pissn , eissn X J Biomed Transl Res 2020;21(4): Received 29 Sep. 2020, Accepted 27

pissn 2508-1357, eissn 2508-139X J Biomed Transl Res 2020;21(4):152-164 https://doi.org/10.12729/jbtr.2020.21.4.152 Received 29 Sep. 2020, Accepted 27 Oct. 2020 Original Article Reference gene selection for gene expression study in tissues of long-tailed chickens Yunjeong Noh 1, Woncheoul Park 1, Han-Ha Chai 1,2*, Dajeong Lim 1* 1 National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea 2 College of Pharmacy, Chonnam National University, Gwangju 61186, Korea Quantitative real-time polymerase chain reaction (RTqPCR) is a rapid and precise method of analysis to quantify the level of gene expression and is widely used in the diagnosis of diseases and quantitative analysis of genes. In RT-qPCR analysis, a reference gene (or housekeeping gene) is used for normalization of experimental results. Since this method of analysis detects a small quantity of the product, it is highly sensitive and it is important for the accuracy and reproducibility of the experiment to select a reference gene suitable for gene expression studies. As the expression levels of the reference gene are affected under different conditions, in order to determine the suitability of the housekeeping gene used as the reference gene, it is necessary to verify the expression stability. In the current study, the stability of the expression of 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB, and ABL1) was investigated in the tissues of long-tailed chickens (heart, thigh, and breast). Expression stability evaluation was analyzed with four software: BestKeeper, NormFinder, genorm, and RefFinder. In our study, GAPDH in heart tissue, HPRT1 in thigh tissue, and RPL13 in breast tissue were selected as the most stable reference genes. Evaluation of the expression stability of housekeeping genes can provide important data in gene expression studies by selecting an appropriate reference gene according to various conditions. Key word: RT-qPCR, housekeeping gene, BestKeeper, genorm, NormFinder Introduction 정량적실시간중합효소연쇄반응 (quantitative real-time polymerase chain reaction, RT-qPCR) 은실시간으로증폭되는산물의양을측정하여목적유전자 (target gene) 의발현수준을정량화하는방법으로, 효율적이고정확도가높아유전자발현검증, 유전자서열변이확인과같은 SNP typing, 생체시료부터바이러스검출등다양한유전체연구에많이적용되고있다 [1]. RT-qPCR 은형광물질을통해증폭된산물을정량적으로검출하기때문에, 민감도가높아샘플의유형, RNA의양과품질, PCR의효율및피펫팅 (pipetting) 오류등여러실험적요소에의해실험결과의정확도가달라질수있다. RT-qPCR 은일정하게발현되는하우스키핑유전자 (housekeeping gene) 를기준유전자 (reference gene) 로하여동일시료로부터같은조건하에서목적유전자를증폭시켜상대적인정량을통해목적유전자의발현수준을측정한다 [2, 3]. 그러나모든조건에서기준유전자로선택된하우스키핑유전자가안정적인발현을나타내지않으며, 실험및생물학적인조건에따라발현이달라질수있기때문에, RTqPCR 분석에서실험조건별로적합한기준유전자의선정이중요하다 [4, 5]. 긴꼬리닭 (Gallus gallus var. domesticus) 은우리나라재래닭에포함되며, 국제연합농업식량기구 (http://dad.fao. org/en/home.htm, FAO) 와가축다양성정보시스템 (http:// dad.fao.org/dad-is/en/, DAD-IS) 에 Ginkkoridak 으로등재되어있으며, 다른토종닭과비교하여수컷의꽁지깃이 1 m 이상길어지는표현형특징이있다 [6]. 닭은척추동 *Corresponding author: Han-Ha Chai National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea Tel: +82-63-238-7306, E-mail: hanha@korea.kr Dajeong Lim National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea Tel: +82-63-238-7307, E-mail: lim.dj@korea.kr

