최종보고서 은나노물질의유해성자료생산 2009 년 11 월 국립환경과학원 - 1 -
최종보고서 은나노물질의유해성자료생산 2009 년 11 월 연구기관 : 동덕여자대학교산학협력단 국립환경과학원
제출문 국립환경과학원장귀하 본보고서를 은나노물질의유해성자료생산 과제의최종보고서 로제출합니다. 2009 년 11 월 연구기관 : 동덕여자대학교산학협력단
참여연구진 총괄책임연구원박광식교수동덕여자대학교약학대학 연구원 박은정박사 동덕여자대학교약학대학 노부연연구보조원 동덕여자대학교약학대학 오지승연구보조원 동덕여자대학교약학대학 자문위원 김영훈교수 광운대학교 류덕영교수 서울대학교 박철범박사 한국화학시험연구원 배희경박사 TO21 서영록교수 경희대학교 - 4 -
I 1 1. 1 2. 1 3. 4 4. 4 5. 5 6. 6 II 8 1. 8 2. 8 III 9 1. 9., ph, 9. in vitro 10 2. 11. in vitro 12. in vivo 15 3. 18. intratracheal instillation ( ) 18. (in vivo ) 19 4. 20. 20., 21.,, 21. 21. Toxicokinetic parameter 23-1 -
IV 24 1. 24. 24. 37 2. 44. in vitro 44. in vivo 53 3. 67. intratracheal instillation 67. 73 4. 79. Toxicokinetic parameter 79. 86. 87 IV 89 1. 89 2. 91 3. 92 4. 92-2 -
< > OECD 8 (Steering Group, SG ). SG4 14. SG4 DDP (Dossier Development Plan) DDP (lead sponsor)...,. (,,, )... 1.. - 3 -
o. o 50 nm, 90 nm, 250 nm, Phosphate Buffered Saline (PBS) Fetal Bovine Serum (FBS) (DMEM) 96. - FBS 1%. o TWEEN 80 TWEEN 80. - Carboxy methyl cellulose (CMC) Dimethylsulfoxide (DMSO) TWEEN 80.. o Sphere type - Seed (seed mediated growth method) 20 nm. Seed 10 nm seed seed. - Sodium citrate 50 100 nm. - 4 -
.. o rod type - 50 nm.,. Sodium citrate. o plate type - Murphy seed-mediated growth method, sodium citrate 3 4 nm seed 50nm 50 100nm. o Soduim citrate Polyvinylpyrrolidone -,. CTAB. CTAB. Soduim citrate(sc) Polyvinylpyrrolidone(PVP). 2.. in vitro o ( 70 nm) RAW264.7 ( : - 5 -
10% FBS DMEM),. o GSH NO TNF-a. MMP.. in vivo o 105 nm 5 (200, 400, 800mg/kg). IL-6, IL-12, IL-4 cytokine. o 22, 42, 71, 323nm 1 mg/kg 14,,. IgE.,,, o 50 nm 0.25, 0.5, 1 mg/kg 28.. AST ALT. pro-inflammatory cytokines (IL-1, TNF-α, IL-6), Th1-type (IL-12, IFN-γ), Th2-type (IL-4, IL-5, IL-10) TGF-β.,,,,,,. - 6 -
3. o PBS 243nm 0.5 mg/kg 1, 7, 14, 28 BAL. 1. o granuloma (Saa3), (MMP), (mesothelin) o (intratracheal instillation), in vivo in vitro. 4. (Toxicokinetics) o Citrate coated ABC nanoparticle 1 mg/kg ( ) 10mg/kg( ) 1, /. - 10, 1, 2, 4, 8, 24, 48 96 24 96 24.. o., 10. - 7 -
- 4 8.. o AUC (Bioavailability) citrated coating ABCNanotech 1.2%, 4.2%. o Cmax 0.673 μg/ml 8 Cmax 5.223 μg/ml 4. o Tmax. 30.. o,..,. o. - 24 96 36%, 54%. - 8 -
o 96 24 30%, 10% ( ).. o ABC Nanotech. 24 1 g 378 μg, 1,663 μg. o.. 24. o. ABC Nanotech citrate coating. coating (liphophilic) coating. - 9 -
I. 1. - 2. o OECD 8 (Steering Group, SG). SG4 14 DDP (Dossier Development Plan). o 14 Fullerenes (C60), Single-walled carbon nanotubes (SWCNTs), Multi-walled carbon nanotubes (MWCNTs), Silver nanoparticles, Iron nanoparticles, Carbon black, Titanium dioxide, Aluminium oxide, Cerium oxide, Zinc oxide, Silicon dioxide, Polystyrene, Dendrimers, Nanoclays o OECD DDP lead sponsor co-sponsor, DDP. DDP lead sponsor. o, in vivo, EH OECD in vitro. o In vitro OECD TG. in vitro OECD TG - 1 -
Fig.1-1. OECD Steering Groups for Nanomaterials - 2 -
Tab1-1. Sponsor countries for DDP of nanomaterials Nanomaterials Lead sponsor(s) Co-sponsor(s) Contributors Fullerenes(C60) Japan, US Denmark, China SWCNTs Japan, US Canada, France, Germany, EC, China, BIAC MWCNTs Japan, US Korea, BIAC Canada, Germany, France, EC, China, BIAC Silver nanoparticles Korea, US Canada, Germany, Nordic Country Australia, France, EC, China Iron nanoparticles China BIAC Canada, US, Nordic Council of Ministers Carbon black Denmark, Germany, US Titanium dioxide Germany Canada, Korea Spain, US, BIAC Denmark, China Aluminium oxide Germany, US Cerium oxide US, UK/BIAC The Netherlands Australia, Germany, EC Zinc oxide UK/BIAC US, BIAC Australia, Canada Silicon dioxide EC Korea, BIAC Denmark, France Polystyrene Korea Dendrimers Spain US Nanoclays Denmark, US - 3 -
3. o (,,, ), OECD SG4 (Steering Group 4) DDP (Dossier Development Plan) 4. OECD o - - o (Stability) - / / (,, ) - OECD DDP (,, ) - 4 -
in vitro in vivo o (,, ) - (descriptive toxicology) o OECD DDP. In vitro Fig.1-2. Physicochemical characteristics of nanoparticles and toxicity tests - 5 -
Fig.1-3. Morphology of nanoparticles and toxicity tests OECD DDP lead sponsor DDP DDP DDP 최종성과물은국제적인학술지에투고하여세계적전문가들의검증을 받아논문으로출판 OECD DDP 에서인용 우리나라국가위상제고 - 6 -
Tab.1-2. Fields of OECD DDP for nanoparticles Physical-Chemical Propertics Agglomeration/ aggregation Water solubility Environment Fate Dispersion stability in water Biotic degradability Environmental toxicity Effects on pelagic species Effects on sediment species Mammalian Toxicity Pharmacokinetics / toxicokinetics (ADME) Acute toxicity Crystalline phase Ready biodegradability Effects on soil species Dustiness Representative TEM picture Particle size distribution Specific surface area Simulation testing on ultimate degradation in surface water Soil simulation testing Sediment simulation testing Sewage treatment simulation testing Effects on terrestrial species Effects on microorganisms Other relevant information (when available) Repeated dose toxicity Chronic toxicity Reproductive toxicity Developmental toxicity Genetic toxicity Zeta potential (surface charge) Photocatalytic activity Pour density Porosity Octanol-water partition coefficient, where relevant Redox potential Identification of degradation product(s) Further testing of degradation product(s) as required Abiotic Degradability and Fate Hydrolysis, for surface modified nanomaterials Adsorption-desorption Adsorption to soil or sediment a) In vitro Genotoxicity b) In vitro Somatic Cell Genotoxicity c) In vitro Genetic toxicity d) In vivo Germ Cell Mutagenecity Experience with human exposure Other relevant test data Radical formation potential Other relevant information (where available) Bioaccumulation potential Other relevant information (when available) - 7 -
