J Korean Acad Pediatr Dent 35(3) 2008 Real-time PCR 을이용한치주질환원인균의정량적분석 김선미 양규호 최남기 강미선 * 오종석 * 전남대학교치의학전문대학원소아치과학교실및치의학연구소및 2 단계 BK21, * 의과대학미생물학교실 국문초록 Real-time PCR 기법을이용하여구강내치태에서특정세균의존재여부를알수있을뿐아니라정량적분석이가능하게되었다. 이연구는 real-time PCR 기법을이용하여 8-18세의청소년에서치주질환원인균의조성을알아보고자전신질환이없는어린이및청소년 65명을대상으로치은연하의치태를채취하여 5종의치주질환원인균의출현율과그양을측정하고, 또한함께측정한치태지수및치은지수와의상관관계를조사하여다음과같은결론을얻었다. 1. 치태지수의평균은 1.33이었으며, 치은지수의평균은 0.97이었다. 치태지수는나이가증가할수록낮아졌다 (p<0.05). 2. 치주질환원인균의출현율은 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4%, F. nucleatum은 100% 였다. P. gingivalis, T. denticola는 10세이후출현율이증가하였고 A. actinomycetemcomitans는 8-10세군에서출현율이높았다 (p<0.05). 3. 정량적분석에서치태지수와치은지수는 F. nucleatum의양과유의한상관성이있었으며, 치태지수는치은지수와유의한상관성이있었다. T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며, T. denticola양과 A. actinomycetemcomitans도강한상관관계를가지고있었다. 주요어 : 치주질환원인균, Real-time PCR, 치태지수, 치은지수 Ⅰ. 서론치주질환은구강내에존재하는치주질환원인균및이세균들이생성하는독소들에의해서치주조직이파괴되는염증성질환이다. 구강내에는많은세균이존재하고있으나이들모든세균이치주질환에관여하지는않는다. 국소적공격형치주염과관련이있는세균은 Actinobacillus actinomycetemcomitans 1), 성인의치주질환에중요한역할을하는원인균은 red complex로분류되는 Porphyromonas gingivalis, Tannerella forsythia(bacteroides forsythus), Treponema denticola와 orange complex의하나인 Fusobacterium nucleatum 등으로알려져있다 2). 이러한치주질환원인균을발견하기위한전통적인세균배양방법은치주질환여부와관계없이 발견되지않는경우도있었다 3,4). 그러나 1990년대중반부터는분자생물학의발전으로 25-100개의세균만있어도검출이가능한중합효소연쇄반응 (Polymerase chain reaction, PCR) 이사용되고있다. 중합효소연쇄반응은세균특이성이있는 primer를이용하여적은수의세균이있을지라도쉽게검출할수있는유용한방법으로이를이용하여구강내치태나타액으로부터직접세균을검출할수있게되었고, 치주질환원인균에대한연구가많이이루어지고있다 5-8). 하지만중합효소연쇄반응은중합반응의최종단계를알아내는것으로존재여부를조사할수있지만정량적계산은어렵다. 최근에는 real-time PCR이이용되고있는데이는지수적증식단계를조사함으로써원인균의존재여부를알수있을뿐아니라정량적분석이가능하게되었다. 이러한정량적분석은치주낭내세균의조성 교신저자 : 김선미 광주광역시동구학동 8 번지 / 전남대학교병원소아치과학교실 / Tel: 062-220-5476 / E-mail: smkim1406@hanmail.net 원고접수일 : 2008 년 3 월 11 일 / 원고최종수정일 : 2008 년 4 월 21 일 / 원고채택일 : 2008 년 4 월 28 일 494
대한소아치과학회지 35(3) 2008 을알아내는데중요한역할을할수있다. 또한치주질환을진단하고적절히치료하는데치주질환원인균의양을비교조사하는것은치주질환에있어서세균의역할을이해하는데중요하다고할수있다. 전통적중합효소연쇄반응과 real-time PCR을이용한연구에서타액과치은연하치태에서치주세균의출현율은높은일치성을보였고, real-time PCR은 40분정도시간이단축되었다고보고하고있다 9). 치주상태와 P. gingivalis의관계에대해 real-time PCR을이용한연구에서치주낭의깊이와세균의양은상관성이있었으며, 치주치료후이세균의양이유의하게감소함이보고되었다 10). 이들보고들을통해치주상태의평가에 real-time PCR을이용한세균의절대적양및상대적양을측정하는것이필요하다고할수있다. 건강한정상의어린이에서치주질환으로치주조직이파괴되는경우는드물다 11). 하지만치주질환의병력이있던어린이는결국청소년기를지나성인이되어서다시치주질환을가지게될가능성이높다 12,13). 이는유치열에존재했던치주질환원인균들이치주조직에잔존하여새롭게영구치열이형성될때재집락을이루기때문이라고추정되고있다 14). 어린이및청소년의치은연하치태에서치주질환원인균의양을측정하는것은추후치주질환의예측및진단, 그리고치료효과의평가에기여할수있다. 따라서이연구는어린이및청소년의구강내치태에서 P. gingivalis, T. forsythia, T. denticola, A. actinomycetemcomitans, F. nucleatum 등 5종의치주질환원인균을 realtime PCR을이용하여출현율과양을측정하고, 측정한치태지수및치은염과의상관관계를조사하여상관성을평가해보고자하였다. Ⅱ. 연구대상및방법 1. 연구대상 2. 연구방법 1) 치태지수와치은지수의검사구강위생상태를측정하기위해서치태지수 (Plaque index of Silness and Loë) 15) 를사용하였으며측정부위는상악좌우제1대구치의협측, 상악우측중절치와하악좌측중절치의순측, 하악좌우제1대구치의설측이었다. 