Expression stability analysis of housekeeping genes 153 물의생물의학모델유기체로분자생물학과질병등을분석하기위한생물의학모델로, 닭을이용해전염병, 암연구, 유전자조절등다양한생물학적연구를수행하기위해서는유전자발현분석이필수적이다 [7]. 닭에대한 RT-qPCR 의유전자발현연구에서 TBP(TATA box binding protein), GAPDH(glyceraldehyde-3-phosphate dehydrogenase), RPL32(ribosomal protein L32), B2M(-2- microglobulin), UB(ubiquitin) [8 10] 등의하우스키핑유전자들이조직유형이나실험조건등에따라발현변화가적어 ( 높은안정성 ) 목적유전자의발현수준을정규화 (normaliztion) 하는데적합한기준유전자로많이적용된다. 그러나, 긴꼬리닭에서발현안정성이높은기준유전자를탐색하는연구는거의알려지지않았다. 특히, 긴꼬리닭의조직시료로부터기준유전자의발현안정성평가는 RT-qPCR 분석에서품종특이적인꽁지깃성장등과관련된목적유전자의발현데이터를정규화하는데기초정보로제공될것이다. 본연구는긴꼬리닭의 3가지조직 ( 심장, 다리근육, 가슴살 ) 에서 B2M, SDHA(succinate dehydrogenase complex flavoprotein subunit A), GAPDH, RPL13(ribosomal protein L13), VIM(Vimentin), EEF1A1(eukaryotic translation elongation factor 1 α 1), HPRT1(hypoxanthine phosphoribosyltransferase 1), GUSB(glucuronidase-β), RPL19(ribosomal protein L19), ACTB(β-actin), ABL1(ABL protooncogene 1, non-receptor tyrosine kinase) 을포함하는 11 개하우스키핑유전자발현을 RT-qPCR 을통해측정한후, 발현안정성을분석하였다. 통계분석은엑셀소프트웨어 BestKeeper, genorm 및 NormFinder와웹기반소프트웨어 RefFinder를사용하였고, 4종류알고리즘을통해각조직에서발현안정성이높은하우스키핑유전자의순위를정하였다. Materials and Methods RNA 추출법실험에사용된재료는저온냉동고 ( 80 ) 에보관중이던긴꼬리닭수컷 3수 ( 개체 1, 2, 4번 ) 각조직 ( 심장, 다리근육, 가슴살 ) 시료를사용하였다. 보관된조직을막자사발에서액체질소로급속냉각시킨후곱게갈아서 Trizol(Ambion, USA) 1 ml에넣고 200 μl chloroform (Sigma-Aldrich, St. Louis, MO, USA ) 과함께혼합 (vortexing) 하였다. 그리고 18,000 g에서 15분동안원심분리해투명한상층액부분을새로운튜브에분주하였다. 상층액이들어간튜브에동량의 isopropanol을 넣고 18,000 g에서 10분간원심분리후펠렛 (pellet) 을제외한상층액부분을제거하였다. 이펠렛을 70% EtOH 로수세하고, 실온에서 10분간건조하여최종적으로 RNA를얻었다. 추출한 RNA는 DEPC(diethylpyrocarbonate) water에녹인후 ND-1000 spectrophotometer(nanodrop, USA) 를이용해순도를검사하였고, 2% Agrose gel(biod, Korea) 에서전기영동하여 RNA의 degradation을확인하였다. 하우스키핑유전자의프라이머제작본연구에서는닭에서선행연구된 11개하우스키핑유전자 (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB, ABL1) 를선별하였고, 서열정보는 NCBI(National Center for Biotechnology Information) 에서각유전자의 mrna 서열을수집하여프라이머 (primer) 를제작하였다. 기본설정은증폭산물의길이 (100 170 bp), 프라이머길이 (20 mers), 어닐링온도 (annealing temperature) (60 61 ) 그리고 GC함량 (55% 60%) 으로하여 Primer 3 Plus(http://primer3plus.com/cgibin/dev/primer3plus.cgi) 프로그램을통해제작하였다 (Table 1). 각프라이머의 PCR 효율값 (Efficiency %) 은 1, 10 1, 10 2, 10 3 배씩희석하여표준곡선을통해기울기 (slope) 값을구했다 ( 이때 Efficiency % 는 (10 ( 1/slope) 1) 100값이다.)[11]. cdna 합성 cdna 합성은 SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, USA) kit 를사용하였다. cdna 합성단계에서추출한 RNA이외사용되는시약들은 SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) kit에포함된시약이다. 추출한 RNA (40 ng) 4 μl, random hexamers (50 ng/μl) 1 μl, dntp (10 mm) 1 μl, DEPC-treated water 4 μl 로제조한반응용액 Ⅰ을 65 에서 5분동안반응한후, ice에서 1분반응하였다. 그후 10 RT buffer 2 μl, MgCl 2 (25 mm) 4 μl, DTT (0.1 M) 2 μl, RNaseOUT (40 U/μL) 1 μl, SuperScript III Reverse Transcriptase (200 U/μL) 1 μl로총반응용액 10 μl를만든후반응용액 Ⅰ과함께혼합하여 25 에서 10분, 50 에서 50분, 85 에서 5분반응후바로 ice에반응하였다. 마지막으로 RNase H 1 μl 넣고 37 에서 20분간반응하여 RNA 를제거해주고 20 에보관하였다. 합성한 cdna에서각프라이머의유전자증폭을위한 PCR 반응은 GeneAmp PCR system 9700(Applied Biosystems, Foster City, CA,

