< C3D6B9CCBFB52DBAB8C5F8B8AEB4AE20BDC5B0E6B5B6BCD22041B8A62E687770>
|
|
- 예준 호
- 5 years ago
- Views:
Transcription
1 Journal of the Korea Academia-Industrial cooperation Society Vol. 18, No. 1 pp , ISSN / eissn 박홍규 1, 최미영 2* 1 ( 주 ) 에이티지씨 R&D 본부연구개발전략팀, 2 선문대학교 BT 융합제약공학과 Production and Characterization of a Recombinant Antibody Neutralizing Botulinum Neurotoxin A Hong-Gyu Park 1, Mieyoung Choi 2* 1 R&D Department, ATGC Co., LTD. 2 Department of BT-Convergent Pharmaceutical Engineering, Sun Moon University 요약보툴리눔신경독소는콜린성신경말단 ( 부 ) 을선택적으로공격하여신경마비를일으키는신경독소로서, 그람양성을띠고내성포자를형성하는절대혐기성세균인보툴리눔균 (Clostridium botulinum) 이만들어낸다. 이중보툴리눔 A형독소 (BoNT/A) 는음식물과물을오염시킬수있으며생물무기나생물협박물질로사용될수도있다. 이때문에독성을탐지할수있는예민한분석방법과중독을치료할수있는효능있는항독소를개발해낼필요성이제기되어왔다. 본연구에서는 BoNT/A를중화할수있는단일클론항체 (mab) 를생산하기위하여 BoNT/A로면역된토끼의항혈청에서유래한 scfv 라이브러리를인간 IgG와융합시켰다. 그렇게재조합된 scfvigg 항체단백질을안정된세포주에서발현시켰고항체친화크로마토그래피를사용하여 scfvigg mab 단백질을정제하였다. ELISA로정제된 scfvigg mab 단백질의효율성을확인하였고, in vivo 실험으로 BoNT/A에대한중화능을시험하였다. 독성중화능실험은마우스를사용하여수행하였는데, 그결과 scfvigg 항체 (10 ug) 는 BoNT/A(100,000 LD 50) 의독성이주입된마우스를완전히방어하지는못하지만마우스의생존기간을현격하게연장시키는것이확인되었다. 이러한결과들은이 scfvigg mab가 BoNT/A를중화하는효능을가지고있다는점을제시한다. Abstract Botulinum neurotoxin (BoNT/A) is a neurotoxin that selectively attacks the peripheral cholinergic nerve endings. It is produced by Gram -positive, endospore-forming strict anaerobic bacteria, Clostridium botulinum. Since BoNT/A could be a biothreat agent, as well as a contaminator of food and water supplies, the development of sensitive assays for toxin detection and potent antitoxin for the treatment of intoxication is necessary. In this study, for the purpose of producing monoclonal antibodies (mabs) that are capable of neutralizing Botulinum neurotoxin type A (BoNT/A), scfv (single-chain variable domain fragment) libraries from the rabbit antisera against BoNT/A was fused to a human IgG. The resulting recombinant scfvigg antibody protein was expressed in stable cell lines and was purified using a protein A affinity chromatography. The efficacy of scfvigg mab was confirmed by ELISA and was evaluated for the neutralization of BoNT/A in vivo. Such an in vivo toxin neutralization assay was performed using mice. Although scfvigg antibody proteins (10 ug) failed to fully protect the mice challenged with BoNT/A (100,000 LD50), it significantly prolonged the survival time. These results suggest that scfvigg mab may be capable of neutralizing BoNT/A single-chain variable domain fragment. Keywords : Botulinum neurotoxin type A(BoNT/A), ELISA(enzyme-linked immunosorbent assay), in vivo toxin neutralization assay, monoclonal antibody(mab), scfv(single-chain variable domain fragment) * Corresponding Author : Mieyoung Choi(Sun Moon Univ.) Tel: choimy@sunmoon.ac.kr Received November 15, 2016 Accepted January 6, 2017 Revised December 1, 2016 Published January 31,