II. 1. o o o (alternative) 2.. o, ph, o In vitro. o,, o in vitro. (alternative) o. o (SCI), OECD Fig.2-1. Validation and review system for the toxicity data of nanoparticles - 8 -
., ph, (1) o 99% (CatNo 484059-5G). Tetrahydro furane (THF, CatNo T5267-1L). Dulbecco s modified eagle s medium (DMEM, GIBCO) Fetal Bovine Serum (FBS) GIBCO. o (THF) 3 24 THF. 2 THF THF. THF nanofilteration. 50 nm, 90 nm, 250 nm. o,, Dynamic lighter scattering (DLS,, ). (2 ) FBS. FBS. 96. TEM (80kV, JEM 1010, JEOL). (2) o in vitro in vivo,,,, (tap water) - 9 -
. o agglomeration aggregation micrometer. o,. o agglomeration/aggregation. - o. Tab. 3-1. Vehicles for toxicity test of nanoparticles 독성분야 용매 생태독성 정제수 인체독성 시험 경기관지 복강 정맥주사 경구투여 또는생리식염수생리식염수또는정제수 시험 세포배양배지 혈청농도. In vitro o aggregation.,. CMC (carbonyl metyl cellulose), Tween - 10 -
. o,.. 2. 독성반응성비교연구개요 Fig. 3-1a. Flow of toxicity tests for silver nanoparticles - 11 -
Fig. 3-1b. Flow of toxicity tests for silver nanoparticles in vitro in vitro RAW264.7. (1) 96 well plates 2 10 4 ~5 10 3 cells/ml 37, 5% CO 2 24. 24, 48, 72, 96, 2 mg/ml MTT well 40 µl DMSO well 150 µl 30 540 nm. (2) ROS, DCFH-DA 37 30. PBS 1 1 M NaOH 96 well black plate 480 nm (Ex.) 530 nm(em.). ROS - 12 -
DCFH-DA 37 30 PBS. (3) GSH, caspase enzyme activity phthaldialdehyde (Sigma-Aldrich, Cat No. P0657). Caspase-3 activity R&D system capase-3 colorimetric assay kit. (4) DNA DAPI Genomic DNA purification kit DNA ethidium bromide (10 mg/ml) 0.02% 1.5% DNA Image VisualizerTM (Seoulin Bioscience Co. Seoul, Korea). DAPI PBS 4% paraformaldehyde 5 DAPI (4',6-diamidino-2-phenylindole). (5) PCR RNA RT-PCR RNA 1 µg oligo dt, reverse transcriptase nucleotide 20 µl RT-PCR premix tube ( ) (,, Cat No. K-2041) 42 60. cdna 1 µl Taq polymerase nucleotide PCR premix tube(,,, Cat NO. K-2016) primer 95 1, 55 1, 72 1 25~30 ethidium bromide (10 mg/ml) 1.5% TAE. (6) RNA. RNA - 13 -
, RNA ABI DNA. /. (7) Cytokine Assay IL-1, IL-4, IL-5, IL-6, IL-10, IL-12 TNF-α, IFN-r cytokine ebioscience (CA, USA) ELISA kit., coating buffer capture Ab well 100 µl 4 overnight. 1 assay diluent well 200 µl 1, standard well 100 µl 2. 1 assay diluent detection Ab well 100 µl 1 1 assay diluent avidin-hrp well 100 µl 30. substrate solution well 100 µl 15, stop solution well 50 µl 450 nm. (8) NO 1 10 6 cells/ml 24 37 o C, 5% CO 2 100 µl well. Griess reagent 100 µl 540 nm. NaNO2 NO. - 14 -
. in vivo Fig. 3-2. Outline of in vivo toxicity tests for silver nanoparticles (1) ICR ( ) (Gyunggi-do, Korea). (22 25 C), (5.5 %), 12 /.,, 3 1 10. 14. 1, 1... ( : ) (2) (Serum biochemical value) Retro orbital plexus EDTA 2. - 15 -
(TP), (A), (AST, aspartate aminotransferase; ALT, alanine aminotransferase), (ALP, alkaline phosphatase),, (BUN, blood urea nitrogen). (3). :,,,,, /,,,, (4) 10%.. - :,,,,,,,, ( ) - : (5),,,,,,,, ( 200 300 mg ) 65 % 7 ml 30 % 1 ml. 200 20. 400 µl 10 ml (250 ). ICP-MS. (6) ebioscience ELISA kit. IL-1β, TNF- - 16 -
α, IL-6, IL-2, IL-12, IL-4, IL-5, TGF-β.. Coating buffer capture Ab well 100 µl 4. 1 Assay diluent well 200 µl 1, well 100 µl 2. 1 Assay diluent detection Ab well 100 µl 1 1 Assay diluent Avidin-HRP well 100 µl 30. well 100 µl 15, well 50 µl 450 nm. (7) ebioscience(san diego, CA, USA) T cells (CD3, 1:50), B cells(cd19, 1:50) and NK cells(dx5, 1:100), CD4+ T cells(cd4+, 1:160), CD8+ T cells(cd8+, 1:50)... 3 5 10 3 Fc-block 4 C 20. Fluoroscence Activated Cell Sorter (FACS) buffer, FACS lysis buffer(bd Bioscience, Franklin Lakes, NJ, USA) 5 10 lysis FACS buffer. 1 % paraformaldehyde, FACSCalibur system (BD Biosciences, Franklin Lakes, NJ, USA). CellQuest software (Becton Dickinson, Franklin Lakes, NJ, USA). (8) IgE IgE ELISA Core kit.. Coating buffer (1:100) coating Ab well 100ul 4. Washing buffer 3 5-17 -
blocking solution well 200 µl 1 well 100 µl 1. Assay diluent detection Ab well 100 µl 1 washing buffer 3 5 well 100 µl 5 40 2 M H 2 SO 4, 450 nm. 3. (alternative) 대체시험법개념 Fig.3-3 Overview of alternative toxicity test for nanoparticles. intratracheal instillation ( ).... (intratracheal instillation, ) - 18 -
/. in vivo toxicity endpoints. ICR ( ) (Kyunggi, Korea), (22 25 C), (5.5 %), 12 / PBS intratracheal instillation 0.5 mg/kg 1. PBS PBS 50 nm 200 nm. ( in vivo ). (in vivo ) In vivo,. in vivo (animal welfare). in vivo in vitro DNA chip..,,,. in vivo in vitro. RNA, RNA ABI DNA. /. - 19 -
4.. ABC nanotech. ABC Nanotech spec. citric acid coating.., ionic strength (PBS ). - coating material: citrate - average size: 8-12 nm - stock concentration : 20% (200,000ppm) - synthesis : aquous reduction - dispersion : monodispersed with citrate capping - form : amorphous type Fig. 3-4. TEM diameter distribution of ABC Silver nanoparticles - 20 -