154 Yunjeong Noh et al. Table 1. Primer list of housekeeping genes selected as reference genes Gene symbol Description RefSeq Sequence (5 3 ) Ampliconsize (bp) B2M -2-Microglobulin NM_001001750 F: CAAGGTGCAGGTGTACTCCC R: CCAGTCGTCGTTGAAGGACA 166 SDHA Succinate dehydrogenase complex flavoprotein subunit A NM_001277398 F: ACCATTTACCACCCCAGCAG R: AGGCAAAACGGGAATAGGCT 107 GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_204305 RPL13 Ribosomal protein L13 NM_204999 VIM Vimentin NM_001048076 EEF1A1 Eukaryotic translation elongation factor 1 α 1 NM_001321516 HPRT1 Hypoxanthine phosphoribosyltransferase 1 NM_204848 GUSB Glucuronidase- NM_001039316 RPL19 Ribosomal protein L19 NM_001030929 ACTB -Actin NM_205518 F: TCACAGCCACACAGAAGACG R: TTTCCCCACAGCCTTAGCAG F: GGATCCCAGGCGAAGAAACA R: TCCTTTCTTCGGTGCAGACG F: GCCAGATGCGTGAAATGGAG R: TGGCGAGCCATTTCTTCCTT F: GGTTACCCGGAAAGATGGCA R: TTGAAGAGGCAGACGCAGAG F: CAGAGAGACTGGCACGTGAA R: TGGGGATTGACTTGTCACTG F: TGGGTGAATGGAGTGCAAGT R: AACAGTGATGCGGCAGAGAA F: GGAAGAGAAAGGGTACGGCC R: GCGGTCGATCTTCTTGGACT F: TCTGTATGCCAACACAGTGCT R: TCATTGTGCTAGGTGCCAGG 116 118 112 109 147 111 116 101 ABL1 ABL proto-oncogene 1, non-receptor tyrosine kinase XM_015279734 F: GCCTTGTAGGGGAGAACCAC R: ACTTGTTGTAGGCCAGGCTC 141 USA) 기기를이용하였고, cdna 2 μl, 10 Buffer 2 μl, dntp (2.5 mm) 1.6 μl, forward/reverse 프라이머 (10 pmol) 각 0.4 μl, HS Taq polymerase (2.5 units/μl) 0.6 μl와멸균증류수 13 μl를넣어총 20 μl로맞추었다. 반응조건은 95 에서 11분반응후 94 에서 30초, 60 에서 30초, 72 에서 45초를 37회반복하였고, 60 에서 30분반응하여 8 에서보관하였다. PCR 산물은 2% Agarose gel에서전기영동과정을통해확인하였다. (10 pmol) 각 1 μl 넣은후 DEPC Water 6 μl를마지막으로넣어총 20 μl를만들었다. PCR조건은 50 에서 2 분, 95 에서 10분간반응후 95 에서 15초, 60 에서 1 분동안 40회반복하였다. 그리고최종적으로 95 에서 15초, 60 에서 1분, 95 에서 30초, 60 에서 15초반응시켰다. 각프라이머의유전자발현수준은한계사이클 (Threshold cycle, Ct) 을통해확인하고, 용융곡선 (Melting curve) 을통해비특이적인증폭반응을확인하였다. Real-time quantitative PCR (RT-qPCR) 분석유전자발현분석을위한 RT-qPCR 은 7500 Real-time PCR System(Applied Biosystems) 기기로수행하였고, 반응용액은 cdna 2 μl, 2X SYBR Green Master MIX (Applied Biosystemes) 10 μl, forward/reverse 프라이머 하우스키핑유전자의발현안정성분석유전자발현안정성평가는심장, 다리근육, 가슴살로구분하여분석하였다. 분석프로그램은마이크로소프트- 엑셀기반소프트웨어인 Bestkeeper [12], NormFinder [13], genorm [14] 도구를사용하였고, 마지막으로세가지도

Expression stability analysis of housekeeping genes 155 구를통합하여모든하우스키핑유전자를비교하는웹- 기반소프트웨어 RefFinder(https://www.heartcure.com.au/ reffinder/?type=reference#) 를통해전체안정성순위를정했다. Bestkeeper 분석은각유전자의 Ct값으로표준편차 (standard deviation, SD) 와변동계수 (Coefficient of variation, CV) 를통해발현변이를계산하며, 가장낮은표준편차값을가지는유전자를최적의기준유전자로나타내지만, SD > 1인유전자는일관성이없는것으로간주한다 [15]. NormFinder와 genorm 분석은 bestkeeper와달리 2 ΔCt 값으로유전자안정성을결정한다 ( 이때 ΔCt = Ct값 최저Ct값 [16] 공식을이용해상대수량으로 Ct 값을변환함 ). genorm 분석은유전자간의비교를통해상호안정성을쌍별변이 (pairwise variations, V) 로결정하고, 각유전자의평균발현안정성 (stability value, M) 값을통해가장낮은 M값을높은안정성으로정한다. NormFinder는그룹내및그룹간의발현변이를기반으로하우스키핑유전자의안정성값을분석하여최적의기준유전자순위를결정한다. Results PCR에서하우스키핑유전자들의발현각유전자의 PCR 효율값은 81% 106% 사이로나타났으며, 용융온도 (melting temperature) 는 78 86 사이 로나타났다 (Table 2). 또한전기영동에서모든하우스키 핑유전자가단일밴드의형성을보였으며 (Fig. 1), RT- qpcr 의용융곡선에서도유전자의비특이적인증폭반 응은보이지않았다 (Fig. 2, 3). 증폭된유전자의발현수 준을나타내는 Ct 값의평균은 GAPDH 가 19.27( 심장 ), Table 2. Melt temperatures and efficiency values of housekeeping genes Gene Annealing temperature ( ) Melt temperature (mean ± SD, ) Efficiency (%) B2M 60 85.5 ± 0.2 100 SDHA 60 79.1 ± 0.2 106 GAPDH 60 83.8 ± 0.2 91 RPL13 60 81.2 ± 0.2 94 VIM 60 79.4 ± 0.2 95 EEF1A1 60 81.9 ± 0.2 95 HPRT1 60 78.6 ± 0.2 104 GUSB 60 81.6 ± 0.2 101 RPL19 60 82.7 ± 0.2 100 ACTB 60 80.9 ± 0.1 94 ABL1 60 83.7 ± 0.1 81 Fig. 1. Confirmation of specific amplification and size of each primer. Electrophoresis result on 2% agarose gel of amplified product. (A) heart, (B) thigh, (C) breast.

