The Korean Journal of Pathology 2008; 42: 202-7 젊은여성에게발생한자궁내막암종에서의현미부수체불안정성분석 이향임 최가원 최진 김규래 울산대학교의과대학서울아산병원병리과 접수 : 2008년 3월 28일게재승인 : 2008년 7월 25일 책임저자 : 김규래우 138-736 서울시송파구풍납동 388-1 울산의대서울아산병원병리과전화 : 02-3010-4514 Fax: 02-472-7898 E-mail: krkim@amc.seoul.kr Microsatellite Instability in Endometrial Adenocarcinomas of Young Women Hyang-Im Lee, Ga-Won Choi, Jene Choi and Kyu-Rae Kim Department of Pathology, Ulsan University College of Medicine, Asan Medical Center, Seoul, Korea Background : The correlation between microsatellite instability (MSI) and the prognosis of patients with endometrial carcinomas is controversial. The endometrial carcinomas in the young adult group usually have an excellent prognosis, and these tumors might have a different frequency of MSI compared with those in old women. Further, the pathogenetic mechanisms of the two groups might be different. We investigated the frequency of MSI in the endometrial cancers of patients who were under the age of 40 and we correlated the frequency with other prognostic factors. Methods : MSI analyses were performed using 5 primers (BAT25, BAT26, D2S123, D5S346 and D17S250) and with using the genomic DNA obtained from the paraffin embedded tumor and the paired normal tissues. Results : All 23 cases we examined exhibited endometrioid adenocarcinomas, and most of them were of the low international federation of gynecologists and obstetricians (FIGO) stage (stage I: 22, IIB: 1); 78% were microsatellite stable and 22% were MSI-low; an abnormal peak was present at only one marker, and any case of MSI-high was not identified. The FIGO stages of the 5 MSI-low cases were variable. Conclusions : The frequency of MSI in the endometrial cancers of young patients is not significantly different from the frequencies reported for all age groups in the previous studies, MSI-low does not seem to be related to the other poor prognostic parameters, although the number of cases we studied is insufficient to draw any firm conclusion. Key Words : Endometrium; Carcinoma; MSI; Young women 현미부수체 (microsatellite) 란인체의유전자전체에걸쳐 6개이하의짧은 DNA 염기서열이순차적으로반복하여배열되어있는형태를말하는데, 이들은각염색체위에서서로다른반복횟수를가지고산재해있다. 현재인간의유전자에는약 30,000개정도의현미부수체가존재하는데, 이들은반복단위의수에따라길이가서로다른다수의대립유전자를생산한다. 