45 3, (2018) Korean J. Poult. Sci. Vol.45, No.3, (2018) Study on the Characteri

Size: px
Start display at page:

Download "45 3, (2018) Korean J. Poult. Sci. Vol.45, No.3, (2018) Study on the Characteri"

Transcription

1 45 3, (2018) Korean J. Poult. Sci. Vol.45, No.3, (2018) Study on the Characteristics of Feather Developing Pattern and Morphology in Early- and Late-Feathering Korean Native Chickens Min Hee Bang 1, Eun Jung Cho 2, Chang Yeon Cho 3 and Sea Hwan Sohn 4 1 Student, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea 2 Researcher, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea 3 Researcher, Animal Genetic Resources Research Center, National Institute of Animal Science, RDA, Namwon 55717, Republic of Korea 4 Professor, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea ABSTRACT Chicken feathers could be classified into early-feathering (EF) and late-feathering (LF) depending on the development and patterns of the wing and tail feathers. Currently, feather-sexing is a widely used chick sexing method in the industry. This study was carried out to suggest the method of classifying of EF and LF chicks to establish auto-sexing Korean native chicken (KNC) strains. The development and morphology of wing feathers and tail feathers in 856 KNCs from hatching to 55-days old were analyzed to classify EF and LF chicks. We also performed PCR analysis using K-specific gene primers to confirm the agreement between the phenotypes and genotypes of EF and LF chickens. In the results, the EF chicks had long primaries and coverts, and there was a significant difference in length between primaries and coverts. The LF chicks had shorter primaries and coverts than the EF chicks, and showed little difference in the length between primaries and coverts. LF chicks could be classified into four groups: LF-Less, LF-Scant, LF-Equal and LF-Reverse according to their wing feather patterns. EF chicks had 1.5 times longer primaries than LF chicks until they were 15-days old, but the lengths were almost the same at 50-days old. The tail feathers of the EF chicks were apparent at 5-days old, but those of the LF chicks were short and indefinite at that time. When EF and LF chicks were classified by the length of primaries being more or less than 9 mm, the classification accuracies for EF and LF chicks were 96.2% and 85.4%, respectively, compared to the PCR results. In conclusion, juvenile EF and LF KNC showed distinct differences in feather development and morphology, and could be easily distinguished at one day-old. (Key words: Korean native chicken, early-feathering chick, late-feathering chick, feather classification, feather-sexing).., (Masui et al., 1925; Martin, 1934), (Mueller and Moultrie, 1952; Plumart and Mueller, 1954; Siegel et al., 1957; Somes, 1969; Warren, 1976; Mc- Gibbon, 1977; SAFRS, 2011). (Saitoh and Mizuno, 1992; Klein To whom correspondence should be addressed : shsohn@gntech.ac.kr

2 156 : and Ellendorff, 2000; Sohn et al., 2012), (Weissmann et al., 2013) (Fluorescence and Raman spectroscopy) (Galli et al., 2018),.,. K Avian ev-21 gene PRLR SPEC2 Z (Humphries et al., 1984; Bacon et al., 1988; Lakshmanan et al., 1992; Iraqi et al., 1995; Bitgood, 1999 Elferink et al., 2008; Zhao et al., 2016),, (Z K W), (Z k Z k ) (Z k W), (Z K Z k ).,,.,, (Saeki and Katsuragi, 1961; Goodman and Muir, 1965; Lowe and Garwood, 1981; Harris et al., 1984; Fotsa et al., 2001; Khosravinia, 2009; Sohn et al., 2013).,, (Siegel et al., 1957; SAFRS, 2011; Sohn et al., 2012). Siegel et al.(1957) Rhode Island 12, 3 5,., Aviagen 1/2 3/4,, (Aviagen Brand, 2018). Sohn et al.(2012),.,.,., , 744, , 3 3 (74 cm 60 cm 35 cm/cage), ,, (IACUC ; ). 2 (primaries) (coverts).