156 Yunjeong Noh et al. Fig. 2. Melting curve of housekeeping genes amplified by RT-qPCR in long-tailed chicken thigh tissues. RT-qPCR, quantitative real-time polymerase chain reaction. 16.47( 다리근육 ), 15.26( 가슴살 ) 으로모든조직에서높은발현수준을보였으며, 심장에서는 GUSB유전자가평균 27.73으로발현수준이낮게나타났고, 다리근육과가슴살에서 ABL1 유전자가 27.37( 다리근육 ), 27.07( 가슴살 ) 로가장낮은발현수준을나타냈다. Bestkeeper 분석이소프트웨어도구는각유전자의평균 Ct값을기반으로 SD와 CV 등의값이측정되며 (Table 3), SD값이가장낮은유전자를높은안정성을가진다고간주한다. 긴꼬리닭의심장조직에서는 RPL13, GUSB, GAPDH가

Expression stability analysis of housekeeping genes 157 Fig. 3. Melting curve of housekeeping genes amplified by RT-qPCR in long-tailed chicken tissues. (A) Heart (B) Breast. RT-qPCR, quantitative real-time polymerase chain reaction. Table 3. Bestkeeper software statistical analysis of housekeeping gene in each tissues of long-tailed chicken (A) Bestkeeper analysis results in heart tissues B2M SDHA GAPDH RPL13 VIM EEF1A1 HPRT1 GUSB RPL19 ACTB ABL1 N 3 3 3 3 3 3 3 3 3 3 3 GM [Ct] 19.47 23.67 19.26 23.19 24.09 19.97 23.33 27.27 23.32 20.16 25.13 AM [Ct] 19.50 23.69 19.27 23.19 24.10 19.98 23.34 27.27 23.34 20.18 25.13 Min [Ct] 18.24 22.92 18.79 22.91 23.50 19.31 22.63 26.90 22.73 19.08 24.52 Max [Ct] 20.94 24.63 19.97 23.46 24.86 20.68 24.50 27.73 24.37 20.97 25.97 SD [± Ct] 0.96 0.63 0.46 0.19 0.51 0.47 0.77 0.31 0.69 0.73 0.56 CV [% Ct] 4.90 2.66 2.41 0.82 2.12 2.36 3.30 1.12 2.95 3.63 2.22 Max [x-fold] 2.35 1.68 1.39 1.22 1.51 1.58 1.63 1.29 1.51 2.12 1.52 Max [x-fold] 2.76 1.94 1.63 1.20 1.71 1.64 2.25 1.38 2.06 1.75 1.79 SD [± x-fold] 1.94 1.55 1.38 1.14 1.42 1.39 1.71 1.24 1.61 1.66 1.47

158 Yunjeong Noh et al. Table 3. Continued (B) Bestkeeper analysis results in thigh tissues B2M SDHA GAPDH RPL13 VIM EEF1A1 HPRT1 GUSB RPL19 ACTB ABL1 N 3 3 3 3 3 3 3 3 3 3 3 GM [Ct] 19.87 25.13 16.47 27.02 23.23 20.06 24.02 26.78 21.80 19.75 27.36 AM [Ct] 19.88 25.14 16.47 27.02 23.23 20.08 24.02 26.80 21.81 19.77 27.37 Min [Ct] 18.98 24.63 15.98 26.57 22.95 18.91 23.83 26.18 20.92 18.95 26.55 Max [Ct] 20.79 25.87 16.73 27.54 23.79 20.94 24.16 27.90 22.69 20.71 27.90 SD [± Ct] 0.61 0.49 0.33 0.35 0.37 0.78 0.13 0.73 0.59 0.63 0.55 CV [% Ct] 3.05 1.94 2.00 1.28 1.60 3.89 0.52 