Fig. 3-5. TEM image of ABC silver nanoparticles., SD (250 g ) 4. ABC silver nanoparticles stock.. 1 mg/kg 10 mg/kg.. (PBS, Saline ).,, time 0 10, 60 (1 ), 120 (2 ), 240 (4 ), 480 (8 ), 1440-21 -
(24, 1 ), 2880 (48, 2 ), 5760 (96, 4 ). 4 24 96,,,. Tab. 3-2 Blood samples and tissue samples for toxicokinetics of silver nanoparticles 그룹 whole blood organ urin feces Total 대조군 8tubes 간, 신장, 폐, 각 1tube, 총 32tubes 8tubes 8 tubes 112 tubes 10 min 16 tubes N/A N/A N/A 16 tubes 1 h 16 tubes N/A N/A N/A 16 tubes 2 h 16 tubes N/A N/A N/A 16 tubes 4 h 16 tubes N/A N/A N/A 16 tubes 8 h 16 tubes N/A N/A N/A 16 tubes 24 h 16 tubes 간, 신장, 폐, 고환각 1tub e, 총 64tubes 16 tubes 16 tubes 224 tubes 48 h 16 tubes N/A N/A N/A 16 tubes 96 h 16 tubes 간, 신장, 폐, 고환각 1tub e, 총 64tubes N/A N/A 144 tubes. 10, 1, 2, 4, 8, 24, 48 96 4 ml ( time 0, ). 0.5 ml (whole blood) ( )., ( ) 24-22 -
. 24.. ( 200 300 mg, 0.5 ml ) 7 ml 70% 1ml H 2 O 2. 250 ICP-MS. 1 ml μg (μg/ml) 1 μg (μg/g). 1 ml μg 1 μg.. Toxicokinetic parameter BA Calc 2006. AUC (Area Under the Curve) Cmax, Tmax, T1/2. AUC (Bioavailability). - 23 -
. (1) o. o PBS FBS. FBS FBS 1%. (Tab. 4-1, Fig. 4-1) o 90 nm FBS 10% (Fig. 4-1d). o DMEM PBS FBS (Fig. 4-2). DMEM FBS 10% DMEM PBS. (2) o FBS, FBS. FBS (Fig, 4-3). - 24 -
o FBS, PBS DMEM -15 mv -10 mv ~ -15 mv. FBS FBS. (3) o 3 (50 nm, 90 nm, 250 nm), DMEM PBS ( ) (Fig. 4-4). o DMEM PBS DMEM PBS. FBS. (4) o (50 nm ) FBS., FBS DMEM FBS DMEM. PBS (Fig.4-5). o, FBS 96 100 nm., FBS DMEM. - 25 -
(5) o DEME PBS.. FBS Fig.4-6. o FBS (Fig. 4-6a-b), (Fig. 4-6c-d). o FBS (10%) ( ) (Fig. 4-6e-h). (6) (Tween80, DMSO, CMC) o Tween80 CMC. (Fig.4-7a). o DMSO. -20 ~ +10 mv FBS (Fig.4-7b). o Tween 80.. CMC DMSO. o, Tween 80. - 26 -
Tab. 4-1 Experimental conditions for agglomeration test of silver nanoparticles (AgNPs) No AgNPs size, nm Ag + ion ratio, % Ag conc n, mg/l FBS conc n, % Medium Exposure time Stabilizer 1) Agglomeration rate 1-1 90 <5 28 0 PBS, DMEM - - 1-2 1 1-3 5 1-4 10 2) Surface charge (zeta potential) 2-1 168, 90 <5 28 0 PBS, DMEM <10 min - 2-2 0.25 2-3 0.5 2-4 1 2-5 2.5 2-6 5 2-7 10 2-8 20 3) Agglomerate size according to AgNPs size 3-1 50, 90, 250 <5 28 0 PBS, DMEM <10 min - 3-2 0.5 3-3 1 3-4 5 3-5 10 4) Agglomerate size monitoring of AgNPs mixed with FBS 4-1 50 <5 28 0 PBS, DMEM 0 96 h - 4-2 0.5 4-3 5 4-4 10 5) Suspension stability with chemical stabilizer 5-1 90 <5 50 - PBS 24 h TWEEN80 5-2 DMSO 5-3 CMC - 27 -
Hydrodynamic diameter, nm 600 500 400 300 200 100 (a) Diameter Accum. Ave. Diameter (b) Diameter Accum. Ave. Diameter Hydrodynamic diameter, nm 600 0 500 400 300 200 100 (c) Diameter Accum. Ave. Diameter Diameter Accum. Ave. Diameter (d) 0 0.1 1 10 Exposure Time, min 0.1 1 10 Exposure Time, min Fig.4-1. Agglomeration of AgNPs with FBS in PBS 7.4 buffer; (a) 0%, (b) 1%, (c) 5%, and (d) 10% of FBS. - 28 -
300 250 (a) Diameter Accum. Ave. Diameter Diameter Accum. Ave. Diameter (b) Hydrodynamic Diameter, nm 200 150 100 50 300 0 250 (c) Diameter Accum. Ave. Diameter Diameter Accum. Ave. Diameter (d) Hydrodynamic Diameter, nm 200 150 100 50 0 0.1 1 10 Time, min 0.1 1 10 Time, min Fig.4-2. Agglomeration of AgNPs with FBS in DMEM medium (a) 0%, (b) 1%, (c) 5%, and (d) 10% of FBS. - 29 -
0-5 DMEM PBS Zeta Potential, mv -10-15 -20-25 -30 Zero FBS% -23.7 mv for DMEM -22.2 mv for PBS 0.1 1 10 FBS Concentration, % Fig.4-3. Zeta potential measurement of AgNPs in cases of mixing with FBS in DMEM and PBS medium. - 30 -
Agglomerate Size, nm 600 500 400 300 200 100 (a) FBS 0.0% FBS 0.5% FBS 1.0% FBS 5.0% FBS 10.0% 0 250 90 50 Ave. Diameter of AgNPs, nm Agglomerate Size, nm 300 250 200 150 100 50 (b) FBS 0.0% FBS 0.5% FBS 1.0% FBS 5.0% FBS 10.0% 0 250 90 50 Ave. Diameter of AgNPs, nm Fig.4-4. Hydrodynamic diameter change according to size of AgNPs; (a) PBS and (b) DMEM. - 31 -
Hydrodynamic Diameter, nm 7600 7580 7560 7540 7520 7500 800 700 600 500 400 300 200 100 0 0.0 0.5 (a) 5.0 1 day 2 day 3 day 4 day 5 day 10.0 FBS Concentration, % Hydrodynamic Diameter, nm 200 150 100 50 (b) 1 day 2 day 3 day 4 day 5 day 0 0.0 0.5 5.0 10.0 FBS Concentration, % Fig.4-5. Stability monitoring of AgNPs suspension in (a) PBS and (b) DMEM. - 32 -
200 nm 200 nm (a) (b) 200 nm 500 nm (c) (d) Fig.4-6. Agglomerate of AgNPs in the test media; (a-b) 0.25 %, (c-d) 1%, (e-f) 5%, and (g-h) 10% of FBS. - 33 -
200 nm 2 탆 (e) (f) 0.5 탆 0.5 탆 (g) (h) Fig.4-6 (continued). Agglomerate of AgNPs in the test media; (a-b) 0.25 %, (c-d) 1%, (e-f) 5%, and (g-h) 10% of FBS. - 34 -
Zeta Potential, mv 40 20 0-20 (b) Tween80 DMSO CMC -40 1 10 100 1000 Concentration, mg/l Ratio of Diffusion Coefficient, D i /D 0 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 (a) 1 10 100 1000 Concentration, mg/l Tween80 DMSO CMC Fig.4-7. Suspension stability of AgNPs using chemical stabilizers; (a) ratio of diffusion coefficient and (b) ξ-potential. - 35 -
Fig.4-8. TEM image of AgNPs with chemical stabilizers; (a) TWEEN 80, (b) DMSO, and (c) CMC. - 36 -