3 Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 157 5, 7, 10, 15, ,. 7, genomic DNA polymerase chain reaction(pcr). primer ev21 JFIL-1 5 GGGGTCAGCATGTTTAAAGG 3 (forward) 5 TTGA- GTCCCTAACGATTGCG 3 (reverse) (Iraqi and Smith, 1994). primer PCR TaKaRa Taq TM kit(takara, Kyoto, Japan), PCR 10 buffer 2.5 μl, dntp 2 μl, Taq polymerase 2 μl (0.5 unit/μl), primer 4 μl(5 pmol/μl), genomic DNA 3 μl (100 ng/μl) ddh 2 O 11.5 μl 25 μl. PCR 95 5, 95 1, 56 1, PCR 200 ng/μl band (Fig. 1). SAS (SAS Institute Inc., Cary, NC, USA) t-test. Gallus gallus endogenous virus-21 JFIL-1 DNA PCR., Table , %. 100% Table 1. The conformity between morphological feathering classification and PCR analysis for the identification of earlyand late-feathering chicks Feathering types Phenotypic analysis PCR analysis Conformity (%) Early feathering Late feathering Total (854/856) Fig. 1. The results from polymerase chain reaction using the K-specific primer in chickens. M is the 100bp size marker. Lanes of 1, 3, 5, 7, 9, 11, 13, and 15 are late-feathering chicks. Lanes of 2, 4, 6, 8, 10, 12, and 14 are early-feathering chicks.

4 158 :. Fig. 2 1 (primaries; ) (primary covert; ) 2 (secondaries) (middle primary covert), 10.,. Fig. 3., 1/2 1/3. EF-1, EF-2,., LF-Less, LF-Scant, LF-Equal LF-Reverse 4. LF-Less,. LF-Scant 1 2 mm. LF-Equal, LF-Reverse. 112 LF-Equal 52%, LF-Less 35%, LF-Reverse 11%, LF-Scant 2%. Aviagen Brand(2018),, Sohn et al.(2012),. Somes(1969; 1970) McGibbon(1977). Fig Fig. 5, Fig. 6. EF-1 EF-2,., 1 13 mm, 9 mm, 7 1.7, 15 2, , Fig. 2. Chicken wing feather; a) Photograph of chicken wing feathers and number of primaries. b) Diagram of chicken wing feather structure based on the left figure.

5 Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 159 Fig. 3. The patterns of wing feather in early-feathering and late-feathering day-old chicks. EF-1 and EF-2 are early-feathering types, and LF-Less, LF-Scant, LF-Equal and LF-Reverse are late-feathering types. Fig. 4. The diagram of wing feather types of early-feathering and late-feathering chicks at day-old. The diagram was based on the length of second primary and it s covert. LF-Less showed that both of the primaries and coverts were shorter than the early-feathering chick s. LF-Scant had almost no coverts. LF-Equal had the same length of primaries and coverts. LF-Reverse showed the coverts were longer than the primaries.

6 160 : Fig. 5. The developmental patterns of wing feathers in early-feathering chicks (EF-1, EF-2) and late-feathering chicks (LF-Equal, LF-Reverse, LF-Less, LF-Scant)., 15,. LF-Less,. LF-Scant LF-Equal LF-Reverse

7 Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 161 Fig. 6. The length of primaries and coverts in early-feathering chicks (EF) and late-feathering chicks (LF-Less, LF-Scant, LF-Equal and LF-Reverse) from one-day-old to 55-day-old., 7, 10. Fig

8 162 : Fig. 7. Comparison of primary length between early-feathering and late-feathering chicks from one-day-old to 55-day-old. * P<0.05, ** P< , 5 1.7, , , ,, 1 7, 10., 5.. 4, 1, mm 9 mm 9 mm, 9 mm, 96.2%, 85.4%. LF-Equal 9 mm ,. Fig , 5, 17. Fig

9 Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 163 Fig. 8. The development of tail feather of early-feathering chicks (EF) and late-feathering chicks (LF) from one-day-old to 15-day-old. Fig. 9. The comparison of developmental pattern of tail feathers between the early-feathering chicks and the late-feathering chicks.. 7,,., 17, Siegel et al.(1957) 12, Sohn et al.(2012) 5., 5. 8~12,..,