2.74 2.72 3.18 2.00 Max [x-fold] 1.85 1.42 1.41 1.36 1.22 2.22 1.14 1.52 1.84 1.75 1.76 Max [x-fold] 1.90 1.66 1.20 1.43 1.48 1.84 1.10 2.16 1.86 1.94 1.45 SD [± x-fold] 1.52 1.40 1.26 1.27 1.29 1.72 1.09 1.66 1.51 1.55 1.46 (C) Bestkeeper analysis results in breast tissues B2M SDHA GAPDH RPL13 VIM EEF1A1 HPRT1 GUSB RPL19 ACTB ABL1 N 3 3 3 3 3 3 3 3 3 3 3 GM [Ct] 20.43 24.28 15.25 25.30 23.14 20.39 23.35 26.07 22.13 19.43 27.07 AM [Ct] 20.44 24.29 15.26 25.31 23.15 20.40 23.36 26.08 22.13 19.44 27.07 Min [Ct] 19.57 23.78 14.95 24.93 22.20 19.61 22.90 25.42 21.92 18.97 26.60 Max [Ct] 20.94 24.92 15.47 26.06 23.92 20.96 23.92 26.92 22.52 20.38 27.71 SD [± Ct] 0.58 0.42 0.20 0.50 0.63 0.52 0.38 0.56 0.26 0.63 0.42 CV [% Ct] 2.83 1.74 1.34 1.98 2.73 2.56 1.61 2.15 1.17 3.22 1.56 Max [x-fold] 1.81 1.42 1.24 1.29 1.92 1.71 1.37 1.57 1.16 1.38 1.39 Max [x-fold] 1.42 1.55 1.16 1.69 1.71 1.48 1.48 1.80 1.31 1.93 1.56 SD [± x-fold] 1.49 1.34 1.15 1.41 1.55 1.44 1.30 1.48 1.20 1.54 1.34 N, number of samples; Ct, threshold cycle value; GM, geometric mean; AM, arithmetic mean; Min, minimal value; Max, maximal value; SD, standard deviation; CV, coefficient of variance. 가장높은발현안정성을나타내고, ACTB, HPRT1, B2M은낮은안정성을보였다. 다리근육은 HPRT1, GAPDH, RPL13 유전자가안정성이높게나타나며, ACTB, GUSB, EEF1A1은낮은안정성을보인다. 그리고가슴살에서는 GAPDH, RPL19, HPRT1이안정성이높으며, B2M, ACTB, VIM은안정성이낮게나타났다. 이결과를종합해보면 GAPDH는모든조직에서안정성이높은유전자로선택되었다 (Fig. 4). NormFinder 분석모든하우스키핑유전자의전체발현변이를추정하여 안정성값을계산하는 NormFinder 분석은심장조직에서 GAPDH, EEF1A1, ABL1이높은안정성의유전자로선택되었고, HPRT1, ACTB, B2M이낮은안정성의유전자로선별되었으며, 다리근육은 HPRT1, VIM, RPL13이높은안정성, ABL1, SDHA, GUSB가낮은안정성을보였다. 가슴살조직은 RPL13, ABL1, HPRT1의순으로안정성점수가높게나타났고, EEF1A1, VIM, B2M이낮은안정성점수를나타냈다. 각조직을그룹별로나누어그룹간비교를통해유전자의발현안정성을추정해보았을때, HPRT1과 RPL13의조합이모든조직에서안정성이높은최적의기준유전자로선택되었다 (Fig. 5).

Expression stability analysis of housekeeping genes 159 Fig. 4. Standard deviation value of 11 housekeeping genes determined by bestkeeper analysis in (A) heart, (B) thigh, and (C) breast of long-tailed chicken. Low standard deviation values indicate stable expression. Fig. 5. Stability values of 11 housekeeping genes analyzed by NormFinder. (A) heart, (B) thigh, (C) breast, and (D) total.