제 1대구치가없는경우는인접제 2유구치나제 2 소구치를검사하였다. 치태침착정도는 0-3점 (0점: 치태가없음, 1점 : 치은변연을따라탐침시묻어나는정도, 2점 : 눈에보이는상태, 3점 : 치태가많은경우 ) 으로구분하였다. 치주조직의염증상태를측정하기위해치은지수 (Gingival index of Loë) 16) 를사용하였으며, 조사치아는치태지수와같다. 탐침부위는해당면의근심, 중앙, 원심세부위였다. 치은염의정도는 0-3점 (0점: 염증소견이없음, 1 점 : 약간의발적과부종, 2점 : 탐침후출혈을동반한발적과부종, 3점 : 자연출혈을동반한염증 ) 으로구분하였다. 2) 치주질환원인균의검사 (1) 치태채취치태시료를얻기위해대상자의하악우측제1대구치또는제2유구치의근심협측부위에서멸균된이쑤시개를사용하여조심스럽게치은부위의치태를채취하였다. 채취한치태는멸균된 0.2 ml phosphate-buffered saline (PBS) 이들어있는 1.5 ml tube에수집한후 DNA 추출을위해실험실로옮겨 4 에보관하였다. (2) 치태내치주세균의 DNA 추출시료를원심분리 (12,000 rpm, 2 min) 한후다시 0.1 ml cell lysis buffer (1.0% Triton X-100, 20 mm Tris-HCl, 2 mm ethylenediaminetetraacetic acid, ph 8.0) 로현탁하고 100 에서 10분간끓여서 DNA를추출한다. 본연구대상으로는초, 중, 고교에재학중이며전신질환이없는학생 65( 남자 32명, 여자 33명 ) 명을조사대상으로하였다. 연구대상의평균연령은 12.6세였으며연령범주는혼합치열기, 영구치열기등을고려하여 4개의범주로구분하였다 (Table 1). Table 1. The distribution of the study subjects Age(year) Male Female 8-10 10 7 11-13 8 14 14-16 10 9 17-18 4 3 Total 32 33 (3) real-time PCR PCR 조건의표준화를위해 5종류의혐기성세균을각각의배지에혐기적으로배양한후표준균주의세균수를측정한후시료와같은방법으로 1 ml를튜브에취하여원심한후 PBS로 2 회세척하고 PBS 0.1 ml로 suspension하여 10배농축시킨후 DNA를추출한다음 10 2 ~10 8 까지 10배씩연속적으로희석하여 real-time PCR 정량에필요한표준곡선을작성하였다. 5종세균의 sense primer와 antisense primer (400 nm) 각각 1 μl, dual labelled probe (5 -FAM, BHQ-3') 가이용되었다 17) (Table 2). template DNA 3 μl에 2배의 QuantiTect Probe(Qiagen GmbH, Hilden, Germany) 12.5 μl, PCR Master Mix(HotStarTaq polymerase, QuantiTec Probe PCR buffer, dntp mix including dutp, 발색제 ROX TM, 8mM MgCl2), 3차멸균수를 6.5 μl첨가하여최종용량 25 μl가되게하였다. 그리고 36 well에분주하고 Rotor-Gene 495
J Korean Acad Pediatr Dent 35(3) 2008 3000 Real-time Thermal Cycler (Corbett research, Sydney, Australia) 를이용하여중합효소연쇄반응을시행하였다. 이때사용한 real-time PCR의조건은최초변성을위해 95 에서 15분간, 이후 45번의중합효소연쇄반응 cycle은 95 에서 15초, 58 에서 1분간시행하였다. 데이터분석은 Rotor-Gene analysis software version 6.0을이용하였다. Cycle threshold (CT) 는알려진숫자의 DNA농도의대수기에서시작하며, 세균수에대한표준곡선에의해서시료당세균수가측정이되었다 (Fig. 1, 2). 3) 통계분석위데이터는 SPSS 12.0을이용하여통계학적평가를시행하였다. 치태지수와치은지수를나이군에대해서비교하기위해 ANOVA를시행하였고, 사후검정으로 Tukey s studentized range test를시행하였다. 치주질환원인균의연령에따른출현율을비교하기위해카이제곱검정을시행하였다. 그리고치태지수, 치은지수와치주질환원인균의상관성을조사하기위해 Pearson 상관계수를계산하였다. Table 2. Oligonucleotide primers and probes used for real-time PCR Oligonucleotide Primers and probes Sequences (5 to 3 ) Amplicon size (bp) P. gingivalis TACCCATCGTCGCCTTGGT (1198-F) 126 CGGACTAAAACCGCATACACTTG (1323-R) Pg 1238T FAM-GCTAATGGGACGCATGCCTATCTTACAGCT-BHQ T. forsythia ATCCTGGCTCAGGATGAACG (18-F) 225 TACGCATACCCATCCGCAA (243-R) Tf 124T FAM-ATGTAACCTGCCCGCAACAGAGGGATAAC-BHQ T. denticola AGAGCAAGCTCTCCCTTACCGT (1394-F) 105 TAAGGGCGGCTTGAAATAATGA (1498-R) Td 1444T FAM-CAGCGTTCGTTCTGAGCCAGGATCA-BHQ F. nucleatum CGCAGAAGGTGAAAGTCCTGTAT (619-F) 99 TGGTCCTCACTGATTCACACAGA(719-R) Fn 663T FAM-ACTTTGCTCCCAAGTAACATGGAACACGAG-BHQ A. actinomycetemcomitans