10 164 :. K- PCR.,,.,,. LF-Less, LF-Scant, LF-Equal LF-Reverse , 5,. 9 mm 96.2%, 85.4%.. ( :,,,, ) ( : PJ ). Aviagen Brand 2018 Feather sexing day-old chicks in the hatchery. ayoldchicks-en-17.pdf Bacon LD, Smith E, Crittenden LB, Havenstein GB 1988 Association of the slow feathering (K) and an endogenous viral (ev21) gene on the Z chromosome of chickens. Poult Sci 67(2): Bitgood JJ 1999 Linkage relationships of the Z-linked silver, slow feathering, and pop-eye loci. Poult Sci 78(8): Elferink MG, Vallée AA, Jungerius AP, Crooijmans RP, Groenen MA 2008 Partial duplication of the PRLR and SPEF2 genes at the late feathering locus in chicken. BMC Genomics 9:391. Fotsa JC, Mérat P, Bordas A 2001 Effect of the slow (K) or rapid (k+) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn x brown egg type cross. Genet Sel Evol 33(6): Galli R, Preusse G, Schnabel C, Bartels T, Cramer K, Krautwald-Junghanns ME, Koch E, Steiner G 2018 Sexing of chicken eggs by fluorescence and Raman spectroscopy through the shell membrane. PLoS One 13(2): e Goodman BL, Muir FV 1965 The influence of comb and feathering phenotypes on body weight and dressing percentage in broilers. Poult Sci 44(3): Harris DL, Garwood VA, Lowe PC, Hester PY, Crittenden LB, Fadly AM 1984 Influence of sex-linked feathering phenotypes of parents and progeny upon lymphoid leukosis virus infection status and egg production. Poult Sci 63(3): Humphries EH, Danhof ML, Hlozanek I 1984 Characterization of endogenous viral loci in five lines of white Leghorn chickens. Virology 135(1): Iraqi F, Robinson D, Smith EJ 1995 A restriction enzyme map of the sex-linked late-feathering locus of chickens. Poult Sci 74(9): Iraqi F, Smith EJ 1994 Determination of the zygosity of ev21-k in late-feathering male White Leghorns using the polymerase chain reaction. Poult Sci 73(7): Khosravinia H 2009 Effect of the slow (K) or rapid (k+) feathering gene on carcass related traits of broiler chickens selected for breast and thighs weight. Genetika 45(1): Klein S, Ellendorff F 2000 Localisation of Xho1 repetitive sequences on autosomes in addition to the W chromosome in chickens and its relevance for sex diagnosis. Anim Genet 31(2): Lakshmanan N, Ponce de Leon FA, Smyth JR, Smith EJ 1992 Chromosomal assignment of the evil locus in chickens using fluorescent in situ suppression hybridization (FISH). Page 10 In: 10th European Colloquium on Cytogenetics of Domestic Animals. Bosma AA ed. University Press,