2 한국산학기술학회논문지제 18 권제 1 호, 서론보툴리눔신경독소는신경마비를일으키는독소로절대혐기성세균인보툴리눔균 (Clostridium botulinum) 으로부터만들어지는데, 생산된독소의항원성에따라 7가지 (A형 ~G형 ) 유형으로구분된다. 그중에서독소 A형이인체에가장치명적인것으로알려져있다 [1]. 보툴리눔신경독소 A형은먼저하나의폴리펩티드 (150 kda, 비활성상태 ) 로합성된후에트립신과유사한단백질분해효소 (trypsine-like protease) 에의해잘리고활성화형태로되는데, 이것은 C 말단의중쇄 (heavy(h) chain: 100 kda) 와 N 말단의경쇄 (light(l) chain: 50 kda) 의두조각이이화황결합 (disulfide bond) 으로연결된구조이다 [2]. 체내에유입된보툴리눔독소는혈관순환계를따라표적부위인신경- 근접합부의전신경말단 (presynaptic nerve ending) 으로이동하여신경말단의세포질로유입된다. 이곳에서신경전달물질인아세틸콜린의분비를억제하여근육운동을조절하는신경신호전달을차단함으로써근수축이일어나지않고이완된상태가유지되는이완성근육마비를일으킨다 [3]. 보툴리눔균이사람몸에들어가다량으로증식하면강한신경독소단백질이생성되어신경마비등보툴리눔중독증 (botulism, 보툴리즘 ) 을일으킨다. 보툴리즘은독소성분에노출되는경로에따라식품유래보툴리즘, 유아보툴리즘, 상처보툴리즘, 흡인형보툴리즘으로구분된다 [4]. 보툴리눔독소는자연계에서생산되는독소중인체에가장치명적인것중하나로알려져있고 [5], 평상시에도환자가발병할수있을뿐아니라생물테러무기로사용될수도있다 [6,7]. 지금까지보툴리눔독소의화학적길항제 (chemical antagonist) 는없는것으로알려져있으며동물 ( 주로말 ) 에서유래한항-독소혈청을환자에게투여하는방법이유일한치료법으로알려져있다 [8]. 유사시에있을생물테러나식중독혹은자연발생보툴리즘등잠재적위험요소에대비하기위하여항독소와독소치료제및독성을탐지할수있는분석방법을개발해내는것에대한필요성이제기되어왔고국내외에서연구가진행되고있다 [9,10]. 본연구의목적은보툴리눔 A형독소 (BoNT/A) 를중화하는재조합항체를개발해내고그특성을분석하는데있다. 이를위하여먼저항원에대한결합력을높이는방법으로알려진 scfv 유전자 [11] 를 BoNT/A로면역된토 끼의항체로합성하였다. 다음, 사람에게적용할수있는중화항체로개발하기위해 scfv를인간 IgG와융합시킨 scfvigg를재조합한후, scfvigg 항체단백질을정제하였다. 이정제된단백질의특성분석은 ELISA와 Western blotting을통해수행하였으며, 그리고 BoNT/A 에대한중화능은 in vivo 실험으로확인하였다. 2. 재료및방법 2.1 scfvigg 항체유전자의재조합이실험에서사용한토끼는뉴질랜드산흰토끼로약 3 Kg, 15주령의암컷을구입하였고 (Samtako, Korea), BoNT/A는 Miprolab (Germany) 사에서구입하여사용하였다. 보툴리눔독소를토끼에주사하기직전에먼저면역전혈청을모았다. 2 마리의토끼에 500 μl의불완전프로인트항원보강제 (Freund's Incomplete Adjuvant) (Difco, USA) 와 500 μl의 BoNT/A를혼합한후각각의토끼에주사하였다. 첫면역 1주후, 동일한혼합액으로토끼에다시한번더주사하였다. 첫면역 8주후, 토끼를희생시키고즉시혈액을모아토탈 RNA(total RNA) 를추출하였다. 랜덤헥사머 (random hexamers) 와역전사효소 (superscript reverse transcriptase) (Promega, USA) 를사용하여토탈 RNA로부터 cdna library를합성하였다. 이 cdna로부터프라이머 3부터 6 (Table 1) 을이용하여항체단백질의무거운사슬의가변부위 (V H, variable region of heavy chain) 유전자와항체단백질의가벼운사슬의가변부위 (V L, variable region of light chain) 유전자를 PCR (polymerase chain reaction, 중합효소연쇄반응 ) 로증폭하여얻었다. 확보한 V H 유전자와 V L 유전자를 V H-LINKER(Gly 4Ser 1) 3 -V L 의단일유전자, 즉 scfv(single-chain variable domain fragment, 단일사슬로이뤄진가변부위 ) 유전자로만들기위하여 V H 유전자와 V L 유전자및 pcantab5e phagemid kit (Amersham Pharmacia, UK) 의연결 DNA (Linker DNA) 를주형으로사용하고, 프라이머 1에서 6 (Table 1) 을이용하여 PCR을실시하였다. 합성된 scfv 유전자를포함하는 DNA 조각을제한효소 SfiI/NotI으로절단한후 pcantab5e 벡터에클로닝하여 pcantab5e -scfv를재조합하였다. pcantab5e-scfv와 EcoRI과 PstI이각각포함된 296
