available for chronic hepatitis C virus (HCV), but is not so effective for a number of patients. In addition, this treatment is so costly and provokes many side-effects. Therefore, it s very important to distinguish those patients for whom the combination therapy would be effective before beginning the treatment. One of the Japanese scientists found a small region of the nonstructural protein 5A (NS5A) gene product of HCV is correlated with the IN responsiveness and named this sequence interferon sensitivity determining region (ISDR). any researchers reported similar results, while other studies concluded this correlation meaningless. This study was performed to confirm such a correlation in Korean patients with chronic hepatitis C virus type b and to find the 38
predictive factors for interferon-α and ribavirin combination therapy. The patients are grouped by effectiveness of this therapy. Group A consists of completely responded patients for chronic hepatitis and group B no-responded patients. This study focused on clinical findings and ISDR sequences, and we found age, HCV RNA titer before treatment and ISDR type may be used as predictive factors for interferon-α and ribavirin combination therapy. After adjustment of age and HCV RNA titer before treatment, the ISDR sequence may be a more potent predictive factor. If these factors are used to predict the effectiveness of interferon-α and ribavirin combination therapy, it would be very helpful for patients. Key words: hepatitis c virus, interferon-α, ribavirin, interferon sensitivity determining region (ISDR), predictive factor 39