160 Yunjeong Noh et al. genorm 분석 genorm소프트웨어는 M값이낮을수록안정성이높음을나타내며, 기본값을 M < 1.5로제한한다 [17]. 각조직에대한모든유전자의발현안정성 M값은모두 1.5 이하로나타났다. 심장에서 ABL1, GAPDH, EEF1A1가발현안정성이높으며, RPL13, ACTB, B2M이낮은발현안정성을보였고, 다리근육에서 B2M, RPL19, ACTB는안정성이높으며, SDHA, ABL1, GUSB가낮은안정성을보였다. 가슴살에서높은발현안정성을가진유전자는 HPRT1, SDHA, GUSB이며, VIM, EEF1A1, B2M이낮은안정성을나타냈다. 기준유전자수를결정하기위해정규화인자 (normalization factor, NF) NF n 과 NF n+1 사이의쌍별변이 (V n /V n+1 ) 의값을계산하여, 0.15 미만의값 (V < 0.15) 으로제한한다 [18]. 이연구에서모든조직의 V 2/3 의값이 0.15 미만이었으며 ( 심장 : 0.053, 다리근육 : 0.036, 가슴살 : 0.073), 이는 2개기준유전자조합이데이터의정규화를위해적합하다 (Fig. 6). RefFidner 분석 RefFinder는각소프트웨어 (Bestkeeper, genorm, Norm- Fiunder) 를통합하여나온데이터를포괄적으로분석하고, 순위를기하학적평균으로계산해전체최종순위를정한다 (Table 4). 심장조직은 GAPDH, ABL1, EEF1A1이가장높은안정성을보였으며, 다리근육은 HPRT1, VIM, RPL19 그리고가슴살은 RPL13, HPRT1, SDHA가안정성이높은유전자로보였다. 낮은안정성을가진유전자는심장에서 HPRT1, ACTB, B2M이나타났고, 다리근육은 SDHA, ABL1, GUSB, 가슴살은 EEF1A1, VIM, B2M 이낮은안정성을보였다. HPRT1은가슴살과다리근육에서안정성이높지만, 심장에서는낮은안정성을보였으며, B2M은심장과다리근육에서낮은안정성을나타냈다 (Fig. 7). Discussion 연구의목적에적합한기준유전자세트는실험대상조직 ( 본연구에서골격근으로구성된심장, 다리근육, 가슴살 ) 에서하우스키핑유전자로서발현이높아쉽게측정이가능하여야하고, 발현안정성을유지하는것과더불어, 동일실험조건에서다른조직 ( 평활근으로구성된 Fig. 6. Stability (M) value of 11 housekeeping genes calculated by genorm analysis in (A) heart, (B) thigh, and (C) breast of long-tailed chicken, (D) pairwise variations (V) value calculated in genorm analysis to determine the number of reference genes for normalization.

Expression stability analysis of housekeeping genes 161 Table 4. Ranking of housekeeping genes for all software Heart Thigh Breast Total Ranking Best- Keeper Norm Finder ge Norm Ref- Finder Best- Keeper Norm Finder ge Norm Ref- Finder Best- Keeper Norm Finder ge Norm Ref- Finder RefFinder 1 RPL13 GAPDH ABL1 GAPDH HPRT1 HPRT1 B2M HPRT1 GAPDH RPL13 HPRT1 RPL13 HPRT1 2 GUSB EEF1A1 GAPDH ABL1 GAPDH VIM RPL19 VIM RPL19 ABL1 SDHA HPRT1 VIM 3 GAPDH ABL1 EEF1A1 EEF1A1 RPL13 RPL13 ACTB RPL19 HPRT1 HPRT1 GUSB SDHA ACTB 4 EEF1A1 SDHA SDHA SDHA VIM GAPDH EEF1A1 B2M SDHA SDHA RPL13 ABL1 EEF1A1 5 VIM GUSB RPL19 GUSB SDHA RPL19 VIM GAPDH ABL1 RPL19 ACTB RPL19 RPL19 6 ABL1 RPL19 HPRT1 RPL13 ABL1 ACTB HPRT1 RPL13 RPL13 ACTB ABL1 GAPDH GUSB 7 SDHA VIM VIM RPL19 RPL19 B2M GAPDH ACTB EEF1A1 GUSB RPL19 GUSB SDHA 8 RPL19 RPL13 GUSB VIM B2M EEF1A1 RPL13 EEF1A1 GUSB GAPDH GAPDH ACTB B2M 9 ACTB HPRT1 RPL13 HPRT1 ACTB ABL1 SDHA SDHA B2M EEF1A1 VIM EEF1A1 ABL1 10 HPRT1 ACTB ACTB ACTB GUSB SDHA ABL1 ABL1 ACTB VIM EEF1A1 VIM RPL13 11 B2M B2M B2M B2M EEF1A1 GUSB GUSB GUSB VIM B2M B2M B2M GAPDH Fig. 7. Expression stability ranking of the housekeeping genes calculated by the RefFinder. (A) heart, (B) thigh, and (C) breast. 소장, 대장등 ) 에서도발현안정성이유지되어야한다. 유전자발현연구에서 RT-qPCR 분석은 mrna 의발현 수준을정규화하기위해적절한기준유전자가필요하다. 대부분의 RT-qPCR 실험에서기준유전자로많이사용되 는 GAPDH, ACTB 및 HPRT1 등과같은하우스키핑유전 자들이세포의기본적인기능을담당하기때문에, 다양한

162 Yunjeong Noh et al. 조건에서도안정적인발현을나타낼것이라고생각한다. 하지만 GAPDH는닭의가슴근육및인슐린이자극된지방세포, ACTB는저산소증이유도된교모세포종세포에서발현이조절되는등특정실험조건, 세포 조직유형및대사과정에따라영향을받기때문에 [19 21], 공통으로많이사용되는하우스키핑유전자또한다양한조건에서확인실험이필요하다. RT-qPCR 에서적절한하우스키핑유전자를선택하는것은유전자발현분석에서기준이되는유전자를정하는중요한단계이며, 안정적으로발현하는기준유전자를선택하여목적유전자발현의표준화를통해실험결과를향상시킬수있다. 따라서, 본연구는긴꼬리닭의조직 ( 심장, 다리근육, 가슴살 ) 별로 RT-qPCR 데이터를정규화할수있는기준유전자를선별하기위해 4가지의분석소프트웨어도구 (BestKeeper, NormFinder, genorm 및 RefFinder) 에서 11 개하우스키핑유전자에대한발현안정성을평가하였다. 분석에사용한하우스키핑유전자는 MHC(major histocompatibility complex)-i 분자의구성요소 (B2M), 구연산회로에관여 (SDHA), 당분해로인한에너지생성에관여 (GAPDH), 리보솜단백질 (RPL13, RPL19), 세포질에서세포기관의위치결정에관여 (VIM), 번역인자 (EEF1A1), 퓨린회수경로에관여 (HPRT1), 리소좀효소의구성원 (GUSB), 세포운동성및골격과구조에관여 (ACTB), 세포의많은과정에관여하는단백질에생산관여 (ABL1) [22 28] 와같은각기관에서중요한기능을담당한다. 