11 Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 165 Utrecht, The Netherlands. Lowe PC, Garwood VA 1981 Independent effects of K and k+ alleles and maternal origin on mortality and performance of crossbred chickens. Poult Sci 60(6): Martin JH 1934 Review the 'sexing baby chicks by Masui and Hashimoto. Poult Sci 13(3):190. Masui K, Hashimoto J, Ono I 1925 The rudimental copulatory organ of the male domestic fowl with reference to the sexual differentiation of chickens. Jpn J Zootech Sci 1(3): McGibbon WH 1977 A sex-linked mutation affecting rate of feathering in chickens. Poult Sci 56(3): Mueller CD, Moultrie F 1952 Classification of sex-linked early and late feathering in 10-week-old chickens. Poult Sci 31(1): Plumart PE, Mueller CD 1954 Effect of sex-linked early feathering on plumage from 6 to 12 weeks of age. Poult Sci 33(4): Saeki Y, Katsuragi T 1961 Effect of early and late feathering gene on growth on New Hampshire, Leghorns and their crossbreds. Poult Sci 40(6): SAFRS 2011 Chicken sexing, primary industries and fisheries. Queensland government, Web au/27_2712.htm Saitoh Y, Mizuno S 1992 Distribution of XhoI and EcoRI family repetitive DNA sequences into separate domains in the chicken W chromosome. Chromosoma 101(8): Siegel PB, Mueller CD, Craig JV 1957 Some phenotypic differences among homozygous, heterozygous, and hemizygous late feathering chicks. Poult Sci 36(2): Sohn SH, Cho EJ, Kang BS 2012 Sex identification of newly hatched chicks by fluorescence in situ hybridization using a W-specific DNA probe in feather follicle cells. J Poult Sci 49(4): Sohn SH, Kim NY, Park DB, Song HR, Cho EJ, Choi SB, Heo KN, Choi HC 2013 Influence of early- and latefeathering phenotype on productive performance in the feather-sexing strains of Korean native chicken. Korean J Poult Sci 40(3): Sohn SH, Park DB, Song HR, Cho EJ, Kang BS, Suh OS 2012 Genotype frequencies of the sex-linked feathering and their phenotypes in domestic chicken breeds for the establishment of auto-sexing strains. J Anim Sci Tech 54(4):1-10. Somes RG 1969 Delayed feathering, a third allele at the K locus of the domestic fowl. J Hered 60(5): Somes RG 1970 The influence of the rate of feathering allele Kn on various quantitative traits in chickens. Poult Sci 49(5): Warren DC 1976 Feather-sexing chicks. Poult Tribune 82(2): Weissmann A, Reitemeier S, Hahn A, Gottschalk J, Einspanier A 2013 Sexing domestic chicken before hatch: A new method for in ovo gender identification. Theriogenology 80(3): Zhao J, Yao J, Li F, Yang Z, Sun Z, Qu L, Wang K, Su Y, Zhang A, Montgomery SA, Geng T, Cui H 2016 Identification of candidate genes for chicken early- and late-feathering. Poult Sci 95(7): Received Jun. 14, 2018, Revised Aug. 5, 2018, Accepted Aug. 9, 2018

12

44 4, (2017) Korean J. Poult. Sci. Vol.44, No.4, (2017) The Effect of Early Chick Weigh

44 4, (2017) Korean J. Poult. Sci. Vol.44, No.4, (2017) The Effect of Early Chick Weigh 44 4, 259 265 (2017) Korean J. Poult. Sci. Vol.44, No.4, 259 265 (2017) https://doi.org/10.5536/kjps.2017.44.4.259 259 The Effect of Early Chick Weight on Market-Weight in Korean Native Chickens Ki Gon

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

<31372DB9CCB7A1C1F6C7E22E687770>

<31372DB9CCB7A1C1F6C7E22E687770> 미래지향 고령친화 주거디자인을 위한 예비노인층의 라이프스타일 특성 Characteristics of Lifestyle of the Pre-Elderly for Future Elderly-friendly Housing Design 류 혜 지 청운대학교 인테리어디자인학과 교수 Ryu hye-ji Dept. of Interior Design, Chungwoon University

More information

230 한국교육학연구 제20권 제3호 I. 서 론 청소년의 언어가 거칠어지고 있다. 개ㅅㄲ, ㅆㅂ놈(년), 미친ㅆㄲ, 닥쳐, 엠창, 뒤져 등과 같은 말은 주위에서 쉽게 들을 수 있다. 말과 글이 점차 된소리나 거센소리로 바뀌고, 외 국어 남용과 사이버 문화의 익명성 등