3 프라이머 7 과 8 (Table 1) 을사용하여 PCR 을실시하여 scfv이포함된 DNA 조각을증폭한후 EcoRI/PstI으로절단하였다. 이 DNA 조각을인간 IgG의 Fc(constant region, 불변부위 ) cdna가재조합된 pcr3 벡터, 즉 pcr3-igg 에클로닝하였다. 후보플라스미드 DNA 를 EcoRI/Xba I 으로절단하여삽입 DNA(insert DNA) 의크기를확인하였다. 재조합된 DNA의염기서열분석을마크로젠 (Korea) 에의뢰하였다. 플라스미드 pcr3-igg 는인간 IgG의 Fc의 cdna를포유동물세포발현벡터인플라스미드 pcr3 (Invitrogen, USA) 에클로닝한것이다 (Park, unpublished). Table 1. Sequence of primers 1 Linker forward 5 GGCACCCTGGTCACTGTCTCTTCA 3 2 Linker reverse 5 TGGAGTCTGGGTCATCACGACATCCGAT CCGC 3 3 VH forward 5 ATGGAGACTGGGCTGCGCTGGCTTCTC 3 4 VH reverse 5 TGAAGAGACAGTGACCAGGGTGCC 3 5 VL forward 5 GCGGATCGGATGTCGTGATGACCCAGAC TCCA 3 6 VL reverse 5 ACCACCTCGGWYCCTCCGCCGAAA 3 7 scfv forward 5 CCGGAATTCATGGAGACTGGGCTGCGCT GG 3 8 scfv reverse 5 AAAACTGCAGGTTTACCTTTGACCACCAC CTCGG scfvigg mab 단백질의발현및정제 재조합된 scfvigg 단백질의발현을확인하고이단백질의중화능을분석하기위하여항체친화크로마토그래피를이용하여 scfvigg 단백질을정제하였는데, 그과정은다음과같다. 먼저, 재조합된 pcr3-scfvigg 플라스미드 DNA를리포펙타민 (Lipofectamine) (Invitrogen, USA) 을사용하여 CHO-DUKX (ATCC, USA) 세포에주입하였다. G418 (Cambrex, USA) 를처리하여얻은 colony 들을 96-well 플레이트 (Falcon 3912) 의웰당 1 개의세포씩배양하여선별하였고, methotrexate (Sigma, USA) 를처리하여안정된단일세포주 (stable cell line) 를확보하였다. 이 CHO-DUKX 세포는 150 mm 접시 (dish) 에서배양하였다. 그다음으로, 세포배양액을모아서 scfvigg 유전자가클로닝된 CHO-DUKX 세포로부터분비된 scfvigg 단백질을 HiTrap protein A (Amersham Pharmacia, UK) 를사용하여정제하였다. 이때 FPLC(Fast Protein Liquid Chromatography) (Amersham Pharmacia, UK) 를이용하였고, 정제된분획 (fraction) 을모두모아 Amicon Ultra 30 kda 제한필터 (cut-off filter) (Millipore, USA) 를사용하여단백질용액을농축하였다. 농축된단백질은 PBS(137mM NaCl, 10mM Na 2HPO 4, 2.7mM KCl, 1.8mM KH 2PO 4 (phis7.4)) 로투석한후에 in vivo 실험에사용하였다. ELISA로항체의농도를측정하였다. 2.3 ELISA(enzyme-linked immunosorbent assay, 효소면역분석법 ) scfvigg mab 단백질의 BoNT/A에대한결합친화력 (binding affinity) 을조사하고가장높은결합력을나타내는 scfvigg mab를생산하는단일세포를선별하기위하여발현된 scfvigg가포함된배양액을사용하여 ELISA를수행하였는데, 그과정은아래와같다. BoNT/A (Miprolab, Germany) 를 96-well 플레이트의웰당 1 μg/ml이포함되도록희석용액 (dilution buffer) (2.5 % FBS, 0.5 % Tween 20, 1 X PBS) 에희석하여 100 μl 씩넣고 4 C에서 16시간동안반응하여코팅하였다. 그다음에는차단용액 (blocking buffer) (1 % FBS, 5 % sucrose, 0.05 % sodium azide) 을첨가하여실온에서 1시간 30분동안반응하여차단하였다. scfvigg mab를포함하고있는세포배양액을 100μl 씩따서웰에첨가하고실온에서 1시간 30분동안반응하였다. scfvigg의결합여부는퍼록시데이즈가결합된 ( 인간 IgG 단백질에대항하는 ) 염소의항체 (peroxidase conjugated goat anti-human IgG) (KPL, USA) 로반응하여조사하였다. TMB (3,3,5,5 - Tetra methyl benzidine) microwell peroxidase substrate system (KPL, USA) 을이용하여색반응분석실험을수행하였고, Microplate Reader (BIO-RAD) 를사용하여 655 nm 파장에서흡광도 (Optical Density, O.D) 를측정하였다. 2.4 Western blotting( 웨스턴블랏 ) 정제된단백질을 10 % SDS-polyacrylamide gel에서전기영동하여단백질의크기를조사하였다. 전기영동하여분리된단백질을멤브레인 (polyvinylidene fluoride transfer membrane) (Pall. Corporation, USA) 으로전기영동하여옮겼다. 멤브레인을 5 % 탈지유가포함된 PBS 297