4가지소프트웨어에서심장조직은 GAPDH, ABL1 및 EEF1A1을안정적인유전자로선택하였으며, B2M은모든소프트웨어에서가장낮은안정성점수를받았다. GAPDH 의경우모든소프트웨어에서상위권의안정성순위를나타냈으며, 우리가연구한긴꼬리닭의심장을포함하여, 인간이나거위의심장조직에서도안정적인발현을나타내최적의기준유전자로선택되었다 [29, 30]. 또한 ABL1 은 BestKeeper를제외한소프트웨어에서높은안정성순위를나타냈다. 다리근육과가슴살은 HPRT1 유전자를각각 1순위와 2순위의높은안정성을나타냈으며, 그외에도다리근육에서 VIM과 RPL19 그리고가슴살에서 RPL13과 SDHA 순으로가장안정적인유전자로선택되었다. 결론적으로긴꼬리닭의조직에서선택된참조유전자는 GAPDH( 심장 ), HPRT1( 다리근육 ), RPL13( 가슴살 ) 이가장적합하며, 모든조직에서는 HPRT1유전자가가장안정적인기준유전자로선택되었다. 우리의연구는 RTqPCR를이용한유전자발현연구에서기준유전자들의발현안정성을평가함으로써, 참조유전자검증의중요성 을보여준다. 또한긴꼬리닭을이용한향후유전자발현 연구에서다양한실험조건과조직유형등에따라가장 안정적인기준유전자를확인하는데적용될수있다. Conflict of Interest No potential conflict of interest relevant to this article was reported. Acknowledgements 본논문은농촌진흥청연구사업 ( 세부과제번호 : PJ0133 4101, 긴꼬리닭의유전체해독및유전자발현변이정 보지도구축 ) 의지원에의해이루어진것입니다. 또한 본연구는 2020 년도농촌진흥청국립축산과학원전문연 구원과정지원사업에의해이루어진것입니다. ORCID Yunjeong Noh, https://orcid.org/0000-0002-0280-1739 Woncheoul Park, https://orcid.org/0000-0003-3140-5628 Han-Ha Chai, https://orcid.org/0000-0001-7752-3967 Dajeong Lim, https://orcid.org/0000-0003-3966-9150 Ethics Approval 국립축산과학원동물실험윤리위원회운영규정에따라 동물실험계획승인심사를받아진행하였습니다 ( 승인번 호 : 2018-628). References 1. Zhang J, Gao YY, Huang YQ, Fan Q, Tao X, Wang CK. Selection of housekeeping genes for quantitative gene expression analysis in yellow-feathered broilers. Ital J Anim Sci 2018;17:540-546. 2. Shi C, Yang F, Zhu X, Du E, Yang Y, Wang S, Wu Q, Zhang Y. Evaluation of housekeeping genes for quantitative real-time PCR analysis of Bradysia odoriphaga (Diptera: Sciarida). Int J Mol Sci 2016;17:1034. 3. Nam YK, Lee SY, Kim EJ. Evaluation of candidate housekeeping genes for the normalization of RT-qPCR analysis using development embryos and prolarvae in Russian sturgeon Acipenser gueldenstaedtii. Korean J Fish Aquat Sci 2018;51:95-106. 4. Lü J, Yang C, Zhang Y, Pan H. Selection of reference genes

Expression stability analysis of housekeeping genes 163 for the normalization of RT-Qpcr data in gene expression studies in inseclts: a systematic review. Front Physiol 2018; 9:1560. 5. Selvarajah GT, Bonestroo FAS, Timmermans Sprang EPM, Kirpensteijn J, Mol JA. Reference gene validation for gene expression normalization in canine osteosarcoma: a genorm algorithm approach. BMC Vet Res 2017;13:354. 6. Jee YM. A study on the history of Bong-Whang and Ginkkoridak (a long-tailed cock). AJMAHS 2016;6:391-401. 7. Burt DW, Carrë W, Fell M, Law AS, Antin PB, Maglott DR, Weber JA, Schmidt CJ, Burgess SC, McCarthy FM. The chicken gene nomenclature committee report. BMC Genom 2009;10:S5. 8. Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P. Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 2016;170:20-24. 9. de Boever S, Vangestel C, de Backer P, Croubels S, Sys SU. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Vet Immunol Immunopathol 2008;122:312-317. 10. Bagés S, Estany J, Tor M, Pena RN. Investigating reference genes for quantitative real-time PCR analysis across four chicken tissues. Gene 2015;561:82-87. 11. Ahn K, Huh JW, Park SJ, Kim DS, Ha HS, Kim YJ, Lee JR, Chang KT, Kim HS. Selection of internal reference genes for SYBR green qrt-pcr studies of rhesus monkey (Macaca mulatta) tissues. BMC Mol Biol 2008;9:78. 12. Pfaffi MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper - Excel based tool using pair-wise correlations. Biotechnol Lett 2004;26: 509-515. 13. Vandesompele J, de Preter K, Pattyn F, Poppe B, Van Roy N, de Paepe, A Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3: 0034. 