230 한국교육학연구 제20권 제3호 I. 서 론 청소년의 언어가 거칠어지고 있다. 개ㅅㄲ, ㅆㅂ놈(년), 미친ㅆㄲ, 닥쳐, 엠창, 뒤져 등과 같은 말은 주위에서 쉽게 들을 수 있다. 말과 글이 점차 된소리나 거센소리로 바뀌고, 외 국어 남용과 사이버 문화의 익명성 등 청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이 229 한국교육학연구 제20권 제3호 The Korea Educational Review 2014. 10. Vol.20. No.3. pp.229-251. 1) 청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이* 강기수 조규판(동아대학교) [요 약] 본 연구의 목적은 청소년의 개인변인인

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

<35BFCFBCBA2E687770>

<35BFCFBCBA2E687770> 주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

11¹ÚÇý·É

11¹ÚÇý·É Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

82-01.fm

82-01.fm w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon

[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon [ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to

More information

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -

More information

아태연구(송석원)13-2-05.hwp

아태연구(송석원)13-2-05.hwp 아태연구 제 13권 제 2호 2006년 11월 30일 pp.81~103 일본에서의 한국학연구 - 회고와 전망 宋 錫 源 경희대학교 사회과학부 정치외교학과 조교수 Ⅰ. 머리말 Ⅱ. 1945년 이전의 한국연구 Ⅲ. 1945년 이후의 한국연구 < 목 차 > Ⅳ. 맺음말 참고문헌 Abstract Key words(중심용어): 한국학(Korean studies), 식민지지배(colonial

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

歯14.양돈규.hwp

歯14.양돈규.hwp : The Korean Journal of Counseling and Psychotherapy 2003. Vol. 15, No. 3, 615-631. 1 2 3 1,410.,, ( ),., ( 69%),.,, ( ), ( ).,,.., ( ).,. :,,. :, (390-711) 21-1, : 043-649-1362 E-mail : ydk9498@hanmail.net

More information

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability 27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466> 001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

V V V α Azam, M. Z. M. & Park, Dong-Ho (2012). The relationship between Digit Ratio(2D:4D) and Physical Fitness in Children. Journal of Korean Society of Living Environmental System, 19(1), 101-110.

More information

44-3대지.08류주현c

44-3대지.08류주현c A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional

More information

황지웅

황지웅 Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic

More information

Microsoft Word - KSR2012A021.doc

Microsoft Word - KSR2012A021.doc YWXY G ºG ºG t G G GGGGGGGGGrzyYWXYhWYXG Ÿƒ Ÿ ± k ¹Ÿˆ Review about the pantograph field test result adapted for HEMU-430X (1) ÕÕÛ äñ ã G Ki-Nam Kim, Tae-Hwan Ko * Abstract In this paper, explain differences

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * The Mediating Eff

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI:   * The Mediating Eff Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.159-177 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.159 * The Mediating Effects of Self-esteem on the Relationship between Social

More information

Àå¾Ö¿Í°í¿ë ³»Áö

Àå¾Ö¿Í°í¿ë ³»Áö Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment

More information

,......

,...... The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of

More information

05-08 087ÀÌÁÖÈñ.hwp

05-08 087ÀÌÁÖÈñ.hwp 산별교섭에 대한 평가 및 만족도의 영향요인 분석(이주희) ꌙ 87 노 동 정 책 연 구 2005. 제5권 제2호 pp. 87118 c 한 국 노 동 연 구 원 산별교섭에 대한 평가 및 만족도의 영향요인 분석: 보건의료노조의 사례 이주희 * 2004,,,.. 1990. : 2005 4 7, :4 7, :6 10 * (jlee@ewha.ac.kr) 88 ꌙ 노동정책연구

More information

<28C3D6C1BE29312DC0CCBDC2BEC62E687770>

<28C3D6C1BE29312DC0CCBDC2BEC62E687770> 한국패션디자인학회지 제9권3호 The Korean Society of Fashion Design Vol. 9 No. 3 (2009) pp.1~12 소니아 리키엘 컬렉션에 나타난 니트웨어 색채 특성 The Color Characteristics of Knit Wear Shown in Sonia Rykiel s Collections 이 승 아ㆍ조 주 연ㆍ이 연

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not

More information

<31372DB9DABAB4C8A32E687770>

<31372DB9DABAB4C8A32E687770> 김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May

