Original Article J Sasang Constitut Med 2017;29(4): 천연물유래산조인복합오일 (Zizyphus jujuba var. spinosa Compo
|
|
- 서 남궁
- 5 years ago
- Views:
Transcription
1 Original Article J Sasang Constitut Med 2017;29(4): 천연물유래산조인복합오일 (Zizyphus jujuba var. spinosa Composite oil, ZjJ-C_oil) 및독활복합오일 (Aralia cordata var. continentalis Composite oil, ARC-C_oil) 의 DNCB 로유도된 NC/Nga 생쥐의아토피에미치는효과연구 곽진영 1 최희정 2 박정미 3 박정환 1 고영미 1 장태수 4* 안택원 1* 1 대전대학교한의과대학사상체질의학과, 2 차의과대학교통합의학대학원, 3 대전대전대학교천안한방병원웰니스스파임상센터, 4 서울대학교그린바이오과학기술연구원 Abstract Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice Jin-young Kwak 1 Hee-Jeong Choir 2 Jung-mi Park 3 Jung-hwan Park 1 Young-mee Kho 1 Tae-soo Jang 4* Teakwon-Ahn 1* 1 Dept. of Sasang Constitutional Medicine, College of Korean Medicine, Daejeon Univ, 2 Graduate School of Intergrated Medicine, Cha Universityr, 3 Cheonan oriental hospital of Daejeon Univ. Wellness spa Clinical Cente, 4 Institutes of Green Bio Science Technology, Seoul National University The aim of this study is to investigate the effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) to NC/Nga mice induced in Atopic dermatitis-like skin lesions by DNCB. NC/Nga mice which have been induced to Atopic dermatitis-like skin lesions by DNCB are divided into 4 groups, the first is the mice which have been spread with izyphus jujuba var. spinosa Composite oil(zjj-c_oil), the second is the mice which have been spread with Aralia cordata var. continentalis Composite oil(arc-c_oil), the third is which have been spread with dexamethasone (Dexa.) 0.5% on their Atopic lesion, the last is the control group. Then We analyzed skin clinical score, blood sample of each group of measure state of the dorsal skin, the number of immunocytes, and resect the skin lesion to anlayze the state of cells. There are meaningful results of measuring the number of IgE, IL-4, IL-13, IFN-γ, IL-5, the total cells in ALN, dorsal skin, CD4+ Th, CD11b+/Gr-1+ in PBMCs, CD4+ Th, B220+/CD23+ in ALN, CD4 +, CD8 + Th in dorsal skin, the level of COX-2, TNF-α, TGF-β1, IL-4, IL-13 mrna, the state of the skin lesion and cells in the group with ZjJ-C_oil, ARC-C_oil cream in comprarison with the control group. Key Words : Atopic Dermatitis, NC/Nga Mouse, izyphus jujuba var. spinosa Composite oil(zjj-c_oil), Aralia cordata var. continentalis Composite oil(arc-c_oil). Received December 18, 2017 Revised December 18, 2017 Accepted December 21, 2017 Corresponding author Taek-won Ahn 1 Tae-soo Jang 2 1 Notaesan-ro 4, Seobuk-gu, Cheon-an, Choongchungnamdo, South Korea. Tel : , Fax : , twahn@dju.kr , Pyeongchang-daero, Daehwa-myeon, Pyeongchang-gun, Gangwon-do, South Korea. Tel : , Fax : , jangts@snu.ac.kr C The Society of Sasang Constitutional Medicine. All rights reserved. This is an open acess article distributed under the terms of the Creative Commons attribution Non-commercial License ( creativecommons.org/licenses/by-nc/3.0/)
2 348 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice Ⅰ. 緖論 아토피는 비정상적인반응, 기묘한, 뜻을알수없다 라는그리스어 (atonia-장소가없음 ) 를어원으로하며, 유전학적요소, 환경적요인, 사회경제적인요소, 면역학적요인, 약리생리학적측면등여러인자간의상호작용으로발생되며, 음식물혹은흡입성물질에대한알레르기반응이유전적으로발생하는경우를일컫는용어로아토피피부염, 천식, 알레르기비염, 알레르기결막염등이포함된다 1. 아토피피부염 (atopic dermatitis) 은아토피알레르기를가진사람에서나타나는대표적인피부질환으로최근발병률이증가하고있다. 흔히, 태열이라고불리는만성피부질환으로서피부건조증및가려움증이주증상이다. 전인구의 0.5-1%, 어린이의경우 5-10% 가아토피피부염을앓고있으며증상이나타나는시기는대체로생후 2-6 개월이며특히, 1세미만에서가장많이나타나고 85% 가 5세이전에나타나는것으로보고되었다 2. 아토피피부염은재발이잦고만성적인경과를보이는흔한염증성피부질환으로, 피부소양증에대한역치가낮아심한소양감과이로인한 2차적인습진이형성되며, 홍반, 부종, 인설, 가피, 태선화등이특징적으로나타난다. 아토피피부염의정확한기전은알려져있지않지만, 유전적, 환경적요인과함께면역학적기능이상이복잡하게연관되어발생하는것으로추측되고있다 3. 아토피피부염에서소양증은환자로하여금반복적으로병변을긁게하여 2차적인병변을형성시켜재발과만성의경과를유도한다. 따라서신속하게소양증을경감시키는것이중요한치료목표가되며이를위해다양한치료방법들이시도되고있으나치료에잘반응하지않는경우가많으며 4, 아토피피부염의치료제로흔히사용되는스테로이드외용제는장기간사용했을때피부의위축이나소아환자에서성장지연의가능성등각종부작용이문제되고있어새로운외용제에대한필요성이증가하고있다 5. 이러한문제점을보완하기위한대증요법으로오일의사용이늘 어나고있는추세로, 경험에의존한오일사용보다과학적검증을통하여안전한개인별맞춤오일치료제개발을위한연구의필요성이증가하고있다. 사상체질의학에서는사람을體形氣像, 容貌詞氣, 性質材幹, 病證藥理에따라태양인, 태음인, 소양인, 소음인으로나누어질병을예방하고치료하기때문에체질별맞춤치료가가능하다. 오일은 2-3 가지를혼합하여사용할때치료효과를극대화시키는것으로알려져있어 6 태음인에게효과적인산조인을주성분으로하는복합오일과소양인에게효과적인독활, 박하를혼합한오일을만들어아토피피부염에대한치료효과를확인하였다. 본연구에서는 NC/Nga 생쥐에 DNCB(1-chloro 2,4- dinitrobenzene) 를도포하여아토피피부염을유발시킨후산조인복합오일 (Zizyphus jujuba var. spinosa Composite oil, ZjJ-C_oil, 이하산조인복합오일 ), 독활복합오일 (Aralia cordata var. continentalis Composite oil, ZjJ-C_oil, 이하독활복합오일 ) 의아토피피부염의발진억제에미치는영향을실험적으로규명하고자 NC/Nga 생쥐의 clinical skin score, hematology 및혈청중 Ig E 수준을분석하였고, axillary lymph node(aln), peripheral blood mononuclear cells(pbmcs) 및등피부조직에서 cytokine level, 총세포수, 유세포형광분석및염증유전자발현분석을실시하였고, 등피부조직에서 H&E 염색을통하여 epidermis 의두께와 toluidine blue 염색을통하여비만세포의침윤정도를관찰하였다. Ⅱ. 材料및方法 1. 재료 1) 시험물질 (1) 명칭 : 산조인복합오일 (ZjJ-C_oil), 독활복합오일군 (2) 공급자 : 힐링네이처농업회사법인강원도평창군진부면하송정길
3 JY Kwak et al. 349 Tel Fax (3) 성분 : Table 1과같다. Table 1. The component of Zizyphus jujuba var. spinosa Composite oil,(zjj-c_oil), Aralia cordata var. continentalis Composite oil(arc-c_oil) ARC-C_oil Herb ratio Component 상지 20% 박하 25% 독활 25% 전나무 30% 후박 20% 산조인 30% 전초 30% 곽향 20% ZjJ-C_oil isoquercetin, palmitic acid tannin oxyresveratrol menthol limonene menthone camphene choline continentalic acid stamasterol hederagenin sabinene a-pinene camphene B-pinene Limonene eugenol honokiol magnolol jujuboside spinosin betulin capaene acidamide hydroxy B-sanshool tannin hyperin dipentene estragole δ-guaiene tilianin α, β-pinene methylchavicol pogostol α-bulnesene 2) 양성대조물질 (1) 명칭 : Dexamethasone (2) 구입처 : Sigma Co. (3) 투여방법 : 0.3mg/kg/day 로증류수에녹여경구투여 3) 동물수컷 8주령의 20~22g NC/Nga 생쥐 (SLC, Inc, Japan) 를중앙실험동물에서공급받았다. 동물은실험당일까지고형사료 ( 항생제무첨가, 삼양사료 Co.) 와물을충분히공급하고, 온도 22±2, 습도 55±15 %, 12 시간 light-dark cycle 의환경을유지하며 2주간적응시킨후실험에사용하였다. 그리고동물실험의윤리적, 과학적타당성검토및효율적인관리를위하여대전대학교동물실험윤리위원회 (Institutional Animal Care and Use Committee : IACUC) 의승인을받았다. 4) 시약및기기 (1) 시약본실험에사용된시약은 diethyl pyrocarbonate (DEPC), chloroform, trichloroacetic acid, isopropanol, Tris-HCl, KCl, MgCl2, 적혈구용혈액 (ACK lysis solution), DMEM 배양액, dulbecco's phosphate buffered saline (D-PBS), Sulforhodamin B (SRB), 2-isopropanol, Sodium dodecyl sulfate (SDS), antibiotics은 Sigma 사 (USA) 제품을사용하였으며, 우태아혈청 (fetal bovine serum, FBS) 은 Hyclone 사 (Logan, USA) 제품을, anti-cd4-fitc(fluorescein isothiocyanate), anti-cd11b- FITC, anti-gr-1-pe, anti-cd8-fitc, anti-cd23-fitc, anti-cd69-fitc, 그리고 anti-b220-pe, anti-cd3 mab 등은 Pharmingen사 (Torreyana, USA) 제품을, IL-4, IL-5, IFN-γ, IL-13 ELISA kit 는 BioSource 사 (California, USA) 제품을, IgE ELISA kit는 SHIBAYAGI사 (Shibukawa, Japan) 제품을, 기타일반시약은특급시약을사용하였다.