CAGCATCTGCGATCCCTGTA (1956-F) 147 TCAGCCCTTTGTCTTTCCTAGGT (2102-R) Aa 2034 FAM-TCGAGTATTCCTCAAGCATTCTCGCACG-BHQ P. gingivalis: Porphyromonas gingivalis, T. forsythia: Tannerella forsythia, T. denticola: Treponema denticola, F. nucleatum: Fusobacterium nucleatum, A. actinomycetemcomitans: Actinobacillus actinomycetemcomitans Fig. 1. Amplification of profiles for P. gingivalis-specific PCR products. Fig. 2. Standard curve was generated from the amplication plot of P. gingivalis. A suspension of P. gingivalis cells was serially diluted and subjected to real-time PCR. 496
대한소아치과학회지 35(3) 2008 Ⅲ. 연구성적 1. 치태지수와치은지수 (Table 3) 치태지수의전체평균은 1.33이었다. 나이가증가할수록치태지수가낮아지는양상이었다 (p<0.05). 치은지수의전체평균은 0.97이었다. 2. 치주질환원인균의출현율 real-time PCR을이용한치주질환원인균의출현율은 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4% 를나타내었다. 각균의연령별비교를보면 F. nucleatum은모든연령에서 100% 의출현율을보였다. P. gingivalis, T. denticola는 10 세이후출현율이증가하는양상을보였고 A. actinomycetemcomitans는어린연령군에서더많이출현하였다 (p<0.05) (Table 4). 3. 치주질환원인균의정량적조사 real-time PCR을이용한치주질환원인균의양적검사에서 F. nucleatum은모든대상자에서많은수의세균이분포하였으며다른세균보다더많은양이관찰되었다. A. actinomycetemcomitans는 출현율도적을뿐아니라양도적게분포하였다. 어린나이군부터치주질환원인균들이다양하게분포하고있었으나, 나이가증가함에따라조사한 5종의치주질환원인균의양은유의한차이를보이지않았다 (p>0.05). 한편 P. gingivalis와 T. forsythia가함께출현하는비율은 33% 였으며, T. forsythia와 T. denticola가함께출현하는경우는 20%, P. gingivalis와 T. denticola가함께출현하는경우는 18%, red complex로분류되는세종류의세균이모두출현한경우가 12% 였다 (Table 5). 4. 치주질환세균의양과치태지수, 치은지수와의상관성치태의침착정도를나타내는치태지수는 F. nucleatum의양과유의한상관성이있었으며 ( 상관계수 0.46), 치은염을나타내는치은지수또한 F. nucleatum의양과유의한상관성이있었다 ( 상관계수 0.3). 치태지수는치은지수와유의한상관성이있었다 ( 상관계수 0.7). T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며 ( 상관계수 0.81, 0.79), T. denticola양과 A. actinomectemcomitans도강한상관관계를가지고있었다 ( 상관계수 0.92). 연령별로는 11-13세군에서 P. gingivalis가 T. forsythia, T. denticola A. actinomycetemcomitans의양과강한상관관계를보이고있었다 ( 상관계수 0.94, 0.99, 0.99)(p<0.05). Table 3. Plaque index and gingival index of study population Age (year) Plaque index Gingival index 8-10 1.62 0.98 11-13 1.45 1.01 14-16 1.11 1.00 17-18 0.88 0.74 Total 1.33 0.97 Table 4. Prevalence of periodontopathic bacteria found in subjects(%) Age (year) P. gingivalis T. forsythia T. denticola F. nucleatum A. actinomycetem comitans 8-10 47.1* 47.1 17.6* 100 29.4* 11-13 50.0 59.1 31.8 100 18.2 14-16 84.2 57.9 26.3 100 5.0 17-18 71.4 42.9 57.1 100 0 Total 61.5% 53.8% 29.2% 100%` 15.4% * p<0.05 P. gingivalis: Porphyromonas gingivalis, T. forsythia: Tannerella forsythia, T. denticola: Treponema denticola, F. nucleatum: Fusobacterium nucleatum, A. actinomycetemcomitans: Actinobacillus actinomycetemcomitans 497