1,2 한편현미부수체불안정성 (microsatellite instability, MSI) 은현미부수체를이루고있는단순반복된짧은염기배열 (short tandem repeat sequence) 이증가하거나감소하면서나타나는길이의다양성을의미하는데, 이는 hmsh2, hmlh1, hmsh6, hpms1, hpms2 등부조화복구유전자 (mismatch repair gene; MMR gene) 에의한종자선돌연변이 (germline mutation) 나 promotor 메틸화에의한복제이상 (replication errors) 에의해길이가변화한다. 그런데이러한변화들은단순반복염기배열을가진 TGFBII, IGFIIR, BAX, hmsh3, hmsh6 등의유전자에 frameshift 돌연변이를유발케하여특정한종양의발생을증가시킨다고알려져있다. 3,4 이러한 MSI는유전성비용종성대장암 (hereditary nonpolyposis colorectal cancer, HNPCC) 증후군환자에게서처음으로발견되었는데, 유전성비용종성대장암환자의약 90% 가이 MSI 를가지고있다고보고되어있다. 특히대장암가운데 MSI(+) 종양들은 MSI(-) 종양에비해임상적으로젊은나이에더자주발생하며 ( 평균연령 44세 ), 5 낮은림프선전이율과점액성의조직학적세포유형을가진다. 또한이들은근위성대장에주로호발하는특징이있으며, 높은생존율을보여비교적예후가좋은종양의지표로알려져있고 6 항암제효과와도연관이있다는보고가있다. 7 이 MSI는유전성비용종성대장암이외에도다양한종양에서발견되는데, 특히유전성비용종성대장암증후군을가진환자에게가장자주동반되는자궁내막암에서 MSI(+) 가 75% 202

젊은여성에게발생한자궁내막암종에서의현미부수체불안정성 203 이상의높은빈도로발현되고있고, 8,9 유전성비용종성대장암의가족력이없는산발성대장암과산발성자궁내막암등에서도 MSI(+) 가존재하는것으로밝혀졌다. 10 특히외국의경우산발성자궁내막암에서 MSI(+) 를가진예가약 10-40% 의빈도로다양하게보고되어있으며, 11,12 최근한국인의산발성자궁내막암종에서도 20-24% 의예가보고된바있다. 13,14 유전성비용종성대장암증후군을가진환자에게동반된자궁내막암종에서의 MSI는유전성비용종성대장암에서와마찬가지로발현빈도가높을뿐아니라, 비교적젊은층에서호발하며 ( 평균나이 : 46.8세 ), 낮은임상적병기와낮은조직학적등급을가지는등종양의양호한예후인자를보임으로써 15 유전성비용종성대장암에서보고된것과마찬가지로 16 양호한예후인자로서작용할것이라고생각할수있다. 그러나최근의문헌에서는이와상반된결과도보이고있어 13 MSI(+) 와예후와의관계는아직확실하게정립되어있지않다고볼수있다. 한편자궁내막암종은대부분폐경기인 50-60대에주로발생하며, 40대이전에발생하는빈도는 1-8% 로비교적드문것으로알려져왔으나, 17,18 최근국내보고에따르면 40대이전에자궁내막암종이발생하는빈도가약 13-18% 로늘어젊은여성의자궁내막암종이폐경기이후에나타나는것보다빠르게증가하고있는것으로나타나고있다. 19,20 따라서본연구에서는젊은여성에게발생하는자궁내막암종의특성, 발생원인및예후인자를분석할필요가있다고생각되어, 유전성비용종성대장암의가족력이없는 40대이전의젊은여성에게서발생한자궁내막암종을대상으로 DNA 현미부수체표지자를이용한 MSI 표현빈도를조사하고, 이들을현재까지알려진예후인자들과비교함으로써 MSI가젊은여성에게발생한산발성자궁내막암종에서예후인자로서의역할을할수있는지를알아보고자하였다. 재료와방법연구재료본연구는 1999년 1월부터 2005년 12월까지서울아산병원에 서자궁내막암종으로진단받고전자궁절제술을받은 40세이하의환자 48명의조직가운데, 파라핀블록보관상태가양호하며정상조직과종양조직을모두포함하고있는 24예를대상으로하였으며, 모두의무기록상유전성비용종성대장암증후군을가지고있지않음을확인하였다. 연구방법 DNA 추출정상조직과종양조직각각의포매블록에서 10 μm 두께로 15회박절하여탈파라핀화과정을거친후, 0.3 ml 의 DNA 용해액 (lysis buffer, 10mM Tris [ph8.0], 10 mm EDTA [ph 8.0], 0.5% SDS, 100 mm NaCl) 으로용해시키고, 7 μl proteinase K (20 mg/ml, GiBCO BRL) 를첨가하여 55 에서하룻밤반응시켜단백성분을분해하였다. 이때반응이끝난시료는끓는물에 10분간방치하여 proteinase K의반응을불활성화시킨후, 4 에서 5분동안 10,000 rpm으로원심분리시켜상층액을모았다. 그리고다시동량의 chloroform을첨가하여반응시킨뒤, 4 12,000 rpm으로 10분동안원심분리하여상층액을얻어냈다. 여기에추출된용액 1/2 분량의 7.5 M NH4AC을넣고두배의무수알코올을첨가하여 DNA를침전시킨다음이를 70% 알코올로세척한뒤말렸다. 그리고마지막으로이를적당량의멸균증류수로녹여분광광도계로농도를측정하였다. PCR 증폭현미부수체염기서열은 National Cancer Institute workshop 21 에서권장한 BAT25 (c-kit oncogene, 4q12), BAT26 (hmsh2, 2p16), D2S123(hMSH2, 2p16), D5S346 (APC, 5q21-22), D17S250 (17q11.2-12) 의 Bethesda panel을사용하였으며, 종양세포와정상세포에서추출한 DNA를주형으로각각 PCR을시행하였다. 