4 한국산학기술학회논문지제 18 권제 1 호, 2017 에담구고 4 C에서 16시간반응하여 ( 비특이적인결합을 ) 차단하였다. 멤브레인을 PBST(137mM NaCl, 10mM Na 2HPO 4, 2.7mM KCl, 1.8mM KH 2PO 4, 0.1% Tween 20) 로씻어낸후, peroxidase conjugated goat anti-human IgG(KPL, USA) 를 1:10,000으로희석하여첨가하고실온에서 1시간동안반응하였다. 결합되지않은항체는 PBST로씻어서제거하였고, 결합된항체는 DAB peroxidase development kit (Vector Lab, Inc., USA) 를이용하여시각화하였다. 2.5 in vivo 독성중화분석실험 BoNT/A에대한 scfvigg mab의중화능력을조사하기위하여 in vivo 실험을수행하였다. 이실험에는 6 주령에서 8 주령의암컷 Balb/C와 ICR 마우스 ( 오리엔트바이오, Korea) 를사용하였다. 먼저 BoNT/A (Miprolab, Germany) 에의해모두죽는범위를설정하기위하여 BoNT/A를단계별로희석한후 ICR 마우스에주입하여사망유무를조사하였다. BoNT/A의생물활성도는 1.0x10 5 LD 50(50% lethal dose) 으로확인하였다. 그룹당 5 마리씩의 ICR 마우스를사용하여총 4개의그룹 (PBS only, BoNT/A, BoNT/A+scFvIgG (CH#1-1), BoNT/A+scFvIgG (CH#1-2)) 을실험하였다. BoNT/A 독소 (1.0x10 5 LD 50) 와 10 μg의 scfvigg 단백질을넣고전체용량이 0.5 ml이되도록 PBS와혼합하여사용하였다. 혼합액을마우스의복강에주입한후, 죽거나생존한마우스의개체수및생존시간을조사하였다. 서보여주고있다. 아가로즈젤전기영동으로 410 bp 의 V H 유전자와 340 bp의 V L 유전자를포함하는 DNA를얻었는데, 예상과그크기가일치하였다.( 그림 1. lane 1, 2). 항원에대한친화력이높은 mab 단백질을제조하기위한수단으로 scfv를사용하는방법이널리응용되고있다 [11]. 본연구에서는 BoNT/A에대한친화력이높은항체단백질을만들기위하여 V H 유전자와 V L 유전자사이에 LINKER(Gly 4Ser 1) 3 DNA를포함하는, V H-LINKER(Gly 4Ser 1) 3-V L 로된 scfv 유전자를 PCR로증폭하였다. 그결과약 800 bp의단일조각의 DNA 밴드를얻었는데, 이것은 scfv의예상크기와일치하였다 ( 그림 1. lane 3). 이 DNA 조각을 pcantab5e phagemid vector에클로닝함으로써 scfv DNA library 를구축하였다. Fig. 1. PCR products of V H,V L,andscFv lane 1:V L, lane 2:V H, lane 3:scFv, M:DNA size standard 1kb ladder 3. 결론 3.1 scfvigg 항체단백질유전자의재조합본연구에서는보툴리눔 A형독소 (BoNT/A) 에높은친화력을가지며또한감염된환자에게중화능을갖는효율적인중화항체를만들기위하여토끼에서유래한 scfv와인간 IgG가연결된융합단백질을제조하고자하였다. 이를위하여, 먼저 BoNT/A로두번주사한토끼에서혈액을얻어토탈 RNA를추출하였다. 이 RNA로 RT-PCR을수행하여항토끼항체단백질의 V H 와 V L 에대한 cdna library를확보하였다. 이실험에는프라이머 3에서 6 (Table 1) 을사용하였고 V H 유전자와 V L 유전자를포함하는 DNA 조각을증폭한결과는그림 1에 (a) (b) Fig. 2. Confirmation of recombinant plasmid pcr3-scfvigg(#1) by EcoRI/XbaI digestion (a) Diagram of the pcr3 expression vector containing the scfv(vh, linker, VL) and human IgG cdna. (b) Agarose gel electrophoresis of pcr3-scfvigg(#1) M : DNA size standard 1kb ladder, Lane 1 : uncut DNA, Lane 2 : The insert DNA (scfvigg gene, 1560 bp) was obtained after cleavage with EcoRI and XbaI. 298