. (1) 20 nm o Seed. Seed 10nm, Seed. Seed 20 nm. o 0.25 mm AgNO 3 0.25 mm Sodium Citrate 200 ml., 0.01M NaBH 4 0.6 ml... 5,,. 20 nm UV 380 nm, TEM. Fig.4-9 Preparation of sphere type AgNPs (less than 20 nm) - 37 -
(2) 50~100 nm o 50~100 nm.,. Sodium Citrate. o 0.5 mm AgNO 3 150 ml., Sodium Citrate,.. 200 nm. UV TEM. 420nm UV, TEM 50nm. Fig.4-10 Preparation of sphere AgNPs (size : 50~100 nm) - 38 -
(3) Phosphate Buffered Saline o PBS,. PBS. o, PBS. 20 nm UV 380 nm 400 nm, 50~100 nm 400 nm 410 nm. UV. PBS UV. PBS. Fig.4-11 UV spectrometry of AgNPs in distilled water and Phosphate buffered saline (PBS) : (A) size: less than 20 nm (B) size: 50~100 nm - 39 -
(4) o 50 nm.,. Sodium Citrate,. o.,.. Fig.4-12 Images of rod type AgNPs in sphere type nanoparticles. - 40 -
(5) Soduim Citrate Polyvinylpyrrolidone o,. CTAB. CTAB. Soduim Citrate(SC) Polyvinylpyrrolidone(PVP). o 0.01 M AgNO 3 SC PVP 20ml. 0.1 M Ascorbic acid 0.5 ml 0.06 ml Seed,. 1 M NaOH 0.1 ml. o UV Spectrometer. UV peak. 420 nm 690 nm peak. TEM. Fig.4-13 Preparation of AgNPs using sodium citrate and PVP - 41 -
(5) 50nm 50~100nm o Murphy seed-mediated growth method, sodium citrate. 3~4 nm seed. o,.,. o. 3 peak, TEM. o Seed,. Seed 0.5 1.5 ml. 0.5 ml 669 nm 50~100 nm, 1.5 ml 571 nm 50 nm. Fig.4-14 Preparation of AgNPs using various amount of Ag seed - 42 -
(6) o Sodium citrate (SC). SC., SC. Fig.4-15 Preparation of AgNPs using various amount of sodium citrate o SC.,.. Fig.4-16 Stability variation graph of AgNPs - 43 -
2.. In vitro o 90nm (AgNPs) in vitro (DMEM, 10%FBS). 70nm. 10%FBS DMEM 100nm. Fig.4-17 Size distribution of AgNPs in DMEM (10%FBS) for in vitro toxicity test. o SEM 100nm.. Fig.4-18 TEM image of AgNPs in the culture medium DMEM (10 % FBS). - 44 -
o RAW264.7. 0.2, 0.4, 0.8, 1.6 ppm 24, 48, 72 96. Fig.4-19 Decreased cell viability by AgNPs Cell viability was measured by the MTT assay and the viability of the treated group (0.2, 0.4, 0.8, and 1.6 ppm ) was expressed as a percentage of the control group. *; P<0.05, **; P<0.01. - 45 -
o 0.4, 0.8, 1.6 ppm 24 RAW264.7. 0.4, 0.8 ppm G1 G1 arrest. 1.6ppm DNA Sub G1. Fig.4-20 Cell cycle changes of cultured RAW 264.7 cells treated with AgNPs Cells were treated with AgNPs and were harvested at 24 h after treatment. The cell cycle was analyzed by measuring the DNA content with PI staining and RNase digestion in the FACSCalibur system. - 46 -
o glutathione. (, ROS). ROS. o RAW264.7 (0.2, 0.4, 0.8, 1.6 ppm, 24 ) Glutathione.. Fig. 4-21 Decreased level of intracellular GSH in cultured RAW 264.7 cells by AgNPs Cells were treated for 24 hours with AgNPs. Intracellular glutathione was measured using o-phthaldialdehyde by substrate. Results were calculated as nmol of glutathione per mg of protein. *; P<0.05, **; P<0.01. - 47 -
o. (0.2, 0.4, 0.8, 1.6 ppm, 24 ) NO. o NO. Fig. 4-22 Increased level of NO secretion by AgNPs NO (nitrogen oxide) production was quantified spectrophotometrically using the Griess reagent. *, P<0.05. Cells were treated with AgNPs with the indicated concentrations for 24 h. - 48 -
o NO (0.2, 0.4, 0.8, 1.6 ppm, 24 ) TNF-a. TNF-a. A) B) Con. 0.2 0.4 0.8 1.6 (ppm) TNF alpha Fig. 4-23 Induction of TNF-α protein level and gene expression by AgNPs A) Cells were treated with AgNPs with the indicated concentrations for 24h. TNF-α secretion waseremeasured by ELISA. *; P<0.05. B) Increase of TNF-α gene expression - 49 -
o PCR. o matrix MMP (matrix metalloproteinase). TMIP (tissue inhibitor of matrix metalloproteinase). Fig.4-24. Change of gene expression related with cell membrane damage RNA was extracted from the RAW264.7 cells treated with AgNPs (0, 0.2, 0.4, 0.8, 1.6 ppm) for 24 h and amplified by RT-PCR using the respective primers described in Table 1. Results were confirmed by several separate experiments and representative images were shown. Tab. 4-2 Primer sequences used in this study Primer name TNF-α MMP-3 MMP-11 MMP-19 Timp 1 Primer sequences R: TTGACCTCAGCGCTGAGTTG L: CCTGTAGCCCACGTCGTAGC R: GGCAGCATCGATCTTCTTCA L: GTTCTGGGCTATACGAGGGC R: GCTGTGGTGTGTTGTAGCCC L: CCCATGCCTTCTTCCCTAAG R: GAGTAACGTCCCCGGTTGAT L: GGCCAGAACTGACCTTAGCC R: CCTGATCCGTCCACAAACAG L: TATGCCCACAAGTCCCAGAA - 50 -
o RAW264.7 1.6 ppm. 3 activation. activation spreading. o 24 RAW264.7 uptake. Fig. 4-25. Uptake of AgNPs from media into the cytoplasm of cultured RAW 264.7 cells RAW264.7 cells were treated with AgNPs of 1.6 ppm for 3h and 24h, respectively. Changes of morphology were observed using phase-contrast microscope (200); representative photos are shown. (A) control group, (B) activated cells by phagocytosis of AgNPs after 3h (C) dead cells after 24h, (D) cells releasing of AgNPs into media after death - 51 -
o uptake dark field. Fig. 4-26 Dark-field images of AgNPs treated to the cultured cells. RAW264.7 cells were treated for 24 h with AgNPs of 1.6 ppm. The presence of AgNPs in the culture medium were observed by dark-field optical microscope. Representative photos are shown. (A) control (100), (B) release of silver NPs from cells (400), (C) phagocytosis of AgNPsby RAW264.7 (100). White arrows represent phagocytosis of AgNPs. - 52 -