J Korean Acad Pediatr Dent 35(3) 2008 Table 5. Amount of periodontopathic bacteria in the subgingival plaque real-time- PCR sample P. gingivalis T. forsythia T. denticola F. nucleatum A. actinomycetem -comitans 1-4747 - 321472-2 3 - - 160926-3 - 157-65274 - 4-9 - 104887-5 197 - - 970559-6 - - - 149949-7 - - - 279982-8 27 3546 3898 198507 36 9-49 33 24889 11 10 14 784-56408 6 11 - - - 50342-12 5 - - 3843 6 13-268 9965 267749 14547 14 - - - 73063-15 28 - - 100096-16 - 16-18539 - 17 94 994 69 1651291-18 - - - 9151 6 19 487 - - 24940-20 - - - 36651-21 6 739-22097 - 22-235 - 25214-23 169-4 43640-24 21227 45657 26319 177646 34030 25 - - - 8996-26 4 10884-36035 - 27 25 17117 1227 610901-28 69 883 865 267950 4735 29-165 - 5787-30 242 - - 2070-31 - - - 64392-32 16 7-633976 - 33 207 0-92947 - 34 5 - - 70870-35 2 805 256 129214 110 36-73 94 11363-37 5772017 2-19827 - 38 182 1228-89612 - 39 908 2-1100342 - 40 14 - - 7025-41 - 158 104 168660-42 - 30-64221 - 43 - - - 1350-44 7 307-21580 - 45 29 - - 61070-46 24 188-13598 - 47 16-11 3808-48 - - - 11113-49 26 - - 8460-50 111 52 204 37774-51 - 170-42084 - 52 5 519 7 25057-53 5-10209 18287-54 503 8082-447033 - 55 15 7 170 1593-56 235 870-242850 - 57 - - 1850 1462-58 5111 926-43413 - 59 - - 97 166-60 19 - - 5222-61 8 1 3 371-62 25 85-13123 - 63 5 - - 1296-64 31 425-72618 602 65 81 1-1967 - P. gingivalis: Porphyromonas gingivalis, T. forsythia: Tannerella forsythia, T. denticola: Treponema denticola, F. nucleatum: Fusobacterium nucleatum, A. actinomycetemcomitans: Actinobacillus actinomycetemcomitans 498
대한소아치과학회지 35(3) 2008 Ⅳ. 총괄및고찰건강한치주조직에비하여치주병소에서흔히나타나는미생물들이치주질환병원균으로제시되어왔으며, 이러한병원균이군집한부위에서는치주파괴의위험이증가한다. 유년형치주염환자나성인형치주염환자의병소에서발견되는세균은같은사람의건강한부위에서나건강한사람에서는낮은비율로나타났다 18,19). 따라서치주질환의적절한치료를위해서는치태내특정병원균을알고이를제거하거나감소시키는것이필요하다. 치은연하치태는그람양성균과그람음성구균, 간균, 사상균으로구성되어있으며, 나선균과다양한편모를가진세균들이치태의하방성장을주도한다 20,21). 1996년세계치주학회에서는 A. actinomycetemcomitans, P. gingivalis, T. forsythia를파괴적치주질환을야기하는치주병원균으로규정하였다 22). A. actinomycetemcomitans는그람음성, 호이산화탄소성, 끝이둥근간균으로건강한상태의치주에서보다국소적유년형치주염, 사춘기전치주염에서증가함이보고되었다 1,23,24). P. gingivalis는그람음성, 혐기성, 비운동성의간균으로건강한사람이나치은염환자에서는드물고파괴성질환에서더많이나타나고특히치주질환이진행된환자에서더많이발견되었다 2,25). T. forsythia는그람음성, 혐기성, 방추형의다형성간균으로건강한부위나치은염부위보다파괴성치주질환또는치주농양부위에많이보이고비활동성병소보다는활동성병소에서더많이발견되었다 26,27). T. denticola는그람음성, 혐기성의활발한운동성을가진나선균으로건강한사람이나치은염환자보다는급성괴사성궤양성치주염에서그리고심한치주염환자에서더많이나타난다 28,29). F. nucleatum은그람음성, 혐기성, 방추형의간균으로치은연하치태에서가장흔히발견되는세균으로치주염을가진사람에게서널리퍼져있다 30). PCR에의한치주질환원인균의출현율을조사한연구를살펴보면 Ashimoto 등은치은염이있는어린이에서 P. gingivalis, T. forsythia, T. denticola, 그리고 A. actinomycetemcomitans가 8-14% 로출현한다고하였다 31). 한편 Kimura 등은 2-13세정상어린이에서치주질환의임상증상없이 A. actinomycetemcomitans 50%, T. forsythia 20% 가발견되었고 P. gingivalis와 T. denticola는발견되지않았다고하였다 32). Umeda 등 33) 은치주세균검사를시행하여어린이에서 P. gingivalis 8.9%, T. forsythia 42.9%, T. denticola 48.2%, A. actinomycetemcomitans가 1.8% 의빈도를보인다고보고하였다. 국내의정 34) 은 2-12세의어린이치주질환원인균을조사하여 P. gingivalis 95.7%, T. forsythia 44.3%, T. denticola 65.7%, A. actinomycetemcomitans가 20% 의빈도를보인다고보고하였다. 