5 그다음으로, 사람에게적용할수있는중화항체로제조하기위하여 scfv 단백질을인간 IgG와융합된단백질로발현시키고자하였다. 이를위해 scfv 유전자를인간 IgG (Fc) cdna를포함하는발현벡터인 pcr3-igg 에넣어 pcr3-scfvigg를재조합하였다 ( 그림. 2. (a)). 재조합된 scfvigg DNA를분석하기위하여플라스미드 DNA를추출하였고, EcoRI과 XbaI으로절단하여약 1,560 bp의 DNA 밴드를확인하였다 ( 그림. 2. (b) lane 1, 2). 이결과는삽입된 scfvigg DNA의예상크기와일치하는것이다. 총 18개의플라스미드 DNA의염기서열분석을의뢰하였다 ( 마크로젠, Korea). 그중 15개의플라스미드 DNA에는기존에밝혀진염기서열 (Synthetic construct single chain Fv antibody fragment, AY307933, gi: ) 과동일한 scfv DNA가들어있다는것을알수있었다. 나머지 3개의플라스미드 DNA는모두 V H 유전자와 V L 유전자가아직까지밝혀지지않은새로운염기서열을포함하고있다는것을알수있었다. 그림 2에서는그중하나인플라스미드 #1의결과를보여주고있다. 3.2 scfvigg mab 단백질의정제및분석재조합된 scfvigg mab 단백질을발현하는안정된세포주를구축하고 BoNT/A에결합력이뛰어난단백질을얻기위하여, 먼저플라스미드 pcr3-scfvigg를 CHO-DUKX 세포에주입하여안정된단일세포주인 CH#1을확보하였다. 이 CH#1 세포를단일클론 (monoclonal) 으로제작하기위하여 G418을처리하여생긴콜로니 (colony) 를 96-well 플레이트에웰당세포하나씩옮겨서배양하였고 ELISA를실시하여 BoNT/A 에결합능력이높은단백질을생산해내는세포주를선별하였다. 그결과 BoNT/A에결합력이가장뛰어난 scfvigg mab 단백질을분비하는세포주는 CH#1-1과 CH#1-2이었다. 이세포들을배양하여배양액을모은다음, 세포배양액으로분비된 scfvigg 단백질을 protein A 친화크로마토그래피를이용하여정제하였다. 정제된 scfvigg 단백질로 SDS-PAGE를실시하여 55 kda의단일밴드를관찰하였고, peroxidase conjugated goat anti-human IgG antibody를사용하여 Western blotting 을실시한결과, 단일밴드를확인할수있었다 ( 그림 3.). 정제된 scfvigg 단백질의항체특이성을 ELISA로분석하였는데, scfvigg mab는높은농도에서는농도의존 적으로 (BoNT/A 와 ) 반응하는것을보였다. 이것은 BoNT/A의 polyclonal antibody (NIBSC, UK) 와유사하게반응한다는것을알수있었다 ( 그림 4.). 이와는대조적으로, negative control로사용된 IgG는 BoNT/A에반응하지않았다. 이결과는 scfvigg mab(#1-1, #1-2) 에는 BoNT/A와특이적으로결합하는활성이있다는것을제시한다. Fig. 3. Western blotting analysis The scfvigg protein was purified using protein A affinity chromatography. Proteins were separated on a 10% SDS-PAGE gel and were analyzed by Western blotting with peroxidase conjugated goat anti-human IgG antibody. Fig. 4. ELISA(enzyme-linked immunosorbent assay) 96-well plates were coated with BoNT/A. scfvigg was added and incubated. The binding of scfvigg was detected via peroxidase conjugated goat anti-human IgG. 3.3 scfvigg mab의 BoNT/A 에대한독성중화능분석 BoNT/A에대한 scfvigg mab의중화능을시험하기위하여 ICR 마우스를이용하여 in vivo에서독소중화분석실험을수행하였다. BoNT/A의생물활성도는 299
6 한국산학기술학회논문지제 18 권제 1 호, x10 5 LD 50 이었는데, 이 BoNT/A와 10μg의 ScFvIgG mab(#1-1, #1-2) 를혼합한후, ICR 마우스의복강에주입하였고마우스의증상발현및생존여부를최소 48시간동안관찰하였다 ( 그림 5). 수행한결과 10μg의 scfvigg 항체는 BoNT/A(100,000 LD 50) 의독성이주입된마우스를완전히방어하지는못했으나마우스의생존기간을현저히연장시킨다는것을알수있었다. 이결과들은 scfvigg mab는 BoNT/A를중화하는효능을가지고있음을제시하며, 보툴리즘을치료할수있는생물치료제로개발될수있는잠재력도가지고있음을보여준다. 그것은또한보툴리눔독성의감염여부를판단하는데활용될수있으며보툴리눔독소를정제하는데에도활용될수있을것으로사료된다. References Fig. 5. In vivo toxin neutralization assay The mixture of ten microgram of scfvigg Ab and BoNT/A was injected intraperitoneally in mice. The time to death and the survival number of mice were determined. 그결과, PBS를주입한군은모두생존하였고, BoNT/A를주입한군은 15시간이내에모두사망하였으며, BoNT/A+ScFvIgG (#1-1) 를주입한군의경우 36시간이내에모두사망하였다. 이와반면에 BoNT/A+ ScFvIgG (#1-2) 를주입한군의경우 36시간이내에 2마리만사망하였고, 3마리는 40 48시간까지생존하였다. 이결과들은 scfvigg mab(#1-1, #1-2) 에는 BoNT/A에대한중화능이있다는것을제시한다. 