. In vivo (1) 5 ( - ) o ( 90nm).. o 105nm. Fig.4-27 Size distribution of AgNPs in the distilled water (vehicle for oral administration) for 5-day repeated dose toxicity test. - 53 -
o (200 mg/kg), (400 mg/kg) (800 mg/kg) 3 ( 5 ) 6 ICR 5 1 1,,,,,. o. o 5,. Tab. 4-3 Toxicological parameters observed in AgNPs-treated group after 5 day repeated treatment. parameters Dose 200 mg/kg 400 mg/kg 800 mg/kg dead animal No No No body weight N N N water, diet consumption N N N behavioral observation N N N macroscopic observation N N N histological observation (liver and kidney) N N N N: no difference was observed compared to the control group. o 5.,. - 54 -
o IL-6, IL-12, IL-4 TNF-a, TGF-b. IgE.. Fig. 4-28 Cytokine levels after oral administration of AgNPs for 5 days. Serum was obtained and pooled after treatment of AgNPs with dose of 200 mg/kg, 400 mg/kg, and 800 mg/kg, respectively. - 55 -
(2) 14 ( ) o 6 ICR ( 5 ) 14 (1 mg/kg),, /,,,,. 10. o.,. Tab. 4-4 Toxicological parameters observed in AgNPs-treated group after 14 day repeated treatment. parameters Average Size 22 nm 42 nm 71 nm 323 nm dead animal No No No No body weight N N N N weight ratio (organ/body) N N N N water, diet consumption N N N N behavioral observation N N N N macroscopic observation N N N N histological observation (liver and kidney) N N N N N: no difference was observed compared to the control group. - 56 -
o 14... 50 0 day 14 day 40 Body weight (g) 30 20 10 0 control 22 nm 42 nm 71 nm 323 nm Size Fig. 4-29 The increase of body weight in AgNPs-treated group. o 14,,,,. 0.06 0.05 liver kidney testis brain lung Tissue weight/body weight 0.04 0.03 0.02 0.01 0.00 control AgS1 AgS2 AgS4 AgS3 Fig. 4-30 The ration of organ weight to body weight in AgNPs-treated group. - 57 -
o. o, 14 ( ). o,.,,,,,... o. Toxicokinetic. ( citrate bare silver nanoparticles ) 800 700 600 500 400 300 200 100 0 con 22 nm 42 nm 323 nm 간신장폐고환뇌 Fig. 4-31 Distribution of AgNPs after oral administration for 14 days. Small size particles (22, 42 nm) were absorbed and distributed in liver, kideny, lung, testis and brain but microsized particles (323 nm) were not measured in the tissues. - 58 -
o IL-6, IL-12 TNF-a, TGF-b 22, 42, 71 nm 323 nm. IgE. o.,. o. 323 nm. 110 100 90 80 70 20 control 22 nm 42 nm 71 nm 323 nm pg/ml 0 TNF-a IL-6 IL-12 TGFb IgE Fig. 4-32 Cytokine levels after oral administration of AgNPs for 14 days. Serum was obtained and pooled after treatment of AgNPs with different sizes (Average size : 22, 42, 71, 323 nm, 1 mg/kg for 14 days) - 59 -
(3) 28 (,, 50 nm size) o 50nm (0.25 mg/kg) (0.5 mg/kg) (1 mg/kg) 28 (1 1, 7 ),, /,,,,. o. /,,,. Tab. 4-5 Toxicological parameters observed in AgNPs-treated group after 28 day repeated treatment. parameters Dose 0.25 mg/kg 0.5 mg/kg 1 mg/kg dead animal No No No body weight N N N water, diet consumption N N N behavioral observation N N N macroscopic observation N N N histological observation (liver and kidney) N N N N: no difference was observed compared to the control group. - 60 -
o. Tab. 4-6 Body weights of male and female mice after AgNPs-treatment for 28 days. Dosage Male (Ave±SD) Female (Ave±SD) Con 39.3156 ± 1.8907 g 31.1407 ± 2.0353 g 250 ug/kg 34.2271 ± 1.9042 g 26.8483 ± 1.2765 g 500 ug/kg 35.0417 ± 1.5459 g 26.7850 ± 1.8742 g 1000 ug/kg 39.4167 ± 0.9581 g 27.4467 ± 1.4516 g Tab. 4-7 Ratio of organ weights to body weight in male mice after AgNPs-treatment for 28 days. Male Heart Liver Lung Kidney Spleen Brain Thymus Testis Epididy mis Control 0.006 ±0.001 0.045 ±0.004 0.007 ±0.001 0.016 ±0.002 0.003 ±0.001 0.012 ±0.001 0.001 ±0.001 0.005 ±0.001 0.001 ±0.001 250 0.006 0.048 0.007 0.016 0.003 0.013 0.002 0.007 0.001 μg/kg ±0.001 ±0.002 ±0.001 ±0.001 ±0.000 ±0.001 ±0.000 ±0.001 ±0.000 500 0.006 0.049 0.007 0.016 0.003 0.013 0.002 0.006 0.001 μg/kg ±0.002 ±0.001 ±0.001 ±0.001 ±0.000 ±0.001 ±0.001 ±0.001 ±0.000 1000 0.006 0.050 0.007 0.018 0.003 0.012 0.001 0.006 0.001 μg/kg ±0.001 ±0.002 ±0.001 ±0.002 ±0.001 ±0.001 ±0.000 ±0.001 ±0.000 Tab. 4-8 Ratio of organ weights to body weight in female mice after AgNPs-treatment for 28 days. Female Heart Liver Lung Kidney Spleen Brain Thymus Uterus Control 0.006 ±0.001 0.046 ±0.003 0.007 ±0.002 0.013 ±0.001 0.004 ±0.001 0.015 ±0.002 0.003 ±0.000 0.007 ±0.002 250 0.005 0.044 0.008 0.013 0.004 0.017 0.002 0.008 μg/kg ±0.000 ±0.003 ±0.001 ±0.001 ±0.001 ±0.001 ±0.000 ±0.004 500 0.006 0.047 0.008 0.014 0.004 0.018 0.003 0.008 μg/kg ±0.001 ±0.004 ±0.001 ±0.001 ±0.001 ±0.001 ±0.000 ±0.003 1000 0.006 0.048 0.008 0.014 0.004 0.017 0.002 0.006 μg/kg ±0.001 ±0.002 ±0.001 ±0.002 ±0.001 ±0.001 ±0.000 ±0.002-61 -