김등 35) 은다운증후군대상자에서 P. gingivalis 63%, T. forsythia 74.1%, T. denticola 40.7%, A. actinomycetemcomitans가 55.6% 의출현율을보인다고보고하였다. 치주질환의진단과추적조사에기여하는치주질환원인균의정성및정량적분석이최근에 real-time PCR을사용하여이루어지고있다 36-38). 전통적중합효소연쇄반응과 real-time PCR 두방법을비교한연구에서 Sakamoto 등은타액과치은연하치태에서 P. gingivalis, T. forsythia, T. denticola, A. actinomycetemcomitans등의치주세균의출현율에있어서높은일치성을보였다고하였다 9). 한편 Yoshida 등은치주질환이있는환자의타액과치은연하치태에서 A. actinomycetemcomitans와 P. gingivalis의수를검사함으로써전통적중합효소연쇄반응과 real-time PCR sensitivity를비교하였는데, real-time PCR이더민감했다고하였다 37). 본연구의 8-18세대상자의 real-timepcr을이용한연구에서는 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4% 를나타내어정등의보고보다낮았으나다른연구자들보다는높은출현율을보였는데대상자들의연령이증가된것과 real-time PCR이더민감한방법이라는주장도그이유의하나로설명할수있다. Suzuki 등 36) 은 T. forsythia와 F. nucleatum의치주낭내출현율과조성을평가했는데, 두균모두깊은치주낭에서잘자라며, 두균이서로공존관계를가진다고보고하였다. 본연구에서도 P. gingivalis 와 T. forsythia가함께출현하는비율은 33% 였으며, T. forsythia와 T. denticola가함께출현하는경우는 20%, P. gingivalis와 T. denticola가함께출현하는경우는 18%, red complex로분류되는세종류의세균이모두출현한경우가 12% 로나타나치주질환원인균들이서로공존하는양상을보였다. Kawada 등 10) 은치주상태와 P. gingivalis의관계에대해평가하였는데, 치주낭의깊이가 1mm 깊어질수록세균의수는 10배씩증가하였다고하였으며, 또한치주낭의깊이가증가할수록 P. gingivalis균의상대적양이 4.69% 증가하며, 치주치료후이세균의양이유의하게감소하였다고보고하였다. 이를통해치주치료를평가하는데있어치주상태와연관하여세균의절대적양및상대적양을측정하는것이중요하다고주장하였다. 본연구에서는치은지수와 F. nucleatum간에유의한상관성을보였고치태지수와치은지수간에상관성을보였는데이는 F. nucleatum의양이많을수록, 그리고치태가많이축적되어있을수록치은염이증가함을의미하였다. Asai 등 39) 은 T. denticola와치주낭의깊이가상관성이있음을보고하였고, Sawamoto 등 40) 도타액에서 P. gingivalis와 T. forsythia는건강한사람보다치주환자에서더많았으며, 초기치주치료후 P. gingivalis의수, 치주낭깊이, 탐침후출혈이감소함을보고하였다. T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며, T. denticola양과 A. actinomectemcomitans도강한상관관계를보이고있어이러한치주질환원인균의공존은추후치주질환을가지게될가능성을높일수있다고추정할수있다. 이상의연구인 real-time PCR을이용한치주질환원인균의정성및정량적검사를통해어린나이에서부터치주질환원인 499
J Korean Acad Pediatr Dent 35(3) 2008 균들이다양하게분포하고있음을알수있었다. 또한나이가증가함에따라치주질환원인균의출현율은증가하는양상이었으며, 연령에따른치주질환원인균의양에는유의한차이가없었지만치주질환원인균이서로상관성를가지고공존하고있음을발견하였다. 또한 F. nucleatum의양이많을수록, 그리고치태가많이축적되어있을수록치은염이증가함을나타내고있어, 추후청소년에서도정확한치주건강상태를평가함에있어 real-time PCR을이용한치주질환원인균의주기적인정성및정량적검사가도움이되리라사료된다. Ⅴ. 결론최근 real-time PCR 기법을이용하여구강내치태에서특정세균의존재여부를알수있을뿐아니라정량적분석이가능하게되었다. 이연구는 real-time PCR 기법을이용하여 8-18세의청소년에서치주질환원인균의조성을알아보고자전신질환이없는어린이및청소년 65( 남자 32명, 여자 33명 ) 명을대상으로치은연하의치태를채취하여 P. gingivalis, T. forsythia, T. denticola, A. actinomycetemcomitans, F. nucleatum 등 5종의치주질환원인균의출현율과그양을측정하고, 또한함께측정한치태지수및치은지수와의상관관계를조사하여다음과같은결론을얻었다. 1. 치태지수의평균은 1.33이었으며, 치은지수의평균은 0.97이었다. 치태지수는나이가증가할수록낮아졌다 (p<0.05). 2. 치주질환원인균의출현율은 P. gingivalis 61.5%, T. forsythia 53.8%, T. denticola 29.2%, A. actinomycetemcomitans 15.4%, F. nucleatum은 100% 의출현율을보였다. P. gingivalis, T. denticola는 10세이후출현율이증가하는양상을보였고 A. actinomycetemcomitans는어린연령군인 8-10세군에서출현율이높았다 (p<0.05). 3. 정량적분석에서 F. nucleatum은모든대상자에서다른세균보다많은양이관찰되었다. 연령에따른치주질환원인균의양에는유의한차이가없었지만치주질환원인균이서로상관성을가지고공존하고있었다. 4. 