이때각각의 PCR 용액은주형 DNA 1.5 μl (50 ng/μl), 10 buffer 1.0 μl, dntp 0.8 μl (200 μm), 10 pmol/l primer, 0.04 μl (5 U/μL) Taq polymerase 에증류수 2.66 μl 을첨가하여총 10 μl 가되게하였다. 또한 PCR은각표본에대하여 35주기를반복실시하였으며, 모든반 Table 1. DNA sequences of the primers for microsatellites Locus symbol Chromosome 5 end to 3 end Sequence D2S123 2p16 Upstream AAACAGGATGCCTGCCTT GGACTTTCCACCTATGGG D5S346 5q21-22 Upstream ACTCACTCTAGTGATAAATCG AGCAGATAAGACAGTATTACTAGTT D17S250 17q11.2-12 Upstream GGAAGAATCAAATAGACA GCTGGCCATATATATATTTAAA BAT25 4q12 Upstream TCGCCTCCAAGAATGTAA TCTGCATTTAACTATGGC BAT26 17q Upstream TGACTACTTTTGACTTCAG AACCATTCAACATTTTTAAC

204 이향임 최가원 최진외 1 인 응은 Thermal cycler에서시행하였다. 각주기에서의변성반응은 95 에서 30초, 결합반응은 48 에서 30초그리고연장반응은 72 에서 40초씩하고마지막주기의연장반응은 72 에서 10분간하였다. 그후증폭된 PCR 산물을 1:30으로희석한다음 10 μl 의혼합액 (hi-di formamide 9.95 μl+liz size standard 0.05 μl) 이들어있는 96 well plate tube에희석된 Table 2. Results of microsatellite instability analysis Patient MSI analysis BAT26 D5S346 BAT25 D17S250 D2S123 MS Status 1 - - - + - MSI-L 2 - - - - - MSS 3 + - - - - MSI-L 4 - - - + - MSI-L 5 - - - - + MSI-L 6 - - - - - MSS 7 - - - - - MSS 8 - - - - - MSS 9 - - - - + MSI-L 10 - - - - - MSS 11 - - - - - MSS 12 - - - - - MSS 13 - - - - - MSS 14 - - - - - MSS 15 - - - - - MSS 16 - - - - - MSS 17 - - - - - MSS 18 - - - - - MSS 19 - - - - - MSS 20 - - - - - MSS 21 - - - - - MSS 22 - - - - - MSS 23 - - - - - MSS MSI, microsatellite instability; MSI-L, MSI-low; MSS, microsatellite stable; +, presence of abnormal peak or frameshift; -, absence of abnormal peak or frameshift. PCR 산물을 1 μl 넣고 95 에서 2분간처리한후얼음에 1분간방치하고 ABI 3100 분석기에넣어전기영동을시행하였다. 각표지자들에대한염기쌍및서열은 Table 1과같다. Microsatellite instability 분석같은환자에게서추출한정상조직과비교하여종양조직에서상이한 peak가나오는경우를 MSI(+) 로판정하였으며, 상이한 peak가 2개이상의표지자에서나오는경우를 MSI-high (MSI- H) 로그리고단하나의표지자에서만나오는경우를 MSI-low (MSI-L) 로표시하였다. 22 또한대조군과비교하여상이한 peak 가보이지않는경우는현미부수체안정형 (microsatellite stable, MSS) 이라고하였으며, 정상조직과종양조직중어느하나에서라도 PCR이되지않아서유전자변이를확인할수없는경우는분석에서제외하였다. 통계처리통계학적분석은 FIGO 병기와조직학적등급그리고임상병리학적예후와관계되는인자들각각에대하여 MSI(+) 의빈도를백분율로분석하였으며, 각각에대하여 MSI(+) 빈도와의상관관계를 Fisher s exact test와 2 test를이용하여비교하였다. 