o 28. Alkaline phosphatase. AST (Aspartate transaminase), ALT (Alanine transaminase). Tab. 4-9 Serum biochemistry in male mice after oral administration of AgNPs for 28 days Groups TP (mg/dl) ALB (mg/dl) AST (IU/l) ALT (IU/l) ALP (IU/l) Creatinine (mg/dl) BUN (mg/dl) Control 6.07 ± 0.06 3.40 ± 0.10 79.00 ± 14.18 48.00 ± 4.58 80.67 ± 3.79 0.40 ± 0.00 17.83 ± 2.54 250 μg/kg 5.73 ±0.25 3.33 ± 0.15 93.00 ± 10.58 51.00 ± 12.49 85.33 ± 9.50 0.37 ± 0.06 13.00 ± 0.44 500 5.27 ± 3.00 ± 99.00 ± 61.33 ± 100.00 ± 0.33 ± 14.63 ± μg/kg 0.67 0.35 32.51 12.01 29.14 0.06 1.02 1000 5.30 ± 2.97 ± 157.33 ± 103.67 ± 124.33 ± 0.37 ± 19.47 ± μg/kg 0.53 0.32 47.98* 77.31 37.98** 0.06 3.46 *; P<0.05, **; P<0.01. Tab. 4-10 Serum biochemistry in female mice after oral administration of AgNPs for 28 days Groups TP (mg/dl) ALB (mg/dl) AST (IU/l) ALT (IU/l) ALP (IU/l) Creatinine (mg/dl) BUN (mg/dl) Control 5.63 ± 0.23 3.37 ± 0.06 79.67 ± 5.69 36.33 ± 5.13 87.67 ± 23.46 0.33 ± 0.06 15.27 ± 2.53 250 μg/kg 5.67 ± 0.15 3.53 ± 0.06 78.67 ± 23.03 24.33 ± 0.58 145.67 ± 43.66 0.30 ± 0.00 13.10 ± 2.65 500 μg/kg 5.73 ± 0.06 3.50 ± 0.00 98.00 ± 41.58 28.33 ± 11.02 160.33 ± 41.04 0.33 ± 0.06 14.77 ± 2.10 1000 μg/kg 6.00 ± 0.36 3.60 ± 0.17 211.67 ± 57.18** 150.67 ± 13.05** 181.00 ± 51.51** 0.37 ± 0.06 11.90 ± 1.40 **; P<0.01. - 62 -
o pro-inflammatory cytokines (IL-1, TNF-a, IL-6), Th1-type (IL-12, IFN-r), Th2-type (IL-4, IL-5, IL-10) TGF-b. o. o IgE. Fig. 4-33 Changes of cytokine and IgE levels in the blood after oral administration for 28 days Serum harvested from male (n=7) and female (n=7) was pooled for analysis. The concentrations of cytokines (concentration unit ; pg/ml) and IgE (concentration unit ; ng/ml) in blood harvested at day 28 after repeated oral administration were determined using ELISA kits. *; P<0.05, **; P<0.01. - 63 -
o B cell. NK, NKT, B cell T cell 3.97%, 1.30%, 58.29%, 36.45%. (1000 ug/kg) 4.05%, 1.28%, 62.13%, 32.54%., B cell 58% 62% Fig.4-33 IgE. o T cell subtype helper cell CD4+ cytotoxic effect CD8+ CD4+/CD8+ 3.80 3.55 CD4+ CD8+. Control group Treated grooup Fig. 4-34 Analysis of lymphocyte phenotypes in blood after oral administration for 28 days Blood harvested from male (n = 7) and female (n = 7) mice was pooled for analysis. All monoclonal antibodies were identified using directly conjugated anti-mouse antibodies, and flow cytometry analysis was performed on the FACSCalibur system. Control samples were matched for each fluorochrome. - 64 -
o.,,,,,,,. o,,... Tab. 4-11 Tissue distribution of AgNPs after oral treatment for 28 days (dose: 1mg/kg) (Unit : μg/kg) Control 250 μg/kg 500 μg/kg 1 mg/kg Kidney ND ND ND 55.211 Lung ND 59.063 79.0164 167.324 Heart ND ND ND ND Brain ND ND 141.333 155.357 Spleen ND ND ND ND Liver ND ND ND ND Thymus ND ND ND 530.000 Uterus ND ND ND 497.778 Testis ND ND 164.000 184.000 Epididymis ND ND ND ND - 65 -
o,,... Fig. 4-35 Histopathology of kidney tissues after oral administration for 28 days Tissue sections were stained with hematoxylin and eosin stains (x200). (A): control group, (B): treated group (1 mg/kg group). Arrow indicate infiltrated mononuclear cells. - 66 -
3.. (intratracheal instillation) /. In vivo,. in vivo (animal welfare). in vivo in vitro DNA chip... intratracheal instillation ( ) o PBS. PBS. o 50nm PBS 200nm.. PBS 200 nm. FBS. FBS FBS ( ) FBS. o PBS ICR (6 ) 0.5 mg/kg - 67 -
1, 7, 14 28 BAL (Bronchoalveolar lavage) fluid. o BAL fluid pro-inflammatory cytokines (IL-1 TNF-a), Th1-type cytokines (IL-12, IFN-r), Th2-type cytokines (IL-4, IL-5, IL-10) IL-6, IL-2, TGF-b. Fig. 4-36 Cytokine levels in BAL fluid after a single intratracheal instillation of AgNPs (0.5 mg/kg) Sample was harvested and pooled at the designated day after instillation. Cytokine concentrations were determined using ELISA kits. *; P<0.05, **; P<0.01. - 68 -
o PBS ICR (6 ) 0.5 mg/kg 1, 7, 14 28 retroorbital plexus. pooling. o pro-inflammatory cytokines (IL-1 TNF-a), Th1-type cytokines (IL-12, IFN-r), Th2-type cytokines (IL-4, IL-5, IL-10) IL-6, IL-2, TGF-b BAL fluid. Fig. 4-37 Cytokine levels in serum after a single intratracheal instillation of AgNPs (0.5 mg/kg) Sample was harvested and pooled at the designated day after instillation. Cytokine concentrations were determined using ELISA kits. **; P<0.01. - 69 -
o PBS ICR (6 ) 0.5 mg/kg 1, 7, 14 28 BAL (Bronchoalveolar lavage) fluid IgE. o BAL fluid IgE. IgE BAL fluid. Fig. 4-38 IgE levels in BAL fluid and in blood after a single intratracheal instillation of AgNPs (0.5 mg/kg) BAL fluid and serum was harvested and pooled on the respective sacrifice days after instillation, and IgE concentration in each samples were determined using commercially available kits. *; P<0.05, **; P<0.01. - 70 -
o PBS ICR (6 ) 0.5 mg/kg 1 NK, NKT, B, T cell. 28 T cell subtype CD4+ CD8+. o NK, NKT, B, T cell 4.03%, 0.90%, 63.91%, 31.16% 1.44%, 0.54%, 74.74%, 23.27%., B 63.91% 74.74% T. o CD4+/CD8+ 4.0 28 2.8 CD8+. Fig. 4-39 Analysis of lymphocyte phenotypes in blood after a single instillation of AgNPs All monoclonal antibodies were identified using directly conjugated anti-mouse antibodies, and flow cytometry analysis was performed on the FACSCalibur system. Control samples were matched for each fluorochrome. - 71 -
o PBS ICR (6 ) 0.5 mg/kg 1, 14 28. o 1. peri-termianl bronchioles. 1. Tab. 4-12 Histopathology of lung tissues after instillation of AgNPs Infiltration of alveolar Control Day 1 Day 14 Day 28 macrophages, - + - - peri-terminal bronchioles -: Not remarkable Grade + : mild Fig. 4-40 Histopathology of lung tissues after instillation of AgNPs Lung sections obatained at day 1 were stained with hematoxylin and eosin stains ( 200). AgNPs were instilled at doses of 500 μg/kg at day 0. (A); control, (B); treated group - 72 -