4 350 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice (2) 기기본실험에사용된기기는 CO2 incubator (Forma scientific Co., USA), clean bench (Vision scientific Co., Korea), autoclave (Sanyo, Japan), micro-pipet (Gilson, France), water bath (Vision scientific Co., Korea), vortex mixer (Vision scientific Co., Korea), spectrophotometer (Shimazue, Japan), centrifuge (Sigma, USA), deep-freezer (Sanyo, Japan), 유세포형광분석기 (BD, USA), thermocycler system (MWG Biotech., Germany), ice-maker (Vision scientific Co., Korea), homogenizer (OMNI, USA), plate shaker (Lab-Line, USA), probe-on plus slide (Fisher Scientific, USA), ELISA reader (Molecular Devices, USA), automatic ELISA washer (Diawasher, ELX50, USA), bright microscope (Nikon, Japan), contrast fluoroseince microscope (Nikon, Japan) 등을사용하였다. 2. 방법 1) 실험군분류및약물처리 NC/Nga 생쥐에아무처리도하지않은정상군 (NC/Nga_Nr, Nr), DNCB 를 2주간도포한대조군 (DNCB_ CTL, CT), DNCB 를 2주간도포후 Dexamethason (3 mg/kg) 투여한양성대조군 (DNCB_Dexamethason, Dex), DNCB 를 2주간도포후산조인복합오일 (ZjJ-C_oil) 로도포한군, DNCB 를 2주간도포후독활복합오일 (ARC-C_oil) 로도포한군으로분류하였다. 양성대조약물 Dexamethason 3 mg/kg 으로 12주령부터 15주령까지 3주간매일경구투여하였으며, 실험군인산조인복합오일군 (ZjJ-C_oil), 독활복합오일군 (ARC-C_oil) 은 12주령부터 15주령까지매일 3주간도포하였다. 2) 피부염유발 8주령의 NC/Nga 생쥐를 2 주일동안적응시킨후 NC/Nga 생쥐의등 ( 귀하단부에서부터꼬리상단부 ) 을제모하고 24시간방치후 1% 의 DNCB (dinitrochlorobenzene) 가들어있는아세톤 : 올리브오일 (3 : 1) 200 μl를제모부위에도포하고, 3일후 2차도포하였다. 1차 도포후 7일째부터는, 1 주일에 3회씩 3주간 0.2 % DNCB 용액 150 μl를재차도포 (10 주령 13주령 ) 하여아토피피부염을유발시켰다. 3) 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 의크림제형제조 산조인복합오일과독활복합오일의크림제형은수상, 유상, 안정제에 2% 복합오일과양성대조군 0.5% dexamethasone의제형을혼합하여제조하였으며구성성분은다음과같다 (Table 2). Table 2. Ointment-cream Formulation Component A B Base 1% ZJ-C oil to 100 1% ARC-C oil to 100 vehicle control glycerin water silicon 유도체 phase Micricide -C EDTA-2Na Keltrol F(1%) Sepiplus Lanette O Olive M Tego care Puresyn oil phase TCG-M DC 200/6cs Lipex Shea Vitamin E D-P BHT stabilizer TEA Di water % ZJ-C oil 1.00 additives 1% ARC-C oil 1.00 vehicle control 4) 피부염유발평가 NC/Nga mouse 의피부염은아토피성피부염에서일반적으로사용되는임상적육안평가법을이용하였다. 육안평가항목은 erythema/hemorrhage ( 소양행동을동반한홍반 ), dryness/scarring ( 인설및가피 ), edema
5 JY Kwak et al. 351 ( 부종 ), excoriation/erosion ( 표피박탈 / 미란 ), lichenification ( 태선화 ) 5가지항목으로하고, 육안평가결과는각각평가한점수의총합으로나타냈다. 각각의항목은없음 (0), 약함 (1), 중증도 (2), 심함 (3) 으로채점하였으며최소 0 점에서, 최고 15 점사이의점수를측정하였다. 5) 혈액중백혈구세포수측정최종실험종료후 EDTA가처리된튜브형주사기로심장혈액 0.5ml 를채취한다. 전혈을바이오톡스텍 ( 주 )( 청주, 충청북도 ) 에의뢰하여혈액중백혈구의총세포수를측정한다. 6) 채혈및 Ig E 측정 NC/Nga 생쥐의눈에서 10주, 12주, 15주에 capillery 관을이용하여약 100 μl의혈액을채혈한후원심분리기 6,500 rpm 에서 20분간원심분리한후 30 μl의혈청을분리하였다. 혈청은취하여 -70 에냉동보관하였다. NC/Nga 생쥐의혈청내 IgE 농도측정은 enzyme-linked immuno-sorbent assay 로 IgE 수준을측정하였다. 각 well 에혈청 5 μl (1/10 dilution) 와 dilution buffer 45 μl를혼합하여각 well 에분주하고, 2시간동안 25 실온에서방치한후 2회 washing 완충용액으로세척한다음 antibody biotin-ige conjugated 를넣고 2시간방치하였다. 다시 2회수세후완충용액으로세척한다음 antibody Avidin-HRP conjugeted 100 μl를처리하고 1시간실온에서방치한후다시세척하였다. TMB 기질을 100 μl씩분주하고암소에서 30분간방치한후 100 μl의 stop 용액을처리한후 ELISA leader 450 nm에서흡광도를측정하였다. 7) 비장세포에서 Th1/Th2 cytokine 발현변화 NC/Nga 생쥐실험시작 8주후 (15주령) 에실험을종료하고비장 (spleen) 을적출하여 100 mesh 로비장세포 (splenocytes) 를분리하였다. 전날 CD3 mab 1 μg / ml을 96 well plate 에 coating 하여 4 냉장고에서 overnight한다음 D-PBS 로 2회수세하였다. 분리한비장세 포는 ACK 용액으로 RBC 를제거한후 DNCB extract가 coating 된각각의 well 에 세포씩 5% FBS-DMEM 배양액에서 48시간동안배양한후원심분리기 2,000 rpm에서 3분간원심분리한후 200 μl의배양상층액을얻었다. 배양상층액내의 IL-4 (BioSource, U.S.A.) 와 IFN-γ (BioSource, U.S.A.), 혈청내 IL-5 (BioSource, U.S.A.), 그리고혈청내 IL-13 (R&D system, U.S.A.) 의수준측정은 ELISA 로측정하였다. 각 well 에배양상층액 50 μl를분주하고, 2시간동안 25 실온에서방치한후 2회완충용액으로세척한다음 antibody biotin-ige conjugated 를넣고 2시간방치하였으며, 다시 2회수세후완충용액으로세척한다음 antibody Avidin-HRP conjugated 100 μl를처리하고 1시간실온에서방치한후다시세척하였다. TMB 기질을 100 μl씩분주하고암소에서 30분간방치한후 100 μl의 stop 용액을처리한후 ELISA reader 450 nm에서흡광도를측정하였다. 8) ALN, PBMCs 및등피부조직에서형광유세포분석실험을종료한후 NC/Nga 생쥐에서 ALN (Axillary lymph node) 을적출하여 100 mesh 로세포를분리하여 D-PBS 로 5분간원심분리 (1,700 rpm) 하고 2회세척한후 cell strainer (FALCON, U.S.A.) 에통과시켜세포이외의분해되지않은조직이나불순물을제거하였다. PBMCs (Peripheral blood mononuclear cells) 는 NC/Nga mouse 에서 heparin 을처리한 3 ml주사기로채혈한후미리준비한 10 ml의 ACK 용액 (8.3 g NH4Cl, 1 g KHCO3, in 1 l of demineralized water mm EDTA) 에혼합하여실온에서 5분동안처리하여적혈구를제거하고 2회 1% 의 FBS 가함유된 PBS (FACS buffer) 로세척한후 cell strainer 에통과시켜세포이외의불순물을제거하였다. 등피부조직은잘게 chopping한후 collagenase 1 mg / ml (in 2% FBS + RPMI 1640) 를넣고 37 shaker (180 rpm, 20 min) 배양기에서배양한후상층액을회수하는방법으로 4회반복하였다. 분리한 ALN, PBMCs 와등피부조직침윤세포의총세포수를측정한다음, 모든조직의세포