치태지수와치은지수는 F. nucleatum의양과유의한상관성이있었으며, 치태지수는치은지수와유의한상관성이있었다. T. forsythia는 A. actinomycetemcomitans, T. denticola양과강한상관성을보였으며 ( 상관계수 0.81, 0.79), T. denticola양과 A. actinomycetemcomitans도강한상관관계를가지고있었다 ( 상관계수 0.92). 청소년의구강내치태에는치주질환을유발하는세균들이다양하게공존하고있었으며, 치은염을나타내는치은지수는치태지수와 F. nucleatum의양과유의한상관성이있었다. 참고문헌 1. Mandell RL : A longitudinal microbiological investigation of Actinobacillus actinomycetemcomitans and Eikenella corrodens in juvenile periodontitis. Infect Immun, 45:778-780, 1984. 2. Haffajee AD, Socransky SS : Microbial etiological agents of destructive periodontal diseases. Periodontol, 5:78-111, 1994. 3. Frisken KW, Tagg JR, Laws AJ, et al. : Suspected periodontopathic microorganisms and their oral habitats in young children. Oral Microbiol Immunol, 2:60-64, 1987. 4. Delaney JE, Kornman KS : Microbiology of subgingival plaque from children with localized prepubertal periodontitis. Oral Microbiol Immunol, 2:71-76, 1987. 5. Slots J, Ashimoto A, Flynn MJ, et al. : Detection of putative periodontal pathogens in subgingival specimens by 16S ribosomal DNA amplification with the polymerase chain reaction. Clin Infect Dis, 20(2): 304-307, 1995. 6. Conrads G, Mutters R, Fischer J, et al. : Reaction and dot-blot hybridization to monitor the distribution of oral pathogens within plaque samples of periodontally healthy individuals. J Periodontol, 67:994-1003, 1996. 7. Watanabe K, Frommel TO : Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans and Treponema denticola detection in oral plaque samples using the polymerase chain reaction. J Clin Periodontol, 23:212-219, 1996. 8. Okada M, Hayashi F, Nagasaka N. : PCR detection of 5 putative periodontal pathogens in dental plaque samples from children 2 to 12 years of age. J Clin Periodontol, 28:576-582, 2001. 9. Sakamoto M, Takeuchi Y, Umeda M, et al. : Rapid detection and quantification of five periodontopathic bacteria by real-time PCR. Microbiol Immunol, 45:39-44, 2001. 10. Kawada M, Yoshida A, Suzuki N, et al. : Prevalence of Porphyromonas gingivalis in relation to periodontal status assessed by real-time PCR. Oral Microbiol Immunol, 19:289-292, 2004. 11. Könönen E : Development of oral bacterial flora in young children. Ann Med, 32:107-112, 2000. 500
대한소아치과학회지 35(3) 2008 12. Sweeny EA, Alcoforado GAP, Nyman S, et al. : Prevalence and microbiology of localized prepubertal periodontitis. Oral Microbiol Immunol, 2:65-70, 1987. 13. Sjödin B, Crossmer CG, Unell L, et al. : A retrospective radiographic study of alveolar bone loss in the primary dentition in patients with localized juvenile periodontitis. J Clin Periodontol, 16:125-127, 1989. 14. Watanabe K, Frommel TO : Detection of Porphyromonas gingivalis in oral plaque samples by use of the polymerase chain reaction. J Dent Res, 72:1040-1044, 1993. 