. o. in vivo in vitro in vivo in vitro. DNA chip. o 500 ug/kg 1 microarray granuloma Saa3, Loricrin Timp, Slpi., MWCNT mesothelioma mesothelin 3. - 73 -
Tab. 4-13 Up-regulated genes in lung by a single intratracheal instillation of AgNPs SYMBOL ACCESSION Average Ag 1st Ag 2nd Saa3 NM_011315.3 39.14 32.15 72.66 Krt13 NM_010662.1 24.07 56.46 31.32 Lor NM_008508.2 20.52 34.80 27.28 Krtdap NM_001033131.1 20.47 48.01 19.84 Lcn2 NM_008491.1 16.97 16.74 24.90 Serpinb12 NM_027971.1 16.41 37.13 17.73 Cnfn NM_001081375.1 16.30 32.29 18.15 Asprv1 NM_026414.2 15.58 28.23 16.76 Lypd3 NM_133743.1 15.46 31.26 12.27 Krt14 NM_016958.1 15.39 28.86 14.22 Lce3b NM_025501.2 14.75 32.60 18.14 2310007F04Rik NM_025501.1 14.62 29.57 18.81 Lce3b NM_025501.2 14.23 30.24 14.34 Lce1c NM_028622.2 13.99 32.23 13.16 LOC100046641 XM_001476658.1 13.81 27.57 13.54 Lce3c NM_033175.2 13.57 26.48 15.70 Crct1 NM_028798.2 13.21 25.85 15.89 Orm1 NM_008768.1 13.15 10.03 17.62 Ada NM_007398.3 12.54 18.61 11.93 Lce1d NM_027137.2 12.22 25.09 10.98 Rptn NM_009100.2 12.10 24.50 11.43 Lce1b NM_026822.1 10.54 21.84 10.07 Serpinb3a NM_009126.2 8.95 16.64 8.93 Them5 NM_025416.1 8.84 15.36 8.49 Sprr3 NM_011478.1 8.80 14.16 8.19 Lce1a2 NM_028625.2 8.59 15.33 6.91 2200001I15Rik NM_183278.2 8.21 12.20 9.59 Krt4 NM_008475.2 8.04 13.45 7.60 Defb4 NM_019728.3 7.65 15.32 7.29 Slpi NM_011414.2 7.49 10.89 5.67 Retnla NM_020509.3 7.38 11.29 8.18-74 -
Tab 4-13 (Continued) SYMBOL ACCESSION Average Ag 1st Ag 2nd Orm2 NM_011016.1 6.91 5.80 8.27 Serpinb3c NM_201363.1 6.87 15.12 3.09 Cdsn NM_001008424.2 6.50 9.70 5.50 Psapl1 NM_175249.3 6.17 8.33 4.57 Lgals7 NM_008496.4 6.10 9.68 6.09 Dmkn NM_172899.2 5.98 6.13 6.74 Igtp NM_018738.3 5.90 4.86 5.75 Gm94 NM_001033280.2 5.81 9.13 4.91 OTTMUSG00000000971 NM_001081957.1 5.76 6.74 6.53 Dmkn NM_172899.3 5.73 6.01 6.39 Timp1 NM_011593.2 5.48 4.32 7.67 Ly6g6c NM_023463.3 5.40 9.41 4.06 Lce1f NM_026394.2 5.26 9.34 3.85 Ctsk NM_007802.3 5.14 8.75 3.32 2310002J15Rik NM_026415.1 4.88 7.47 3.76 Arg1 NM_007482.2 4.86 5.07 5.23 Rptn NM_009100.2 4.80 7.37 3.91 Timp1 NM_011593 4.75 3.85 6.10 Lce1a1 NM_025984.2 4.59 8.70 3.71 Prcp NM_028243.2 4.58 3.65 4.16 Iigp2 NM_019440.2 4.24 3.35 4.23 Calm4 NM_020036.4 4.12 6.80 3.39 Lrg1 NM_029796.2 3.96 4.33 5.09 Lce3a NM_001039594.1 3.88 5.00 3.18 Gbp2 NM_010260.1 3.78 3.18 3.33 Hist1h2ad NM_178188.3 3.76 4.94 3.93 Tapbp NM_001025313.1 3.72 4.89 4.16 Cd274 NM_021893.2 3.72 4.42 3.62 Ly6d NM_010742.1 3.65 5.70 3.06 Ccl7 NM_013654.2 3.63 2.57 4.87-75 -
Tab. 4-13 (Continued) SYMBOL ACCESSION Average Ag 1st Ag 2nd Krt78 NM_212487.3 3.61 5.56 2.88 Fetub NM_021564.2 3.56 5.05 2.77 EG433016 NM_001082547.1 3.56 3.86 6.25 Hist1h2ak NM_178183.1 3.54 4.94 3.53 Ltf NM_008522.3 3.49 5.33 1.42 Hsd17b11 NM_053262.3 3.48 4.32 3.86 Cxcl1 NM_008176.1 3.48 2.27 5.55 Hist1h2ah NM_175659.1 3.46 4.64 3.53 Smarce1 NM_020618.3 3.36 3.52 3.78 Mt4 NM_008631.2 3.28 4.70 3.32 Mfsd2 NM_029662.1 3.26 3.61 3.14 Pkp1 NM_019645.2 3.25 4.90 2.50 Chi3l1 NM_007695.2 3.25 2.89 4.70 BC024561 NM_153576.1 3.22 4.86 2.49 Itih4 NM_018746.2 3.21 2.70 4.59 Ly6d NM_010742.1 3.18 4.77 2.93 Plunc NM_011126.2 3.14 3.08 1.04 Gipc1 NM_018771.3 3.13 4.00 4.51 S100a9 NM_009114.1 3.12 3.81 5.01 Defb14 NM_183026.1 3.12 4.24 2.66 Cxcl17 NM_153576.2 3.12 4.78 2.26 Hpx NM_017371.1 3.11 2.97 3.45 Msln NM_018857.1 3.09 3.55 3.12 Krt15 NM_008469.1 3.08 3.80 2.26 Serpina3n NM_009252.2 3.03 2.86 4.15 Bglap1 NM_001037939.1 3.03 4.99 2.33 Clec4n NM_020001.1 3.03 3.91 3.08 Cd177 NM_026862.3 3.02 2.86 2.84 Ada NM_007398.3 3.02 4.53 2.73 Tnnc2 NM_009394.2 3.00 8.64 1.46-76 -
Tab. 4-14 Down-regulated genes in lung by a single instratracheal instillation of AgNPs SYMBOL ACCESSION Average Ag 1st Ag 2nd H2-Ea NM_010381.2-20.55-23.07-22.39 Chka NM_001025566.1-6.87-13.14-9.90 BC030476 NM_173421.1-6.79-11.59-10.09 Heg1 NM_172934.4-5.66-10.89-8.95 Hbb-b1 NM_008220.3-5.21-4.11-5.45 Angptl7 NM_001039554.1-5.19-2.83-3.83 Rhbdl2 NM_183163.2-4.36-6.97-6.04 Tnnc1 NM_009393.2-4.08-5.41-6.01 Ang4 NM_177544.2-3.94-3.81-2.82 Zxda NR_003292.1-3.90-5.77-5.69 Prf1 NM_011073.2-3.84-6.60-5.59 H2-Eb1 NM_010382.2-3.79-2.44-6.80 Rpl23 NM_022891.1-3.74-5.19-3.37 Edn1 NM_010104.2-3.73-5.05-3.32 Cops8 NM_133805.3-3.58-3.20-4.29 Rgs9 NM_011268.2-3.54-4.05-3.63 Dpysl2 NM_009955-3.45-5.25-3.71 Slc38a2 NM_175121.3-3.40-4.91-3.49 Mybphl NM_026831.1-3.17-4.60-4.33 Fgfr1op2 NM_026218.2-3.14-2.90-3.72 Myh6 NM_010856.2-3.05-4.88-4.23 Slc4a1 NM_011403.1-2.95-3.18-1.80 Myl4 NM_010858.4-2.94-3.01-4.05 EG241041 NR_002858.1-2.88-3.55-1.76 Dctn4 NM_026302.3-2.85-5.04-1.65 BC030499 NM_001045522.1-2.83-3.57-4.13 E330018D03Rik NM_177133.2-2.76-3.57-3.13 Myl7 NM_022879.1-2.75-3.18-4.21 Ppnr NM_012022.1-2.68-3.19-2.76 Spnb2 NM_009260.2-2.66-4.26-2.66-77 -