6 352 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice 등을 cells/ ml로조정한후 4 에서면역형광염색 (immunofluorescence staining) 을실시하였다. 각각에 anti-cd4-fitc, anti-cd8-fitc, anti-cd23-fitc, anti-cd11b-fitc, anti-gr-1-pe, 그리고 anti-b220-pe 를넣고 30분간얼음에서반응시킨후 3회이상 PBS로수세한후 flow cytometry의 Cell Quest 프로그램을이용하여 CD4 +, CD8 +, CD11b + Gr-1 +, 그리고 B220 + CD23 + 세포수를백분율 (%) 로분석한후총세포수를적용하여각조직에서의절대세포수 (absolute number) 를산출하였다. 9) 등피부조직에서 Quantitative Real-time PCR 분석 (1) NC/Nga 생쥐의등피부조직에서 RNA 분리 NC/Nga 생쥐의등피부조직을적출하여각각에 RNAzol B 500 μl를넣고용해될때까지 homogenizer 로분쇄하였다. 이조직분쇄혼합부유액에 chloroform (CHCl 3 ) 50 μl를첨가한후 15초간다시혼합하였다. 이를얼음에 15분간방치한후 13,000 rpm 에서원심분리한후약 200 μl의상층액을회수하여 2-propanol 200 μl와동량혼합후천천히흔들고얼음에서 15분간방치하였다. 이를다시 13,000 rpm 에서원심분리한후 80% EtOH 로수세하고 3분간 vaccum pump 에서건조하여 RNA 를추출하였다. 추출한 RNA 는 DEPC 를처리한 20 μl의증류수에녹여 heating block 75 에서불활성화시킨후 first strand cdna 합성에사용하 였다. Quantitative Real-time PCR 은 7500 Real-Time PCR system을이용하여수행하였다. (2) 역전사- 중합효소연쇄반응역전사 (reverse transcription) 반응은준비된 total RNA 2 μg을 DNase I (10 U/ μl ) 2 U/tube 를 37 heating block 에서 30분간반응한후 75 에서 10 분동안변성시켰다. 이에 2.5 μl 10 mm dntps mix, 1 μl random sequence hexanucleotides (25 pmole/ 25μl ), RNA inhibitor 로서 1 μl RNase inhibitor (20 U/ μl ), 1 μl 100 mm DTT, 4.5 μl 5 RT buffer (250 mm Tris-HCl, ph 8.3, 375 mm KCl, 15 mm MgCl 2 ) 를가한후, 1 μl의 M-MLV RT (200 U/ μl ) 를다시가하고 DEPC 처리된증류수로서최종부피가 20 μl가되도록하였다. 이 20 μl의반응혼합액을잘섞은뒤 2,000 rpm에서 5초간원심침강하여 37 heating block 에서 60분동안반응시켜 first-strand cdna 를합성한다음, 95 에서 5분동안방치하여 M-MLV RT(Moloney murine leukemia virus reverse transcriptase, Promega, U.S.A.) 를불활성화시킨후합성이완료된 cdna 를 polymerase chain reaction (PCR) 에사용하였다. (3) Quantitative Real-time RT-PCR Quantitative Real-time RT-PCR 은 7500 Real-time PCR system 을이용하여수행하였으며 Mouse Olionucleotid 의염기배열은다음과같다 (Table 3). Table 3. Primer Sequence Gene Primer Sequence GAPDH Forward 5' TGAAGCAGGCATCTGAGGG 3' Reverse 5' CGAAGGTGGAAGAGTGGGAG 3' IL-4 Forward 5' -GGATGTAACGACAGCCCTCT-3 Reverse 5' -GTGTTCCTTGTTGCCGTAAG-3 ' IL-13 Forward 5' ATGCCCAACAAAGCAGAGAC 3' Reverse 5' TGAGAGAACCAGGGAGCTGT 3' TNF-α Forward 5' TTCTGTCTACTGAACTTCGGGGTGATCGGTCC 3' Reverse 5' GTATGAGATAGCAAATCGGCTGACGGTGTGGG 3' TGF-β Forward 5' TGGAGCAACATGTGGAACTC 3' Reverse 5' CTGCCGTACAACTCCAGTGA 3' COX-2 Forward 5' GGGTGTCCCTTCACTTCTTTCA 3' Reverse 5' TGGGAGGCACTTGCATTGA 3'
7 JY Kwak et al. 353 Cytokine 유전자발현은 SYBR R Green PCR Master mix를사용하였고, internal standard는 GAPDH 로 Taqman probe 를사용하였으며, primer 의최종농도가 200 nm이되게반응시켰다. IL-5와 IL-13 mrna 유전자발현은등피부조직에서관찰하였고 cdna 를합성하여분석하였다. Quantitative Real-time PCR 의조건은 pre-denaturation 은 2 min at 50, 10 min 94, 그리고 40 cycles을 0.15 min at 95, 1 min at 60 에서수행하였다. 양성대조군, DIDT (300 mg / kg ) 투여군, DIDT (100 mg / kg ) 투여군의대조군은 internal standard 로 GAPDH 를사용하여 target group 의 Quantitative PCR 은 y=x(1+e)n x : starting quantity y : yield n : number of cycles e : efficiency 로계산하여 RQ (relative quantitative) 값을측정하였다. 10) Histology 분석등쪽목부분의피부를떼어내어 10% paraform-aldehyde 에서 24시간동안포르말린에고정하였다. 그조직을파라핀으로포맷하였고, 5 μm두께로 block 을만들었다. 그조직부분은염증을일으키는 epidermis, dermis, keratinocytes, neutrophils / eosinophil, 그외다른세포와부종을식별하는 hematoxyline /eosin (H&E) 염색과비만세포를염색하는 toluidine blue 염색으로비만세포의침윤을광학현미경 ( 200, Nikon, Japan) 으로관찰하였다. Ⅲ. 結果 1. 체중변화실험동물의체중변화를측정한결과, NC/Nga 생쥐에 DNCB 를도포하여아토피피부염모델을유도한후, 매일 3주간일정한시각에 3주간양성대조군은 (Dex) 경구투여하고, 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 체중의증감확인을위해 5주간몸무게를측정하였다. 그결과모든군에서눈에띄는체중감소는확인되지않았다 (Figure 1). 2. Skin clinical score NC/Nga mouse 에 DNCB 를 3주간도포하고최종 5 주후등피부에나타난소양행동을동반한홍반, 부종, 인설, 가피, 태선화등의단계를 0 (none), 1 (mild), 2 (moderate), 3 (severe) 로개체마다평가기록하여피부발진점수로평가한결과대조군의 skin clinical score 는 DNCB 를도포하지않은정상군 (NC/Nga-Nr, 이하정상군 ) 에비하여 4배이상증가를나타내었고, 양성대조군인 dexamethasone (3mg/kg) 투여군 ( 이하, 양성대조군 ) 은대조군 (CT, 이하대조군 ) 에비해 3배정도의감소를나타내었다. DNCB 를도포한후산조인복합오일 (ZjJ-C_oil) 을도포시킨군 ( 이하, 산조인복합오일군 ) 은대조군에비해약간의감소를나타내었으며, DNCB 를도포한후, 독활복합오일 (ARC-C_oil) 를도포시킨군 ( 이하, 독활복합오일군 ) 에서는대조군에비해 skin clinical score 가 2배이상감소를나타내었다 (Figure 2). 3. 통계처리각실험군결과값은 unpaired student's T-test 통계프로그램을사용하여통계처리하였으며, p<0.05 이하의수준에서유의성검정을실시하였다.