결 PCR 산물을얻을수없었던 1예를제외한 23예의정상조직과종양조직을상호비교하여 5개의 DNA 현미부수체표지자에서 MSI(+) 를관찰한결과, 5예 (22%) 에서 MSI-L(+) 가관찰되었고, 나머지 18예에서는모두 MSS (78%) 를보였으며, MSI-H(+) 는단 1예에서도관찰되지않았다. MSI-L(+) 는 D17S250 표지자에서 2예, D2S123 표지자에서 2예, BAT26 표지자에서 1예가관찰되었다 (Table 2, Fig. 1). 과 Fig. 1. Microsatellite instability analysis electropherograms using 5 markers. The first row represents the graph of normal tissue and the second row represents the graph of tumor tissue of MSI-low phenotype. The tumor sample in this case shows alteration in the position of the peak at BAT26 locus, shown in blue, compared with the corresponding normal sample: BAT26 (FAM)-blue, D5S346 (VIC)-green, BAT25 (NED)-yellow (black), D17S250 (VIC)-green, D2S123 (FAM)-blue.

젊은여성에게발생한자궁내막암종에서의현미부수체불안정성 205 Table 3. Clinicopathologic characteristics according to MSI status in endometrioid type adenocarcinoma Parameter No MSI-low MSS p value Age (mean) 23 35 33 FIGO stage 0.173* Ia 10 1 9 Ib 9 2 7 Ic 3 2 1 IIb 1 0 1 Histologic grade 0.291 G1 18 3 15 G2 5 2 3 LVI 0.217 Negative 22 0 22 Positive 1 1 0 *, 2 test;, Fisher s exact test, p<0.05 MSI, microsatellite instability; FIGO, international federation of gynecologists and obstetricians; MSS, microsatellite stable; LVI, lymphovascular invasion. 본연구의대상이된모든증례들은고분화및중등도분화를보이는자궁내막모양샘암종이었고, 임상적병기에있어서는 FIGO 병기 IIB를보인 1예를제외하고는모두 FIGO 병기 I기에속하였다. 즉 MSI-L(+) 를보인 5예중에서 IC가 2예, IB가 2예그리고 IA가 1예였고, 이들의조직학적등급은 1을보인예가 3예, 등급 2를보인예가 2예였다. 그리고림프혈관강침범은 1예에서관찰되었다. 또한 MSI-L(+) 를보인 5예중 4예가 IB와 IC에속하여 IA 보다상대적으로높은임상병기를보였지만, 통계학으로유의한차이를발견할수는없었다 (p=0.173). 그리고조직학적등급과림프혈관강침범유무에따른 MSI의빈도에서도유의한차이를발견할수없었다 (Table 3). 고 자궁내막암에서 MSI 의예후인자로서의역할은아직명확하게밝혀져있지않다. 몇몇연구들에서자궁내막암에서의 MSI(+) 는대부분조직학적으로예후가좋은자궁내막모양샘암종에서나타났으며, 23 유두상장액성암종과같이예후가나쁜암종에서는거의관찰되지않았다. 23 또한예후인자로잘알려진 FIGO의수술적병기, 연령, 폐경유무, 조직학적세포유형, 세포분화도, 자궁근층의침윤여부, 림프혈관강침범등과도연관성이있다는문헌보고가있으나 24,25 이러한예후와의연관성은문헌마다상당한차이를보이고있다. Russell 등 15 은유전성비용종성대장암증후군에동반되는자궁내막암종은 MSI 빈도가높고, 비교적젊은층에호발하며낮은임상병기와낮은조직학적등급등양호한예후인자들의임상적특징을가지는반면, MLH1의과메틸화가관여하는산발성자궁내막암은주로폐경기인 50- 찰 60대에서발생하며 ( 평균연령 : 61.1), 50대이전에발생하는자궁내막암과비교하였을때보다높은임상적병기, 높은조직학적등급과연관성이있다고하였다. 15 또한최근에안등 13 도산발성자궁내막암종가운데자궁내막모양샘암종만을대상으로 MSI를조사한결과, MSI가양성인종양들은임상병리학적으로나쁜예후인자들, 즉높은조직학적등급, 림프혈관강침범, 자궁근층의침윤들을가지고있을뿐만아니라나쁜예후인자들로알려진 cyclin A, skp2와도깊은연관성이있음을보고하여 Russell 등 15 의연구와일치하는결과를보고하였다. 이와같이연구결과가문헌마다상당한차이를보이는것은아마도자궁내막암종을구성하는다양한조직학적유형들과유전학적인차이를고려하지않은결과로생각된다. 