14. Andersen CL, Jensen JL, Ørntoft TF. Normalization of realtime quantitative reverse transcription-pcr data: a modelbased variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004;64:5245-5250. 15. Li Y, Han J, Wu J, Li D, Yang X, Huang A, Bu G, Meng F, Kong F, Cao X, Han X, Pan X, Yang S, Zeng X, Du X. Transcriptome-based evaluation and validation of suitable housekeeping gene for quantification real-time PCR under specific experiment condition in teleost fishes. Fish Shellfish Immunol 2020;98:218-223. 16. Ali H, Du Z, Li X, Yang Q, Zhang YC, Wu M, Li Y, Zhang G. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro. Mol Med Rep 2015;11:3767-3773. 17. Paul S, Singh S, Chakrabarti A, Rudramurthy SM, Ghosh AK. Selection and evaluation of appropriate reference genes for RT-qPCR based expression analysis in Cadidia tropicalis following azole treatment. Sci Rep 2020;10:1972. 18. Adeola F. Normalization of gene expression by quantitative RT-PCR in human cell line: comparison of 12 endogenous reference genes. Ethiop J Health Sci 2018;28:741-748. 19. Gong H, Sun L, Chen B, Han Y, Pang J, Wu W, Qi R, Zhang TM. Evaluation of candidate reference genes for RTqPCR studies in three metabolism related tissues of mice after caloric restriction. Sci Rep 2016;6:38513. 20. Marciano CMM, Ibelli AMG, de Oliveira Peixoto J, Savoldi IR, do Carmo KB, Fernandes LT, Ledur MC. Stable reference genes for expression studies in breast muscle of normal and white striping-affected chickens. Mol Biol Rep 2020;47:45-53. 21. Sridharan P, Anbazhagan A, Chandrasekaran A, Pratheesh P. Absence of beta-2 microglobulin (B2M) and hypoxanthineguanine phosphorilbosyl transferase-1 (HPRT1) gene modulation in U87MG and U251 glioblastoma cell lines subjected to cobalt chloride mediated hypoxia. Gene Rep 2018;11: 159-164. 22. Nazari F, Parham A, Maleki AF. GAPDH, -actin and 2-microglobulin, as three common reference genes, are not reliable for gene expression studies in equine adipose- and marrow-derived mesenchymal stem cells. J Anim Sci Technol 2015;57:18. 23. Gill AJ. Succinate dehydrogenase (SDH)-deficient neoplasia. Histopathology 2018;72:106-116. 24. Biskou O, Casanova V, Hooper KM, Kemp S, Wright GP, Satsangi J, Barlow PG, Stevens C. The type III intermediate filament vimentin regulates organelle distribution and modulates autophagy. PLoS ONE 2019;14:e0209665. 25. Zeng C, Sang Y, Wang FY, Zhuang SM. Opposing roles of C/EBPα and eef1a1 in Sp1-regulated mir-122 transcription. RNA Biol 2020;17:202-210. 26. Caradec J, Sirab N, Keumeugni C, Moutereau S, Chimingqi M, Mater C, Revaud D, Bah M, Manivet P, Conti M, Loric S. Desperate house genes : the dramatic example of hypoxia. Br J Cancer 2010;102:1037-1043. 27. Wang JYJ. The capable ABL: what is its biological function? Mol Cell Biol 2014;34:1188-1197. 28. Nagaraj S, Senthil-Kumar M, Ramu VS, Wang K, Mysore

164 Yunjeong Noh et al. KS. Plant ribosomal proteins, RPL12 and RPL19, play a role in nonhost disease resistance against bacterial pathogens. Front Plant Sci 2016;6:1192. 29. Li M, Rao M, Chen K, Zhou J, Song J. Selection of reference genes for gene expression studies in heart failure for left and right ventricles. Gene 2017;620:30-35. 30. Ji H, Wang J, Liu J, Guo J, Wang Z, Zhang X, Guo L, Yang H. Selection of reliable reference genes for real-time qrt-pcr analysis of Zi Geese (Anser anser domestica) gene expression. Asian-Australas J Anim Sci 2013;26:423-432.