8 354 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice Atopic dermatitis NC/Nga mice were induced by DNCB treatment in the dorsal skin, before the treatment of DNCB (NC/Nga-Nr), DNCB treatment for 3 weeks (CT), DNCB treatment for 3 weeks with dexamethasone (3mg/kg) (Dex), DNCB treatment ZjJ-C_oil, ARC-C_oil for 3 weeks with for 3 weeks. (* : p<0.05, ** : p<0.01, *** : p<0.001) Figure 1. Changes in body weight in experimental mice Atopic dermatitis NC/Nga mice were induced by DNCB treatment in the dorsal skin, before the treatment of DNCB (normal, NC/Nga-Nr), DNCB treatment for 3 weeks (DNCB_CTL, CT), DNCB treatment for 3 weeks with Dexamethasone (DNCB_Dexamethason, Dex), DNCB treatment for 3 weeks with ZjJ-C_oil, DNCB treatment for 3 weeks with ARC-C_oil treatment for 3 weeks. A total clinical severity score for AD-like lesions was defined as the sum of theindividual scores graded as 0 (none), 1 (mild), 2 (moderate) and 3 (severe) for each of five signs and symptoms (erythema/hemorrhage, scarring/dryness, edema, excoriation/erosion and lichenification) on the three parts of the body: ear, and head and back. Each point represents the mean±se of five mice. Figure 2. Clinical skin features and severity of atopic dermatitis skin lesions in atopic dermatitis-like NC/Nga mice induced by DNCB
9 JY Kwak et al 혈청 IgE에미치는영향혈청 Ig E를측정한결과, 대조군은정상군에비해유의성있게 (p<0.001) 증가하였으며, 양성대조군은대조군에비해유의성있게 (p<0.001) 감소하였다. 산조인복합오일군, 독활복합오일군모두대조군에비해유의성있게 (p<0.01) 감소하는것으로나타났다 (Figure 3). IFN-γ 생산량은정상군에비해대조군에서증가하였고, 양성대조군은대조군에비해감소하였으며, 산조인복합오일군과독활복합오일군이대조군에비해감소하였으며특히산조인복합오일군에서유의성있게 (p<0.05) 감소하였다 (Figure 4). IL-13 생산량은정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.05) 감소하였다. 그리고산조인복합오일군과독활복합오일군이대조군에비해감소하였으며특히산조인복합오일군에서유의성있게 (p<0.01) 감소하였다 (Figure 4). IL-5 생산량은정상군에비해대조군에서유의성있게 (p<0.05) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.05) 감소하였다. 그리고산조인복합오일군과독활복합오일군이대조군에비해감소하였으며특히산조인복합오일군에서유의성있게 (p<0.05) 감소하였다 (Figure 4). Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil for 3 weeks. Blood was collected from the retro-orbital plexus under ether anesthesia and heparinized immediately thereafter. Serum samples were obtained by centrifugation and stored at -20 until use. Total IgE levels were measured by a sandwich ELISA using an ELISA kit (Shibayagi, Japan). Each point represents the mean±se of five mice. Statistically significant value compared with DNCB_CT group data by student's T-test (**p<0.01, ***p<0.001).### : p<0.001 compared with normal group. Figure 3. Serum Ig E elevation and development of atopy dermatitis skin lesions-induced in NC/Nga mice by DNCB 4. 비장세포 cytokine 발현 비장세포를분리하여배양상층액에서의 cytokine 발현을측정한결과, IL-4 생산량은정상군에비해대조군에서약 4배증가하였고, 양성대조군은대조군에비해감소하였으며산조인복합오일군과독활복합오일군이대조군에비해감소하였으며특히산조인복합오일군에서유의성있게 (p<0.05) 감소하였다 (Figure 4). 5. ALN, PBMCs, 등피부조직에서형광유세포분석 1) 총세포수측정실험종료후 15주령의 NC/Nga 생쥐를 ethyl ether 로마취한한후 ALN, spleen 그리고등피부부위를적출하여총세포수를측정하였다. ALN 세포수는정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.01) 감소하였으며, 산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 은대조군에비해유의성있게감소되는것으로나타났다 (Figure 5). 등피부조직의세포수는정상군에비해대조군에서유의성있게 (p<0.01) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.01) 감소하였으며, 산조인복합오일군은대조군에비해유의성있게 (p<0.05) 감소되는것으로나타났다. 독활복합오일군에서는감소하였지만유의성은나타나지않았다 (Figure 5).