24,25 본연구에포함된자궁내막모양샘암종의대부분의증례들이 FIGO 제1병기의낮은병기와낮은조직학적등급에속하고증례수또한적어병기혹은예후와의상관관계를정확하게판단할수는없었지만, MSI-L(+) 를보인 5예가운데 4예가자궁근층에침윤을보이는 FIGO 병기 IB와 IC에속하고, FIGO 병기 IIB를보인 1예가 MSS를보였던점등은 MSI(+) 가예후와밀접한상관관계가없음을일부반영한것이라생각되며, 통계학적으로도임상적병기와조직학적등급에따른 MSI 빈도와의유의한차이를발견할수없었다. 또한산발성자궁내막암에서 MSI(+) 의빈도는 10-40% 로보고자들마다다양하고, 11,12 한국인을대상으로한문헌에서도약 20% 내외의빈도를보인다고보고되어있는데, 13,14 본연구에서도 MSI(+) 가 22% 에서관찰되어기존의문헌보고와빈도자체는크게다르지않음을알수있었다. 그러나많은문헌에서 2개이상의표지자에서양성을보이는예들만을 MSI(+) 로간주하였기에, 본연구에서그와같은기준을적용한다면예후가좋은것으로알려진젊은여성의자궁내막암에서의 MSI(+) 빈도는매우낮은것으로해석할수있다. 이미앞서언급하였듯이, 유전성비용종성대장암증후군환자에게서처음발견된 MSI는 MMR 유전자 ( 특히 hmlh1과 hmsh2) 의종자선돌연변이와밀접한관계에있으며, 산발성종양에서도발현된다고보고되어있다. 그러나유전성비용종성대장암증후군에서와는달리산발성자궁내막암에서는 MSH2 와 MLH1의종자선돌연변이는거의발견되지않고, 대부분이 MLH1의과메틸화가주원인인것으로보고되었다. 26,27 1983년에 Bockman 등이처음으로자궁내막암에서임상병리학적유형을제1형과제2형의 2가지로나누어기술한이후, Lax와 Kurman 28 은이 2가지형태의암종이각각다른기전에의하여발생한다고설명하였는데, 28 이들의모델에따르면하나는 PTEN-MSI와연관된 P53 비의존성기전 (PTEN-MSI-related, P53-independent pathway) 이고, 또다른하나는 PTEN- MSI와연관성이없는 P53 의존성기전 (PTEN-MSI-unrelated, P53-dependent pathway) 이다. 첫번째기전은주로제1형에해당하는자궁내막모양샘암종

206 이향임 최가원 최진외 1 인 의조직학적유형에해당하며, 두번째기전은제2형의유두상장액성자궁내막암종의조직학적유형에관여한다. 제1형의자궁내막모양샘암종의발생기전에는 MSI와 PTEN, k-ras 그리고 β-catenin 등의유전자들이서로연관성을가지며관여하는데, 그중에서도 MSI가주요한작용을한다. 그러나본연구에서는모든증례들이제1형에해당하는자궁내막샘모양의조직학적유형을가지고있었음에도불구하고, 종양발생에의미가있다고알려진 MSI-H(+) 는한예에서도관찰되지않았기에젊은여성에게발생한제1형의자궁내막암종은여태까지알려진제1 형의자궁내막암종의일반적인종양발생기전과다를가능성이있음을시사하고있다. 또한최근의문헌들은자궁내막암종과관련된또다른하나의 MMR 유전자변이로서 hmsh6와 MMR 유전자의체세포돌연변이를제시하였는데, 이들의보고에의하면 hmsh6와관련된자궁내막암에서는 MSI의양성비율이낮다고하였다. 29,30 결론적으로, 젊은여성에게발생하는제1형의산발성자궁내막암종의발병기전이 MLH1의과메틸화에의해발생하는산발성자궁내막암종과다를가능성이있으므로, 앞으로이에관한연구가필요하다고생각된다. 결 본연구결과, MSI(+) 가 40세이하의젊은여성들에게발생하는산발성자궁내막암종의약 22% 에서나타남으로써, 폐경기이후여성에게발생한예들이주로포함된기존연구결과와크게다르지않았으나, 기존의보고들과는달리 MSI-H(+) 가관찰되지않은것으로미루어볼때이제까지일반적으로알려진자궁내막모양샘암종과는다른발생기전을가질가능성이있다고생각된다. 또본연구의대부분의증례들이 FIGO 제1병기에속하여병기혹은예후와의상관관계를정확하게판단할수는없었으나, MSI-L(+) 를보인 5예가운데 4예가자궁근층에침윤을보이는 FIGO 병기 IB와 IC에속하였던점과 FIGO 병기 IIB의증례가 MSS를보였던점은 MSI(+) 가예후와크게상관관계가없음을나타내는것이라생각된다. 론 참고문헌 1. Weber JL, May PE. Abundant class of human DNA polymorphism which can be typed using the polymerase chain reaction. Am J Hum Genet 1989; 44: 388-96. 2. Charlesworth B, Sniegowski P, Stephan W. The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 1994; 371: 215-20. 3. Bronner CE, Baker SM, Morrison PT, et al. Mutation in the DNA mismatch repair gene homologue hmlh1 is associated with hereditary non-polyposis colon cancer. Nature 1994; 368: 258-61. 