15. Silness J, Löe H : Periodontal disease in pregnancy. Correlation between oral hygiene and periodontal condition. Acta Odontol Scand, 22:112-135, 1964. 16. Löe H : The gingival index, the plaque index and the retention index system. J Dent Res, 38:610-616, 1927. 17. Kato H, Yoshida A, Awano S, et al. : Quantitative detection of volatile sulfur compound producing microorganism in oral specimens using real-time PCR. Oral Dis, 11:67-71, 2005. 18. Slots J : The predominant cultivable organisms in juvenile periodontitis. Scand J Dent Res, 84:1-10, 1976. 19. Slots J : The predominant cultivable microflora of advanced periodontitis. Scand J Dent Res, 85:114-121, 1997. 20. Schroeder HE, De Boever J : The structure of microbial dental plaque. In: McHugh, W.D., ed. Dental plaque. Edinburgh: Livingstone, 49-74, 1970. 21. Listgarten MA : Structure of the microbial flora associated with periodontal health and disease in man. A light and electron microscopic study. J Periodontol, 47:1-18, 1976. 22. Consensus report. Anonymous. Periodontal diseases: Pathogenesis and microbial factors. Ann Periodontol, 1:926-932, 1996. 23. Slots J, Reynolds HS, Genco RJ : Actinobacillus actinomycetemcomitans in human periodontal disease: a cross-sectional microbiological investigation. Infect Immun, 29:1013-1020, 1980. 24. Newman MG, Socransky SS, Savitt ED, et al. : Studies of the microbiology of periodontosis. J Periodontol, 47:373-379, 1976. 25. Lopez NJ : Occurrence of Actinobacillus actimomycetemcomitans, Porphyromons gingivalis and Prevotella intermedia in progressing adult periodontitis. J Periodontol, 71:948-954, 2000. 26. Papapanou PN, Neiderud AM, Papadimitriou A, et al. : "Checkerboard" assessments of periodontal microbiota and their antibody responses: a case control study. J Periodontol, 71:885-987, 2000. 27. Lai CH, Listgarten MA, Shirakawa M, et al. : Bacteroides forsythus in adult gingivitis and periodontitis. Oral Microbiol and Immunol, 2:152-157, 1987. 28. Listgarten MA : Electron microscopic observations of the bacterial flora of acute necrotizing ulcerative gingivitis. J Periodontol, 36:328-339, 1965. 29. Simonson LG, Robinson PJ, Pranger RJ, et al. : Quantitative relationship of Treponema denticola to severity of periodontal disease. Infect Immun, 56:726-728, 1988. 30. Dzink JL, Tanner ACR, Haffajee AD, et al. : Gramnegative species associated with active destructive periodontal lesions. J Clin Periodontol, 12:648-659, 1985. 31. Ashimoto A, Chen C, Bakker I, et al. : Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol Immunol, 11:266-273, 1996. 32. Kimura S, Ooshima T, Takiguchi M, et al. : Periodontopathic bacterial infection in childhood. J Periodontol, 73:20-26, 2002. 