10 356 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil for 3 weeks. Spleen from mouse at 15 weeks of age were re-stimulated with CD3 mab (1 μg / ml ) for 48 hrs. IL-4, IL-5, IL-13 and IFN-γ levels were measured by a sandwich ELISA using an mouse ELISA kit I (Biosource, USA). Statistically significant value compared with DNCB_CT group data by student's T-test (*p<0.05, **p<0.01, ***p<0.001). # : p<0.05 compared with normal group. ### : p<0.001 compared with normal group. Figure 4. Culture supernatant IL-4, IL-5, IL-13 and IFN-γ level in splenocytes cytokines level in NC/Nga mouse by DNCB Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil treatment for 3 weeks. Statistically significant value compared with DNCB_CT group data by student's T-test (*p<0.05, **p<0.01, ***p<0.001). ## : p<0.01 compared with normal group. ### : p<0.001 compared with normal group. Figure 5. Total cell number of ALN, spleen and dorsal skin in NC/Nga mouse
11 JY Kwak et al ) 면역형광염색에의한 cell contents 변화 (1) PBMCs 에서 CD4 + &CD8 +, CD11b + /Gr-1 + 세포수 CD4 + Th 세포의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.001) 감소하였고, 양성대조군은대조군에비해유의성있게 (p<0.05) 증가하였으며, 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 은대조군에비해유의성있게 (p<0.001) 증가하는것으로나타났다 (Figure 6). CD8 + c/s T 세포의총절대세포수는정상군에비해대조군에서감소하였고, 양성대조군은대조군에비해증가하였으며, 산조인복합오일군, 독활복합오일 (ARC-C_oil) 은대조군과비슷한수준으로나타 Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil treatment for 3 weeks. NC/Nga mouse PBMC cells (5x10 5 cells/ ml ) were isolated from blood and the PBMCs were washed twice and analyzed by flow cytometry. Total absolute number of CD4+&CD8+ and CD11b + /Gr-1 + in NC/Nga mouse. Statistically significant value compared with DNCB_CT group data by student's T-test (*p<0.05, **p<0.01, ***p<0.001). # : p<0.05 compared with normal group. ### : p<0.001 compared with normal group. Figure 6. Effects of ZjJ-C_oil, ARC-C_oil treatment on the percentage of CD4 + &CD8 + and CD11b + /Gr-1 + changes of total absolute numbers in PBMC cells in NC/Nga mouse by DNCB
12 358 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice 났다 (Figure 6). CD11b + /Gr-1 + MSC 의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.05) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.05) 감 소하였으며, 산조인복합오일 (ZjJ-C_oil) 은대조군에비해유의성있게 (p<0.001) 감소하였고독활복합오일 (ARC-C_oil) 대조군에비해감소하였지만유의성은나타나지않았다 (Figure 6). Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil treatment for 3 weeks. NC/Nga mouse ALN cells (5x10 5 cells/ ml ) were isolated from ALN, and the ALN cells were washed twice and analyzed by flow cytometry. Total absolute number of CD4 + &CD8 + and B220+/CD23 + in NC/Nga mouse. Statistically significant value compared with DNCB_CT group data by student's T-test (*p<0.05, **p<0.01, ***p<0.001). ### : p<0.001 compared with normal group. Figure 7. Effects of ZjJ-C_oil, ARC-C_oil treatment on the percentage of CD4 + &CD8 + and B220 + /CD23 + changes of total absolute numbers in ALN cells in NC/Nga mouse by DNCB
13 JY Kwak et al ) ALN에서 CD4 + &CD8 +, B220 + /CD23 + 세포수 CD4 + Th 세포의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.001) 감소하였으며, 산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서는대조군에비해유의성있게감소한것으로나타났다 (Figure 7). CD8 + T c/s 세포의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.05) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.01) 감소하였다. 산조인복합오일군, 독활복합오일 (ARC-C_oil) 은대조군에비해감소되었다 (Figure 7). B220 + /CD23 + 세포의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.001) 감소하였다. 그리고산조인복합오일 (ZjJ-C_oil) (p<0.001), 독활복합오일 (ARC-C_oil)(p<0.01) 에서는대조군에비해유의성있게감소하는것으로나타났다 (Figure 7). 3) 등피부조직에서 CD4 + &CD8 +, CD11b + /Gr-1 + 세포수 CD4 + Th 세포의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.001) 감소하였다. 그리고산조인복합오일군, 독활복합오일군에서는대조군에비해유의성있게 (p<0.01) 감소되는것으로나타났다 (Figure 8). CD8 + c/s T 세포의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.001) 감소하였으며, 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 은대조군에비해증가되는것으로나타났다. 특히산조인복합오일 (ZjJ-C_oil) 은대조군에비해유의성있게 (p<0.01) 감소되는것으로나타났다 (Figure 8). CD11b + /Gr-1 + MSC 의총절대세포수는정상군에비해대조군에서유의성있게 (p<0.05) 증가하였고, Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil treatment for 3 weeks. NC/Nga mouse dorsal skin cells (5x10 5 cells/ ml ) were isolated from dorsal skin, and the dorsal skin cells were washed twice and analyzed by flow cytometry. Total absolute number of CD4 + &CD8 + and CD11b + /Gr-1 + in NC/Nga mouse. Statistically significant value compared with DNCB_CT group data by student's T-test (*p<0.05, ***p<0.001). # : p<0.05 compared with normal group. ### : p<0.001 compared with normal group. Figure 8. Effects of ZjJ-C_oil, ARC-C_oil treatment on the percentage of CD4 + &CD8 + and CD11b + /Gr-1 + changes of total absolute numbers in dorsal skin cells in NC/Nga mouse by DNCB