4. Matias-Guiu X, Catasus L, Bussaglia E, et al. Molecular pathology of endometrial hyperplasia and carcinoma. Hum Pathol 2001; 32: 569-77. 5. Vasen HF, Wijnen JT, Menko FH, et al. Cancer risk in families with hereditary nonpolyposis colorectal cancer diagnosed by mutation analysis. Gastroenterology 1996; 110: 1020-7. 6. Lunch HT, Smyrk TC, Watson P, et al. Genetics, natural history, tumor spectrum and pathology of hereditary nonpolypoid colorectal cancer. Gastroenterology 1993; 104: 1535-49. 7. Klump B, Nehls O, Okech T, et al. Molecular lesions in colorectal cancer: impact on prognosis?: original data and review of the literature. Int J Colorectal Dis 2004; 19: 23-42. 8. Lui B, Parsons R, Papadopoilos N, et al. Analysis of mismatch repair genes in hereditary non-polyposis colorectal cancer patients. Nat Med 1996; 2: 169-74. 9. Risinger JL, Berchuck A, Kohler MF, Watson P, Lunch HT, Boyd J. Genetic instability of microsatellites in endometrial carcinoma. Cancer Res 1993; 53: 5100-3. 10. Doggan BD, Felix JC, Muderspach LI, Tourgeman D, Zheng J, Shibata D. Microsatellite instability on sporadic endometrial carcinoma. J Natl Cancer Inst 1994; 86: 1216-21. 11. Sirchia SM, Pariani S, Rossella F, et al. Cytogenetic abnormalities and microsatellite instability in endometrial adenocarcinoma. Cancer Genet Cytogenet 1997; 94: 113-9. 12. Berends MJ, Hollema H, Wu Y, et al. MLH1 and MSH2 protein expression as a pre-screening marker in hereditary and non-hereditary endometrial hyperplasia and cancer. Int J Cancer 2001; 92: 398-403. 13. An HJ, Kim KI, Kim JY, et al. Microsatellite Instability in endometrioid type endometrial adenocarcinoma is associated with poor prognostic indicators. Am J Surg Pathol 2007; 31: 846-53. 14. Ju W, Park HM, Lee SN, Sung SH, Kim SC. Loss of hmlh1 expression is associated with less aggressive clinicopathological features in sporadic endometrioid endometrial adenocarcinoma. J Obstet Gynaecol Res 2006; 32: 454-60. 15. Broaddus RR, Lynch HT, Chen LM, et al. Pathologic features of endometrial carcinoma associated with HNPCC: a comparison with sporadic endometrial carcinoma. Cancer 2006; 106: 87-94. 16. Kim H, Jen J, Vogelstein B, Hamilton SR. Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 1994; 145: 148-56. 17. Kempson RL, Pokorny GE. Adenocarcinoma of the endometrium in women aged forty and younger. Cancer 1968; 21: 650-62. 18. Crissman JD, Azoury RS, Barnes AE, Schellhas HF. Endometrial carcinoma in women 40 years of age of younger. Obstet Gynecol 1981; 57: 699-704.