33. Umeda M, Miwa Z, Takeuchi Y, et al. : The distribution of periodontopathic bacteria among Japanese children and their parents. J Periodontol Res, 39:398-404, 2004. 34. 정우성 : 어린이의치은연하치태내치주질환원인균의출현율조사. 경희대학교대학원, 2004. 35. 김선미, 양규호, 최남기, 등 : 다운증후군환자의치주질환원인균의출현율. 대한소아치과학회지, 32(4):717-725, 2005. 36. Suzuki N, Yoshida A, Saito T, et al. : Quantitative microbiological study of subgingival plaque by realtime PCR shows correlation between levels of Tannerella forsythensis and Fusobacterium spp. J Clin Microbiol, 42:2255-2257, 2004. 37. Yoshida A, Suzuki N, Nakano Y, et al. : Development of a 5' fluorogenic nuclease-based realtime PCR assay for quantitative detection of 501
J Korean Acad Pediatr Dent 35(3) 2008 Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. J Clin Microbiol, 41:863-866, 2003. 38. Lyons SR, Griffen AL, Leys EJ : Quantitative realtime PCR for Porphyromonas gingivalis and total bacteria. J Clin Microbiol, 38:2362-2365, 2000. 39. Asai Y, Jinno T, Igarashi H, et al. : Detection and quantification of oral treponemes in subgingival plaque by real-time PCR. J Clin Microbiol, 40:3334-3340, 2002. 40. Sawamoto Y. Sugano N, Tanaka H, et al : Detection of periodontopathic bacteria and an oxidative stress marker in saliva from periodontitis patients. Oral Microbiol Immunol, 20:216-220, 2005. 502
대한소아치과학회지 35(3) 2008 Abstract QUANTITATIVE DETECTION OF PERIODONTOPATHIC BACTERIA USING REAL-TIME PCR Seon-Mi Kim, Kyu-Ho Yang, Nam-Ki Choi, Mi-Sun Kang*, Jong-Suk Oh* Department of Pediatric Dentistry, School of Dentistry, Chonnam National University and Dental Research Institute and second stage of BK 21, *Department of Microbiology, College of Medicine, Chonnam National University The detection of special bacteria of oral plaque and quantitative analysis are possible through the real-time PCR technique. The aim of this study was to investigate the prevalence and the amount of five periodontopathic bacteria using real-time PCR, and evaluate the relationship among amount of bacteria, plaque index and gingival index. Sixty five subjects ranging from 8 to 18 years old were enrolled. Plaque index and gingival index were examined and five periodontopathic bacteria were surveyed in subgingival plaque samples. The results were analyzed by ANOVA and Pearson's correlation. Results: The prevalence of P. gingivalis was 61.5%, T. forsythia was 53.8%, T. denticola was 29.2%, A. actinomycetemcomitans was 15.4% and F. nucleatum was 100%. Plaque index and gingival index have a significant relationship with the amount of F. nucleatum. The amount of T. forsythia has a strong relationship with the amount of T. denticola and A. actinomycetemcomitans(p<0.05). Key words : Periodontopathic bacteria, Real-time PCR, Plaque index, Gingival index 503