14 360 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice 양성대조군은대조군에비해유의성있게 (p<0.05) 감소하였다. 그리고산조인복합오일군, 독활복합오일군에서는대조군에비해감소하는것으로나타났다 (Figure 8). 7. 등피부조직에서 mrna 유전자발현 실험종료후등피부조직에서유전자발현을측정한결과, COX-2 mrna의유전자발현의상대정량값 Topical application of atopic dermatitis NC/Nga mouse was maintained under conventional conditions, and induced by DNCB in the dorsal skin for 3 weeks, and next to ZjJ-C_oil, ARC-C_oil treatment for 3 weeks. Total RNAs were extracted in dorsal skin tissue IL-4, IL-13, COX-2, TNF-α and TGF-β1 mrna synthesized by real-time PCR was analyzed. The amount of SYBR Green was measured at the end of each cycle. The cycle number at which the emission intensity of the sample rises above the baseline is referred as to the RQ (relative quantitative) and is proportional to the target concentration. Real time PCR was performed in duplicate and analyzed by a Applied Biosystems 7500 Fast Real-Time PCR system. Statistically significant value compared with DNCB_CT group data by student's T-test (*p<0.05, **p<0.01, ***p<0.001). # : p<0.05 compared with normal group. ## : p<0.01 compared with normal group. ### : p<0.001 compared with normal group. Figure 9. Effects of ZjJ-C_oil, ARC-C_oil treatment on IL-4, IL-13, COX-2, TNF-α and TGF-β1 mrna expression in dorsal skin cells in NC/Nga mouse by DNCB
15 JY Kwak et al. 361 (RQ)은 정상군에 비해 대조군에서 유의성 있게 군(p<0.01), 독활 복합오일 (ARC-C_oil)(p<0.05) 에서 (p<0.001) 증가하였고, 양성대조군은 대조군에 비해 는 대조군에 비해 유의성 있게 감소하는 것으로 나타 유의성 있게(p<0.01) 감소하였으며, 산조인 복합오일 났다(Figure 9). Atopic dermatitis NC/Nga mice were induced by DNCB treatment in the dorsal skin, before the treatment of DNCB (NC/Nga-Nr), DNCB treatment for 3 weeks (CT), DNCB treatment for 3 weeks with dexamethasone (3mg/kg) (Dex), DNCB treatment for 3 weeks with ZjJ-C_oil, DNCB treatment for 3 weeks with ARC-C_oil treatment for 3 weeks. Figure 10. H&E staining on histological features of dorsal skin Atopic dermatitis NC/Nga mice were induced by DNCB treatment in the dorsal skin, before the treatment of DNCB (NC/Nga-Nr), DNCB treatment for 3 weeks (CT), DNCB treatment for 3 weeks with dexamethasone (3mg/kg) (Dex), DNCB treatment for 3 weeks with ZjJ-C_oil, DNCB treatment for 3 weeks with ARC-C_oil treatment for 3 weeks. Figure 11. Toluidin staining on histological features of dorsal skin
16 362 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice TNF-α mrna의유전자발현의상대정량값 (RQ) 은정상군에비해대조군에서유의성있게 (p<0.05) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.01) 감소하였으며, 산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서도대조군에비해유의성있게감소되는것으로나타났다 (Figure 9). TGF-β1 mrna의유전자발현의상대정량값 (RQ) 은정상군에비해대조군에서유의성있게 (p<0.01) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.001) 감소하였다. 산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서대조군에비해유의성있게감소하였다 (Figure 9). IL-4 mrna의유전자발현의상대정량값 (RQ) 은정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.01) 감소하였다. 산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 은대조군에비해유의성있게감소되는것으로나타났다 (Figure 9). IL-13 mrna의유전자발현의상대정량값 (RQ) 은정상군에비해대조군에서유의성있게 (p<0.001) 증가하였고, 양성대조군은대조군에비해유의성있게 (p<0.01) 감소하였다. 산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 은대조군에비해유의성있게감소되는것으로나타났다 (Figure 9). 8. 등피부조직검사및분석실험종료후등피부를절단하여 H&E 염색하여분석한결과, 정상군에비하여대조군의상피조직이부종으로현저하게확장되었고 leucocytes의침윤, erythema, edema, excoriation, scaling 도보이고있다. 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 은대조군에비하여상피조직의두께가현저하게줄었고, leucocytes의침윤및 erythema, edema, excoriation, scaling 등은보이지않아부종이거의사라진것을알수있다 (Figure 10). 또한등피부에침윤된비만세포를관찰하기위하여 toluidine blue 염색하여분석한결과, 정상군에비하여대조군의비만세포가현저하게증가되었고, 산조인복합오일군, 독활복합오일군은대조군에비하여비만세포가거의사라진것을알수있다 (Figure 11). Ⅳ. 考察 아토피피부염은심한가려움과습진성변화, 태선화를일으키는만성염증성피부질환이다 1,2. 아토피피부염은전인구의 0.5-1%, 어린이의경우 5-10% 가앓고있으며최근유소아의유병률이 2-3 배증가하고성인에게서도증가하고있는추세이다 2. 아토피피부염은일반적으로 Ig E 합성의증가와호산구증가증이나타나는데기존의면역학적연구에의하면 IL-4, IL-5와같은 Th2 cytokine이증가하고 Th1 cytokine 인 IFN-γ 의분비가감소하는것과관련이있는것으로보고되었으며, 이러한 Th1과 Th2의불균형을조절하는방법으로피부염의치료에접근하고있다 7. 아토피피부염의치료법으로는스테로이드제, 항히스타민제, 면역억제제가사용되는데반복적으로사용시피부의위축이나소아환자에서성장지연의가능성등각종부작용이문제되고있어새로운대체요법의필요성이증가하고있다. 동무이제마가창안한사상체질의학은성정 ( 性情 ) 의차이에서비롯된장부 ( 臟腑 ) 의대소, 생리, 외형특성에따라사람을태양인, 소양인, 태음인, 소음인으로분류하여체질에맞는치료법과양생법을제시하여오늘날개인별맞춤의학치료의기틀을마련하였다. 동의수세보원 8 에따르면 4가지체질중각체질의비율은태음인 50%, 소양인 30%, 소음인 20%, 태양인 1% 미만이고명 9 의연구에따르면아토피환자중 61.3% 가태음인, 29.1% 가소양인, 9.6% 가소음인으로나타나가장많은비율을차지하는태음인과소양인에게적합한복합오일의치료제가필요할것으로생각된다. 태음인약재인산조인 ( 酸棗仁 ) 은갈매나무과
17 JY Kwak et al. 363 (Rhamnaceae) 에속한낙엽관목인묏대추의성숙한종자 ( 種子 ) 를건조한것으로심경 ( 心經 ) 과간경 ( 肝經 ) 으로들어가마음을안정시키고, 땀을수렴시켜불면, 경계 ( 驚悸 ), 다한 ( 多汗 ), 구갈 ( 口渴 ) 등을치료하며 10 이등 11 의연구처럼불면, 신경안정효과에대한연구가활발히이루어지고있다. 소양인약재인독활 ( 獨活 ) 은미나리과에속한다년생초본 ( 草本 ) 인중치모당귀의뿌리인데, 신경 ( 腎經 ) 과방광경 ( 膀胱經 ) 에들어가습 ( 濕 ) 을제거하고통증과저림을해소하는효과가있어무릎과허리통증, 관절운동이상, 발열, 두통, 전신통을치료하며 10 이등 12 의연구처럼항염증효과에대한연구가활발히이루어지고있다. 소양인약재인방풍 ( 防風 ) 은미나리과에속하는다년생초본 ( 草本 ) 인방풍 ( 防風 ) 의근 ( 根 ) 및근경 ( 根莖 ) 으로간경 ( 肝經 ), 비경 ( 脾經 ), 방광경 ( 膀胱經 ) 에들어가표증을해소하고습을제거하며경련을멈추는효과가있어감기로인한두통, 풍습 ( 風濕 ) 으로인한저림증상, 관절통, 소양감, 발진, 경련, 파상풍을치료하며 12 노의연구처럼항염효과에대한연구가이루어지고있다 13. 이처럼신경안정, 항염증효과가증명되었으나아직직접적으로아토피피부염에대한효과에대한연구는이루어지고있지않아본논문에서는산조인복합오일, 독활복합오일의아토피동물모델에서호전도를실험적으로검증해보고자하였다. 상기실험에서는 NC/ Nga mouse 를아무런처리를하지않은정상군, 등을제모한후 1% 의 DNCB 를 2주간도포한음성대조군, 등을제모한후 1% 의 DNCB 를 2주간도포하고양성대조약물 dexamethasone(dexa.) 0.5% 를주 5회등에도포한양성대조군, 등을제모한후 1% 의 DNCB 를 2주간도포하고산조인복합오일을 3주간등에도포한실험군, 등을제모한후 1% 의 DNCB 를 2주간도포하고독활, 방풍복합오일을 3주간등에도포한실험군으로나누어실험을진행하였다. 최종 5주후 skin clinical score를측정한결과, DNCB 를도포한후산조인복합오일군을도포시킨군은대조군에비해약간의감소를나타내었으며, DNCB 를도포한후, 독활복합오일 (ARC-C_oil) 를도포시킨 군에서는대조군에비해 skin clinical score 가 2배이상감소를나타내었다. 이는산조인, 독활복합오일이가려움을동반한홍반, 부종, 인설, 가피, 태선화를개선시킬수있음을보여준다. 