Tab. 4-14 (Continued) SYMBOL ACCESSION Average Ag 1st Ag 2nd BC049806 NM_172513.2-2.63-3.24-2.58 Alas2 NM_009653.1-2.63-3.76-2.00 Erdr1 NM_133362.2-2.63-3.38-2.98 Ifngr2 NM_008338.2-2.61-3.97-2.82 Ankmy2 NM_178910.1-2.58-3.27-3.37 Fabp3 NM_010174.1-2.58-2.87-3.69 Vtn NM_011707.1-2.58-2.99-2.67 Faim3 NM_026976.2-2.57-3.83-2.83 Acaa1b NM_146230.3-2.57-1.26-3.25 BC021381 NM_145382.3-2.56-3.95-2.24 Mapt NM_010838.2-2.53-4.85-2.49-78 -
4.. Toxicokinetic parameter o ABCNanotech (citrated coated silver nanoparticles, ) SD (8, 250 g, 4 ) ( : 1 mg/kg, : 10 mg/kg) ( :1 mg/kg, : 10 mg/kg). 5 ml/kg. o ( ) ( 4, : 10, 1, 2, 4, 8, 24, 48 96 ). 5 ml 0.5 ml. ( ) o Tab.4-15. o Tab.4-15.. -. citrate. o 10. 10. - 4-79 -
8. o (Entero-hepatic circulation). -. Tab. 4-15 Blood concentration of AgNPs after oral/vein administration at the indicated times (µg/ml) group 0 h 10 min 1h 2h 4h 8h 24h 48h 96h P.O 1 mg/kg 0 0 0 0.063 ±0.035 0.054 ±0.067 0.025 ±0.017 0.083 ±0.017 0 0 P.O. 10 mg/kg 0 0.031 ±0.003 0.219 ±0.304 0.179 ±0.047 0.429 ±0.205 0.673 ±0.075 0.248 ±0.008 0.166 ±0.101 0.049 ±0.032 I.V. 1 mg/kg 0 1.351 ±0.494 0.825 ±0.115 0.923 ±0.193 1.325 ±0.056 1.345 ±0.107 1.159 ±0.215 1.011 ±0.076 0.717 ±0.042 I.V. 10 mg/kg 0 3.705 ±2.006 3.319 ±1.776 2.861 ±0.441 2.707 ±0.367 4.311 ±1.269 4.671 ±1.255 5.223 ±1.723 4.905 ±1.176 o AUC (last), AUC (inf), Cmax, Tmax. AUC (Bioavailability) (Tab.4-16). o Tab.4-14 AUC (last), AUC (inf) 69.8. AUC (last) AUC (inf) 5791.6 11944.3. - 80 -
o, AUC (last), AUC (inf) 1166.0 1294.2. AUC (last) 27,569.7 AUC (inf) default 96. - AUC (last) 16.7 4.8. o AUC 1.2%. 4.2%. - Bioavailability ( ) = oral AUC (last) /i.v. AUC (last) o Cmax 0.673 ug/ml 8 Cmax 5.223 ug/ml 4. o Tmax. 30. o 10, 2880 (48 ) 10 10. o.. - 81 -
1 mg/kg (p.o.) 0.12 0.10 0.08 0.06 ug/ml 0.04 0.02 0.00-0.02-0.04 0 20 40 60 80 100 time (hour) Fig. 4-41 Changes in blood AgNPs level with time following a single oral administration (1 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h). - 82 -
10 mg/lg (p.o.) 1.0 0.8 0.6 ug/ml 0.4 0.2 0.0-0.2 0 20 40 60 80 100 time (hour) Fig. 4-42 Changes in blood AgNPs level with time following a single oral administration (10 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h). - 83 -
1 mg/kg (i.v.) 2.0 1.5 ug/ml 1.0 0.5 0.0 0 20 40 60 80 100 120 time (hour) Fig. 4-43 Changes in blood AgNPs level with time following a single intraveous administration (1 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h). - 84 -
10 mg/kg (i.v.) 8 6 ug/ml 4 2 0 0 20 40 60 80 100 time (hour) Fig. 4-44 Changes in blood AgNPs level with time following a single intraveous administration (10 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h). - 85 -
Tab. 4-16 Toxicokinetic parameters of AgNPs in rats p.o i.v Cmax Tmax Groups AUC (last) AUC (inf) (ug/ml) (min) T 1/2 (min) 1 mg/kg 69.7 60.7 0.083 1440-10 mg/kg 1166.0 1294.2 0.673 480 1813 1 mg/kg 5791.6 11944.3 1.351 10 5948 10 mg/kg 27569.7-5.223 2880 -. o 1 mg/kg, 10 mg/kg 24 96, ( ). o Tab. 4-17,..,. o. - 24 96 36%, 54%. - 96 24 30%, 10% ( ). - 86 -
- ( ). Tab. 4-17 Tissue distribution of AgNPs in lung, kidney, and liver (μg/g). Lung Kidney Liver p.o. 1 mg/kg p.o. 10 mg/kg i.v. 1 mg/kg i.v. 10 mg/kg 0h 24h 96h 0h 24h 96h 0h 24h 96h 1.9±2.4 0.1±0.2 0.0±0.0 2.3±4.2 0.04±0.05 0 0.66±1.09 0.05±0.11 1.7±2.7 0 0.3±0.3 0.3±0.5 0.15±0.08 0 2.72±1.28 0.03±0.06 6.1±1.1 1.8±1.2 1.04±0.35 0.95±0.57 1.0±0.7 63.0±32.9 6.5±5.5 10.57±2.57 11.83±5.50 0 48.43± 4.69 1919.90± 718.97 17.60± 5.28 1037.99± 241.18. (1) o (Tab.4-18). 24 1 g 378 μg, 1,663 μg. o... - 87 -
(2) o (Tab. 4-18). 24.. o. -. Tab. 4-18 Excretion of AgNPs through urine and feces p.o. 1 mg/kg p.o. 10 mg/kg i.v. 1 mg/kg i.v. 10 mg/kg treated group (24h) control group Urine (µg/ml) Feces (µg/g) 0 0.003±0.005 377.6±173.8 0 0.042±0.031 1663.1±522.2 0 0.007±0.013 1.5±2.3 0 0.018±0.311 85.2±55.1-88 -
V. 1.. o. o 50 nm, 90 nm, 250 nm, Phosphate Buffered Saline (PBS) Fetal Bovine Serum (FBS) (DMEM) 96. - FBS 1%. o Tween 80 Tween 80. - Carboxy methyl cellulose (CMC) Dimethylsulfoxide (DMSO) Tween 80.. o Sphere type - Seed (seed mediated growth method) 20 nm. Seed 10 nm seed seed. - 89 -
- Sodium citrate 50 100 nm... o rod type - 50 nm.,. Sodium citrate. o plate type - Murphy seed-mediated growth method, sodium citrate 3 4 nm seed 50nm 50 100nm. o Soduim Citrate Polyvinylpyrrolidone -,. CTAB. CTAB. Soduim citrate(sc) Polyvinylpyrrolidone(PVP). - 90 -
2.. in vitro o ( 70 nm) RAW264.7 ( : 10% FBS DMEM). o GSH NO TNF-a. MMP.. in vivo o 105 nm 5 (200, 400, 800mg/kg). IL-6, IL-12, IL-4 cytokine. o 22, 42, 71, 323nm 1 mg/kg 14,,. IgE.,,, o 50 nm 0.25, 0.5, 1 mg/kg 28.. AST ALT. pro-inflammatory cytokines (IL-1, TNF-α, IL-6), Th1-type (IL-12, IFN-γ), - 91 -
Th2-type (IL-4, IL-5, IL-10) TGF-β.,,,,,,. 3. o PBS 243nm 0.5 mg/kg 1, 7, 14, 28 BAL. 1. o granuloma (Saa3), (MMP), (mesothelin) o (intratracheal instillation), in vivo in vitro. 4. (Toxicokinetics) o Citrate coated ABC nanoparticle 1 mg/kg ( ) 10mg/kg ( ) 1, /. - 10, 1, 2, 4, 8, 24, 48 96 24 96 24. - 92 -
. o., 10. - 4 8.. o AUC citrated coating ABCNanotech 1.2%, 4.2%. o Cmax 0.673 μg/ml 8 Cmax 5.223 μg/ml 4. o T max. 30.. o,..,. o - 93 -
. - 24 96 36%, 54%. o 96 24 30%, 10% ( ).. o. 24 1 g 378 μg, 1663 μg. o. 24.. o. -. - 94 -