More information

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

216 동북아역사논총 41호 인과 경계공간은 설 자리를 잃고 배제되고 말았다. 본고에서는 근세 대마도에 대한 한국과 일본의 인식을 주로 영토와 경계인 식을 중심으로 고찰하고자 한다. 이 시기 대마도에 대한 한일 양국의 인식을 살펴볼 때는 근대 국민국가적 관점에서 탈피할

216 동북아역사논총 41호 인과 경계공간은 설 자리를 잃고 배제되고 말았다. 본고에서는 근세 대마도에 대한 한국과 일본의 인식을 주로 영토와 경계인 식을 중심으로 고찰하고자 한다. 이 시기 대마도에 대한 한일 양국의 인식을 살펴볼 때는 근대 국민국가적 관점에서 탈피할 전근대시기 한국과 일본의 대마도 인식 215 전근대시기 한국과 일본의 대마도 인식 하우봉 전북대학교 사학과 교수 Ⅰ. 머리말 브루스 배튼(Bruce Batten)의 정의에 따르면 전근대의 국경에는 국경선으로 이루어진 boundary가 있고, 공간으로 이루어진 frontier란 개념이 있다. 전자 는 구심적이며 내와 외를 격리시키는 기능을 지니고, 후자는 원심적이며

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

ePapyrus PDF Document

ePapyrus PDF Document 육아지원연구 2008. 제 3권 1 호, 147-170 어린이집에서의 낮잠에 대한 교사와 부모의 인식 및 실제 이 슬 기(동작구 보육정보센터)* 1) 요 약 본 연구의 목적은 어린이집에서의 일과 중 낮잠 시간에 대한 교사와 부모의 인식 및 실제를 알아봄 으로써, 교사와 부모의 협력을 통해 바람직한 낮잠 시간을 모색해 보는 데 있었다. 연구 대상은 서울, 경기지역

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( ) . 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).

More information

07-1960(JH)

07-1960(JH) 한국두피모발미용학회지 제5권 제1호 2009 The Journal of Beauty & Trichology 5(1), 00~00(2008) 1960년대 뷰티 및 패션트렌드 분석 - 모델 트위기 (Twiggy) 를 중심으로 - 김희선* 안양과학대학 뷰티디자인학부 Analysis of Beauty and Fashion trends in the 1960 s - Focusing

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

도비라

도비라 광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신

More information

02¿ÀÇö¹Ì(5~493s

02¿ÀÇö¹Ì(5~493s Korean Journal of Remote Sensing, Vol.22, No.6, 2006, pp.485~493 Estimation of Quantitative Precipitation Rate Using an Optimal Weighting Method with RADAR Estimated Rainrate and AWS Rainrate Hyun-Mi Oh,

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: * Review of Research

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   * Review of Research Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.79-102 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.79 * Review of Research Trends on Curriculum for Students with Severe and multiple

More information

<303720C7CFC1A4BCF86F6B2E687770>

<303720C7CFC1A4BCF86F6B2E687770> 1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI:   * A Study on Teache Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

-07-......

-07-...... A Depth Interview on Qualification, Role, and Professionalism of Infant/Toddler Teachers Department of Child & Family Studies, Kyung Hee University Associate Professor : Ahn, Sun Hee Department of Early

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

(....).hwp

(....).hwp sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial

More information

44-4대지.07이영희532~

44-4대지.07이영희532~ A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006; ,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).

More information

Study on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport

More information

12È«±â¼±¿Ü339~370

12È«±â¼±¿Ü339~370 http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,

More information

大学4年生の正社員内定要因に関する実証分析

大学4年生の正社員内定要因に関する実証分析 190 2016 JEL Classification Number J24, I21, J20 Key Words JILPT 2011 1 190 Empirical Evidence on the Determinants of Success in Full-Time Job-Search for Japanese University Students By Hiroko ARAKI and

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI:   * The Grounds and Cons Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information

09김정식.PDF

09김정식.PDF 00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>

More information