혈청 IgE를측정한결과, 산조인복합오일군, 독활복합오일군모두대조군에비해유의성있게 (p<0.01) 감소하는것으로나타났다. 아토피피부염환자는랑게르한스세포에알레르기원인물질을전달해주는세포표면의수용체가정상인보다증가되어있다 14. 항원에대한특이 IgE 는랑게르한스세포가가진이러한항원전달능력을증가시킨다. 항원이들어와 IgE에결합하면랑게르한스세포가항원을림프구에전달하여세포매개면역반응을유도함으로서병변을유발시킬수있을뿐만아니라, 면역반응을지속적으로유지시키는데중요한역할을한다 15. 이와같은결과산조인복합오일 (ZjJ-C_oil), 독활복합오일군으로인하여알레르기면역반응을억제하여 B세포분화과정에서분비되어염증반응을유도하는 IgE 분비를억제하는것으로사료된다. 비장세포를분리하여배양상층액에서의 cytokine 발현을측정한결과, IL-4, IFN-γ, IL-5생산량은산조인복합오일군과독활복합오일군이대조군에비해감소하였으며특히산조인복합오일군에서유의성있게 (p<0.05) 감소하였다. IL-13 생산량은산조인복합오일군과독활복합오일군이대조군에비해감소하였으며특히산조인복합오일군에서유의성있게 (p<0.01) 감소하였다. 아토피피부염은급성일경우 Th2 세포가편향적으로발달하며아토피피부염이심화되면 Th1 cytokine도동시에증가해염증반응을더욱악화시킨다. Th2 세포는다양한 cytokine과 chemokine 인자들을생성하여아토피피부염의진행을유도하는데 Th2 세포에서발현된 IL-4, IL-5, IL-13 cytokine 은 B림프구의생성과분화를유도한다 16. IL-4 는 Th2 세포가분비하는 cytokine 으로 B 세포에서 IgE의생산을유도하고 B 세포에서 IgM 에서 IgE 로전환하는정도를증가시킨다. IL-4 는면역반응의초기에 naive Th 세포를 Th2
18 364 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice 세포로분화되게하며 Th1 세포집단으로의확장을저해하기도한다 17. IL-5 는 Th2 세포가생산하고호산구의발달, 생존에중요한역할을하며 18 호산구를활성화시키고, IL-13은 Th2 세포가생산하는 cytokine 이고대식세포가미생물을죽이는활동을억제한다 19. IFN-γ 는대식세포를활성화하고, 대식세포의항미생물활성을증가하도록자극하며, Th1 림프구의분화와활성을촉진시키는주된조절분자의발현을상향조절하고 Th2 집단의확장을저해한다. 아토피피부염환자의말초혈액과피부조직에서 IFN-γ 생산저하가보고되고있고 IFN-γ 가 IgE 생성및 Th2 림프구의증식을억제한다 20. 따라서산조인복합오일군, 독활복합오일군은 Th2 cytokines 과 IFN-γ 의발현을조절하여피부염증반응을억제한다고사료된다. 실험종료후 15주령의 NC/Nga 생쥐를 ALN, spleen 그리고등피부부위를적출하여총세포수를측정하였다. ALN 세포수는산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서대조군에비해유의성있게감소되는것으로나타났다. 등피부조직의세포수는산조인복합오일군에서대조군에비해유의성있게 (p<0.05) 감소되는것으로나타났다. 독활복합오일군에서는감소하였지만유의성은나타나지않았다. 아토피피부발진이심화되면피부발진부위에 Th2 세포, 호산구, 단핵구, 비만세포등면역염증세포가증가하게되고, 표피층이두꺼워지는원인을제공하여만성피부질환동물의피부발진을계속유지하고악화시키는데기여하게된다 18. 실험결과산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 이면역염증세포수증가를억제하는것으로사료된다. 면역조절작용중 myeloid 세포의역할은다양한질환상태에관여하여면역억제작용을하고세포의성장과분화에도중요하게작용하는것으로알려져있다. 그리고 myeloid suppressor cells (MSC) 의특징은 macrophage (Mac-1/CD11b) 와 granulocyte (Gr-1)lineages 를모두표면분자로발현하는것이다. CD11b+Gr-1+ MSC 는 spleen, lymphnodes 에서염증피부및조직으로이동하여많이존재하는데, 이세포는 antibody production, cytotoxic T lymphocyte (CTL) generation, 그리고 lymphocyte proliferative responses 를억제하여아토피의경우만성피부질환을계속적으로심화시키는역할을한다 22. CD4+ T 세포는특정한 B 림프구에작용하여 B 림프구가항원과반응하도록함으로써체액성면역반응을촉진 ( 항체형성촉진 ) 시키며세포성면역반응자체도증강시킨다. 또한 CD8+ T 세포는직접적으로항원을죽일수있는독성물질을방출하여항원을죽이며자극을받으면세포성면역반응을이끌어낸다. 이로써 CD4+ T 세포와 CD8+ T 세포는우리몸의면역기능을가늠하는가장중요한지표가된다. 또한최근연구에서따르면 CD8+ T세포는염증발진에서 migration 으로중요한역할을하고또한 LTB4를통해비만세포를활성화시켜알레르기질환의 pathogenesis 에서중심적역할을한다 23. CD23+ 세포는비만세포, 호중구, 호산구등의표면분자이며알레르기질환에서 IgE 생성및염증반응에연관된다. CD23+ 을통한 allergen-loaded IgE 에의해세포들이활성화되면 IL-1, IL-6, TNF-α 가생성된다 24. B220+ 세포는사람에게는없지만생쥐의 B세포표면에있는표식자로 B세포의표면에서발현되는 B세포마커이며 B220+ 가증가하면체액성면역이증가한다는것을의미한다 25. PBMCs 에서 CD4 + &CD8 +, CD11b + /Gr-1 + 세포수를측정한결과, CD4 + Th 세포의총절대세포수가산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 에서대조군에비해유의성있게 (p<0.001) 증가하는것으로나타났다. CD8 + c/s T 세포의총절대세포수는산조인복합오일군, 독활복합오일 (ARC-C_oil) 에서대조군과비슷한수준으로나타났다 (Figure 8). CD11b + /Gr-1 + MSC 의총절대세포수는산조인복합오일 (ZjJ-C_oil) 은대조군에비해유의성있게 (p<0.001) 감소하였고독활복합오일 (ARC-C_oil) 은대조군에비해감소하였지만유의성은나타나지않았다. 산조인복합오일 (ZjJ-C_oil), 독활복합오일군으로 CD11b+/Gr-1+ myeloid suppressor 세포가염증피부및조직으로의이동을제한하여면역반응과지속적인피부염증을억제할것으로사료된다.
19 JY Kwak et al. 365 ALN 에서 CD4 + &CD8 +, B220 + /CD23 + 세포수를측정한결과, CD4 + Th 세포의총절대세포수는산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서는대조군에비해유의성있게감소한것으로나타났다. CD8 + T c/s 세포의총절대세포수는산조인복합오일군, 독활복합오일 (ARC-C_oil) 에서대조군에비해감소되었다. B220 + /CD23 + 세포의총절대세포수는산조인복합오일 (ZjJ-C_oil)(p<0.001), 독활복합오일 (ARC-C_oil)(p<0.01) 에서대조군에비해유의성있게감소하는것으로나타났다. 산조인복합오일 (ZjJ-C_oil), 독활복합오일군으로인하여 ALN로활성 B세포, CD4+ T세포, CD8+ T세포의침윤을억제하여체액성면역반응과세포성면역반응을제한하는것으로판단된다. 등피부조직에서 CD4 + &CD8 +, CD11b+/Gr-1 세포수를측정한결과, CD4+ Th 세포의총절대세포수는산조인복합오일군, 독활복합오일군에서는대조군에비해유의성있게 (p<0.01) 감소되는것으로나타났다. CD8+ c/s T 세포의총절대세포수는산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 은대조군에비해증가되는것으로나타났다. 특히산조인복합오일 (ZjJ-C_oil) 은대조군에비해유의성있게 (p<0.01) 감소되는것으로나타났다. CD11b+/Gr-1+ MSC의총절대세포수는산조인복합오일군, 독활복합오일군에서대조군에비해감소하는것으로나타났다. 산조인복합오일군, 독활복합오일군의효과등피부발진부위로 CD4+ T세포, CD8+ T세포그리고 CD11b+/Gr-1+ myeloid suppressor 세포의침윤을억제하여면역반응을제한하고, 피부질환이심화되는것을조절할수있을것이라고판단된다. 아토피피부염의면역학적기전을살펴보면우선 Th1과 Th2 cytokine의균형이항원에의해깨지게되고, 이에따라비정상적으로 IL-4, IL-5, IL-13 같은 Th2 cytokine 들이과잉생산되고 B세포를자극하여혈청내 IgE가증가하게된다는특징을가진다. 아토피질환에서분비되어증가된 IgE는비만세포표면의 IgE 수용체와결합하여비만세포를감작시키며, 항원이 침투하면비만세포표면의 Ig E와결합하게되면서비만세포활성및탈과립이유도되고, 세포내저장되어있던히스타민과같은화학전달물질이생성되어세포표면으로분비되는데, 이러한화학전달물질들로인하여알레르기증상이나타난다. 즉, 아토피질환은항원노출, 항원특이 Th2 세포와 B 세포의활성, IgE 항체의생산, 비만세포의 Fc 수용체에항체결합, 항원의재차노출에의한비만세포의자극의경과를따르며이에따라비만세포의매개자방출로나타난병리학적반응이라고요약할수있다 40. 비만세포는모든결합조직과상피세포아래층에존재하여흔히즉시형과민반응이나타나는부위이며, 아토피피부염피부병변에서자주관찰된다 26. 비만세포는 FCεRI의자극을통해 IL-4, IL-5, IL-6, IL-8, IL-13, GM-CSF 등과같은다양한 cytokine을생산, 분비하는데이러한 cytokine 을분비함으로써조기알레르기반응뿐아니라후기반응이나만성알레르기반응에도기여하게된다 19. 이렇듯아토피피부염의증상발현에여러가지 cytokine 이복합적으로작용하여우리몸피부에서소양감및각종알레르기염증상태를유발하게된다. Cyclooxygenase 는두가지형이있는데세포의구성성분으로되어있는 cyclooxygenase-1 (COX-1) 과염증매개물질에의해유도되는 cyclooxygenase-2 (COX-2) 가있다. COX-1 은주로혈관내피세포, 위점막및신장등에존재하면서위점막보호작용이나신장혈류를조절하는항상성기능을가지고있다. 이에비하여 COX-2 는염증매개물질에의하여생성된후염증부위에서염증을일으키고유지시키는작용을한다 27. TGF-β 도 IFN-γ 와같이순수분리된 B 세포와 anti-cd40 mab 와 ril-4 와동시배양하여자극할경우 B세포의분화및 IgE 생성을억제한다고보고되어있다 28. 실험종료후등피부조직에서유전자발현을측정한결과, COX-2, TNF-α, TGF-β1, IL-4, IL-13 mrna 의유전자발현의상대정량값 (RQ) 은산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서대조군에비해유의성있게감소하는것으로나타났다. 이와같은