그렇지만, 10μg의 scfvigg mab로는 BoNT/A(100,000 LD 50) 를중화하는능력을오랜동안유지하지못하여완전한방어를할수가없었고, 그로인해 48시간안에모두사망하였다고생각된다. 이는 scfvigg mab가높은농도의 BoNT/A에대해친화력이충분히높지못하여 BoNT/A를오랜시간동안중화하지못했거나, 또는 BoNT/A(100,000 LD 50) 를완전하게중화하기위해서는더높은농도의 scfvigg mab가필요하다는것을의미하는것으로사료된다. 본연구에서얻은재조합항체, scfvigg mab의특성을 ELISA와 Western blot으로분석한결과, scfvigg mab는농도의존적으로 BoNT/A와반응하는것을알수있었고, BoNT/A와특이적으로결합한다는것을확인하였다. 마우스를이용한 in vivo 독성중화능실험을 [1] J. Thanongsaksrikul and W. Chaicumpa, Botulinum Neurotoxins and Botulism: A Novel Therapeutic Approach, Toxins, 3, pp , DOI: [2] D. B. Lacy, W. Tepp, A. C. Cohen, B. R. Das Gupta, R. C. Stevens, Crystal structure of botulinum neurotoxin type A and implications for toxicity, Nat. Struct. Biol. 10, pp , DOI: [3] C. Montecucco, G. Schiavo, Mechanism of action of tetanus and botulinum neurotoxins, Mol Microbiol, 13, pp. 1-8, DOI: [4] C. O. Tacket and M. A. Rogawski, Botulinum Neurotoxin and Tetanus Toxin, In: Simpson, L.L., (Ed.), p , Academic Press, [5] L. L. Simpson, The study of clostridial and related toxins. The search for unique mechanisms and common denominators, J. Physiol. 84, pp , [6] R. K. Dhaked, M. K. Singh, P. Singh, P. Gupta, Botulinum toxin: bioweapon and magic drug, Indian J Med Res., 132, pp , [7] S. S. Arnon, R. Schechter, T. V. Inglesby, D. A. Henderson, J. G. Bartlett, M. S. Ascher, E. Eitzen, A. D. Fine, J. Hauser, M. Layton, S. Lillibridge, M. T. Osterholm, T. O Toole, G. Parker, T. M. Perl, P. K. Russell, D. L. Swerdlow, K. Tonat. Botulinum toxin as a biological weapon: medical and public health management, J. Am. Med. Assoc. 285, pp DOI: [8] C.O. Tacket, W. X. Shandera, J. M. Mann, N. T. Hargrett, and P. A. Blake, Equine antitoxin use and other factors that predict outcome in type A foodborne botulism, Am. J. Med., 76, pp , DOI: [9] H. Bigalke, Botulinum toxin: application, safety, and limitations, Curr Top Microbiol Immunol, 364, pp DOI: [10] J. W. Froude, B. Stiles, T. Pelat, P. Thullier, Antibodies 300
7 for biodefense, MAbs., 3, pp DOI: [11] A. Nowakowski, C. Wang, D. B. Powers, P. Amersdorfer, T. J. Smith, V. A. Montgomery, R. Sheridan, R. Blake, L. A. Smith, J. D. Marks, Potent neutralization of botulinum neurotoxin by recombinant oligoclonal antibody, Proc. Natl. Acad. Sci. 99, pp DOI: 박홍규 (Hong-Gyu Park) [ 정회원 ] 2001 년 2 월 : 선문대학교미생물학과 ( 이학사 ) 2003 년 2 월 : 선문대학교대학원분자생물학전공 ( 이학석사 ) 2010 년 2 월 : 한양대학교의과대학대학원의생명공학과 ( 이학박사 ) 2010 년 3 월 ~ 2010 년 12 월 : 연세대학교치과대학 post-doc 년 12 월 ~ 현재 : 에이티지씨 R&D 본부연구개발전략팀 Senior manager < 관심분야 > 의약품 / 화장품, 제약 최미영 (Mieyoung Choi) [ 정회원 ] 1983 년 2 월 : 서울대학교사범대학생물교육과 ( 이학사 ) 1985 년 2 월 : 서울대학교자연과학대학대학원동물학과 ( 이학석사 : 분자유전학 ) 1992 년 12 월 : University of Chicago 대학원발생생물학과 ( 이학박사 : 분자생물학 ) 1993 년 1 월 ~ 1995 년 12 월 : University of Pennsylvania, HHMI, Research Associate ( 분자세포생물학 ) 1997 년 3 월 ~ 현재 : 선문대학교 BT 융합제약공학과교수 < 관심분야 > RNA- 결합단백질의유전자발현에서의기능, 의약품 301