젊은여성에게발생한자궁내막암종에서의현미부수체불안정성 207 19. Shin SK, Lee PG, Shin JK, et al. Endometrial cancers in the fourth decade: a clinicopathologic review. Korean J Obstet Gynecol 2003; 46: 1950-56. 20. Song SH, Lee JK, Oh NJ, Hur JY, Park YK, Saw HS. Clinicopathologic characteristics and prognostic factors of stage I and II endometrial cancer of the uterus. Korean J Obstet Gynecol 2006; 49: 1267-75. 21. Boland CR, Thibodeau SN, Hamilton SR, et al. A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res 1998; 58: 5248-57. 22. Peiro G, Diebold J, Lohse P, et al. Microsatellite instability, loss of heterozygosity, and loss of hmlh1 and hmsh2 protein expression in endometrial carcinoma. Hum Pathol 2002; 33: 347-54. 23. Maxwell GL, Rinsinger JI, Hayes K, et al. Racial disparity in the frequency of PTEN mutations, but not microsatellite instability, in advanced endometrial cancers. Clin Cancer Res 2000; 6: 2999-3005. 24. Caduff RF, Johnston CM, Svoboda-Newman SM, Poy EL, Merajver SD, Frank TS. Clinical and pathological significance of microsatellite instability in sporadic endometrial carcinoma. Am J Pathol 1996; 148: 1671-8. 25. Basil JB, Goodfellow PJ, Rader JS, Mutch DG, Herzog TJ. Clinical significance of microsatellite instability in endometrial carcinoma. Cancer 2000; 89: 1758-64. 26. Lim PC, Tester D, Cliby W, et al. Absence of mutations in DNA mismatch repair genes in sporadic endometrial tumors with microsatellite instability. Clin Cancer Res 1996; 2: 1907-11. 27. Gurin CC, Federici MG, Kang L, Boyd J. Causes and consequences of microsatellite instability in endometrial carcinoma. Cancer Res 1999; 59: 462-6. 28. Lax SF, Kurman RJ. A dualistic model for endometrial carcinogenesis based on immunohistochemical and molecular genetic analyses. Verh Dtsch Ges Pathol 1997; 81: 228-32. 29. Wu Y, Berends MJ, Mensink RG, et al. Association of hereditary nonpolyposis colorectal cancer-related tumors displaying low microsatellite instability with MSH6 germline mutations. Am J Hum Genet 1999; 65: 1291-8. 30. Chadwick RB, Pyatt RE, Niemann TH, et al. Hereditary and somatic DNA mismatch repair gene mutations in sporadic endometrial carcinoma. J Med Genet 2001; 38: 461-6.