항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationMicrosoft Word - 3-오희복.doc
Journal of Bacteriology and Virology 2008. Vol. 38, No. 3 p.119 125 Development of Capture ELISA Using a Biotinylated Monoclonal Antibody for Detection of Botulinum Neurotoxin Type A Yun Jeong Kim, Na-Ri
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More informationMicrosoft PowerPoint - Chapter 3-2
Chapter 3 단백질의탐구및단백체학 (3) 겔거르기 (Gel filtration) chromatography: 크기에의한분리 - Resin: 다공성구슬 = Sephadex, Sepharose, Biogel = Bead size: 100 mm - 원리 : 분배 (partition) chromatograph = 분배 : 용질이이동상 (mobile phase)
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationGlutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15
체외진단용의료기기 ( 인플루엔자바이러스및 A형간염바이러스 ) 의허가 심사가이드라인 2015. 2. 의료기기심사부체외진단기기과 - 1 - 목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 Ⅵ. 기술문서등의심사를위한제출자료 37 Ⅶ. 성능시험에대한상세사항 44 Ⅷ. 참고문헌
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationPowerPoint 프레젠테이션
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More information170 김위식ㆍ김기홍ㆍ김춘섭ㆍ오명주, (LaPatra, 1996; Watanabe et al., 1998; 2000; Kibenge et al., 2002). ELISA, 2 IgM. ELISA IgM (monoclonal antibody, MAb). IgM manna
한수지 50(2), 169-174, 2017 Original Article Korean J Fish Aquat Sci 50(2),169-174,2017 넙치 (Paralichthys olivaceus) 의 immunoglobulin M 에대한단클론항체생산 김위식 김기홍 김춘섭 1 오명주 * 전남대학교수산생명의학과, 1 엔바이로젠 Production of Monoclonal
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information보툴리눔독소의약리 이루어지고 있다 현재 피부과 안과 신경과적 영역에서 널리 사용되고 있으며 이비인후과 영역에서도 사용 범위가 증가하고 있는 추세이다 보툴리눔독소의역사 고대에서부터 특정 음식물의 섭취를 금기시하거나 이를 금지시킨 법률이 존재하며 이를 통하여 음식의 섭취와
online ML Comm 대한후두음성언어의학회지제 23 권제 2 호 2012 종설 보툴리눔독소의약리 성균관대학교의과대학강북삼성병원이비인후과학교실 이상혁 이현섭 진성민 = Abstract = The Pharmacology of Botulinum Toxin Sang Hyuk Lee, MD, Hyun Sub Lee, MD and Sung Min Jin, MD Department
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More informationPierce-Plus-Alpha.pdf
Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information02양은용
The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),
More informationlastreprt(....).hwp
pheophytin Jukart.. 서론 재료및방법 . 650 nm (10). 3. 124 15 3 68 2 3 124 2, 3, 43 5, 5 23 (5). 4. 5 4 5 53. 650 nm (10),..,. 16 pheophytin Jukart.. IC 50 1mg/ml.. pheophytin Jukart.. IC 50 1mg/ml.
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * The Mediating Eff
Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.159-177 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.159 * The Mediating Effects of Self-esteem on the Relationship between Social
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 276), 504511. http://dx.doi.org/10.5515/kjkiees.2016.27.6.504 ISSN 1226-3133 Print)ISSN 2288-226X Online) Near-Field
More informationJournal of the Korean Society of Mechanical Engineers 기 계 저 널 2012 8 43 43 ISSN 1226-7287 Vol. 52, No. 8 August CONTENTS 04 이 달의 화보 05 11 인터뷰 14 16 18
기 계 저 널 Vol. 52, No. 8 August 2012 8 8 테마기획 : BioMEMS 연구 동향 커버스토리-테마기획 BioMEMS 연구 동향 인터뷰 한국원자력안전기술원 박윤원 원장 동아리 탐방 포항공과대학교 로봇동아리, 파워온(POWER-ON) 특별회원사 소개 (주)에이치케이밸브 전문가 연재 한국기계공업사 Journal of the Korean Society
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-
Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information00....
Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information-09-......
The Values, Consumption Culture, and Clothing Attitudes of a Modern New Generation as the Primary Consumer of Modern Korean Culture: From the 1920 s to the 1930 s Department of Fashion Design, Osan College
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information1020041200.hwp
20 2004-7-1 21 22 2004-7-1 23 B M B P C B C C C C C Co M B P M B P B FC P B: C: M: P: C C FC C M FC : Co : :, 2004. 24 2004-7-1 25 1999 2000 2001 2002 26 2004-7-1 27 28 2004-7-1 29 30 2004-7-1 31 32 2004-7-1
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More informationWestern Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch
2018 년 4 월 16 일 ~ 6 월 15 일까지 2018 비엠에스할 인 행 사 AbD Serotec 이 Bio-Rad 와하나가되었습니다. 10,000 여종의 Primary Antibody 를검색해보세요! Western Blot 장비 & 시약 5+2 증정 Western Blot Consumable Best Seller - Protein Standards -
More informationChapter 4. Bacteria (the first microbes)
- DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information(지도6)_(5단원 156~185)
1 _ 2_ 3_ 4_ 01 158 159 참고 자료 160 161 162 163 02 164 165 참고 자료 166 167 168 169 활 동 지 03 170 171 172 173 활동의 결과이다. 신경 세포와 신경 세포 간에 화학 물질을 방출하여 전기 신호를 전달해 주는 시냅스 활동은 우리 뇌가 새로운 경험을 할 때마다 변한다. 기분 나쁜 경험을 하면
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
More informationDisclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,.
PanGen Biotech Inc. INVESTOR RELATIONS 2015 Disclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,. Pangen BIOTECH INVESTOR RELATIONS 2015 Prologue Chapter 01. Chapter 02., Chapter 03.,
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information25(6)-21(김유곤).fm
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 25, No. 6, 483-491, 2012 http://dx.doi.org/10.5806/ast.2012.25.6.483 Study on stability test of in process sample of recombinant Protein
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationPowerPoint 프레젠테이션
IDA Excellose handbook - Purification of polyhistidine tagged proteins - Looking for more detail Purification protocol? - Chelating Excellose Spin Kit - IDA MiniExcellose - IDA Excellose www.takara.co.kr
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information슬라이드 1
유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information