20 366 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice 결과는산조인복합오일군, 독활복합오일군이아토피피부염에서발현되는다양한 cytokine 유전자발현을억제함으로서아토피피부염의염증반응을호전시킬수있다고판단된다. 실험종료후등피부를절단한후 H&E 염색하여분석한결과, 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 은대조군에비하여상피조직의두께가현저하게줄었고, leucocytes 의침윤및 erythema, edema, excoriation, scaling 등은보이지않아부종이거의사라졌고등피부에침윤된비만세포를관찰하기위하여 toluidine blue 염색하여분석한결과, 산조인복합오일군, 독활복합오일군은대조군에비하여비만세포가거의사라진것으로나타났다. 이를통해산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 이상피조직이두꺼워지고부종이생기는걸억제하며비만세포증식을억제하는효과가있는것으로사료된다. 상기실험의결과를종합하여볼때, 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 이 IgE 증가, cytokine 발현, 면역염증세포수증가, 세포성면역과체액성면역, 유전자발현을조절하여 NC/Nga mouse에서알레르기염증반응을효과적으로억제한다고볼수있다. 이를통해산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 을아토피피부염의새로운보조요법제로이용가능할것으로판단된다. 하지만아토피피부염동물모델이사람에서발생하는유전적인요인을고려하지못했고재현성에서한계가있다는단점이있다. 또한오일성분에치료효과를위해첨가하였던전나무, 천초약재가동의수세보원에체질이구체적으로명시되어있지않아태음인, 소양인에맞는치료제로사용되기에한계가있어약재구성과함량을체질에맞게조정하여치료의보조요법으로사용하기전에태음인, 소양인환자를대상으로한임상연구가필요할것으로사료된다. Ⅴ. 結論 1. 혈청 IgE 수치가산조인복합오일군, 독활복합오일군모두대조군에비해유의성있게 (p<0.01) 감소하였다. 2. IL-4, IFN-γ, IL-5 생산량은산조인복합오일군이대조군에비해유의성있게 (p<0.05) 감소하였다. IL-13 생산량은산조인복합오일군에서대조군에비해유의성있게 (p<0.01) 감소하였다. 3. ALN 의총세포수가산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서대조군에비해유의성있게감소되었다. 등피부조직의총세포수는산조인복합오일군에서대조군에비해유의성있게 (p<0.05) 감소되었다. 4. PBMCs 에서 CD4+ Th 세포의총절대세포수가산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 에서대조군에비해유의성있게 (p<0.001) 증가하였고 CD11b+/Gr-1+ MSC 의총절대세포수는산조인복합오일 (ZjJ-C_oil) 에서대조군에비해유의성있게 (p<0.001) 감소하였다. 5. ALN 에서 CD4+ Th 세포의총절대세포수는산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서는대조군에비해유의성있게감소하였고 B220+/CD23+ 세포의총절대세포수는산조인복합오일 (ZjJ-C_oil)(p<0.001), 독활복합오일 (ARC-C_oil)(p<0.01) 에서대조군에비해유의성있게감소하였다. 6. 등피부조직에서 CD4+ Th 세포의총절대세포수는산조인복합오일군, 독활복합오일군에서대조군에비해유의성있게 (p<0.01) 감소되었다. CD8+ c/s T 세포의총절대세포수는산조인복합오일 (ZjJ-C_oil) 은대조군에비해유의성있게 (p<0.01) 감소되었다. 7. 피부조직에서유전자발현을측정한결과, COX-2, TNF-α, TGF-β1, IL-4, IL-13 mrna 의유전자발현의상대정량값 (RQ) 은산조인복합오일군 (p<0.01), 독활복합오일군 (p<0.05) 에서대조군에비해유의성있게감소하였다. 8. 실험종료후등피부를절단하여 H&E 염색하여
21 JY Kwak et al. 367 분석한결과, 산조인복합오일 (ZjJ-C_oil), 독활복합오일 (ARC-C_oil) 은대조군에비하여상피조직의두께가현저하게줄었고, 부종이줄었다. 등피부에침윤된비만세포를관찰하기위하여 toluidine blue 염색하여분석한결과, 산조인복합오일군, 독활복합오일군은대조군에비하여비만세포가줄었다. 감사의말씀 본논문은산업통상자원부의제품개발및헬스테인먼트연동프로그램개발사업 ( 과제번호 : R ) 과웰니스스파임상지원센터구축사업 ( 과제번호 : N ) 지원비에의해수행되었습니다. Ⅵ. References 1. Journal of asthma,allergy and chinical immunology, 40 million allergies. Seoul: Medical history corporation of medical science. 2005:1-22, (Korean). 2. SP Yoon, BS Kim, JH Ree, SC Lee, YK Kim. The environment and lifestyle of atopic dermatitis patients. Korean J. Dermatol. 1999;37: (Korean). 3. HS Ahn, Hongchangui pediatrics. 9th edition. Seoul. Miraen, p.1142, 2010.(Korean). 4. HJ Lee, CY P, JH Lee, KH Lee: The Antipruritic Effect of Topical Doxepin Cream in Patients with Atopic Dermatitis, Korean journal of dermatology, 2006;44(3): JD Guin. Complications of topical hydrocortisone. J Am Acad Dematol. 4: , H Sugano. Psychology and Biology of FragranceⅠ. Chapman and Hall Okada M, Hirasawa Y, Yoshijima K et al. : Effect of clobetasol propionate, a corticosteroid on hapten-induced dermatitis in SPF NC/Nga mouse, Pharmacometrics, 59: , Lee JM. Dongeisusebowon. Seoul: Daesungmoonhwasa. 1997;1:5, 4:1,10,29-32(Korean). 9. SK Myungm, A Survey Study about Eating Habits, Living Environment and Sasang Constitution of Children with Atopic Dermatitis, The Graduate School of Education at Incheon National University, a Master s degree, 2014;1-95(Korean). 10. National College of Oriental Medicine Collaborative Textbook Compilation Committee, Herbal medicine. Seoul: YeongLimSa. 2010; 323(Korean). 11. JH Lee, JY Baek, HS Jeong, SD Park., A clinical study of Sanjoincho - induced injection on insomia patients, The Korean Society of Oriental Neuropsychiatry, 2000;11(2): SK Lee, DJ Joe, HJ Jang, K Hyun, Journal of Naturopathy, Antioxidant and Anti-inflammatory Activities of Ethanol Extracts from Aralia continentalis Kitagawa, 2015;4(1): SI Noh, SD Kim, SC Park, BY Seo, SR Yeom, YD Kwon, et al.,mechanism of Anti-inflammatory Effect of Peucedanum japonicum Thunb, Journal of Oriental Rehabilitation Medicine, 2005;15(2): Abramovits W. Atopic dermatitis. J Am Acad Dermatol. 2005;53(Suppl):S Valladeau J, Saelan S. Cutaneous dendritic cells. Semin Immunol. 2005;17: Beltrani VS. The clinical spectrum of atopic. 21(1): Richard A. Goldsby, Thomas J. Kindt, Barbara A. Osborne, Janis Kuby. KUBY Immunology 5th.. World Science,. 2006;104-5, 310, YM Park,. Advances In the Pathophysiology of Atopic Dermatitis. The Korean Academy of Pediatric Allergy and Respiratory Disease, 2006;16(3):190.(Korean). 19. Abul K. Abbas, Andrew H. Lichtman. Basic immunol-
22 368 Anti-atopic Effect of Zizyphus jujuba var. spinosa Composite oil(zjj-c_oil) and Aralia cordata var. continentalis Composite oil(arc-c_oil) in DNCB-induced Atopic Dermatitis-like Skin Lesions NC/Nga Mice ogy 3th. Epublic,. 2009; TY Kim, Therapeutic effect of IFN-γ in refractory atopic dermatitis. The Korean Dermatological Association, 2000;38(10):55.(Korean). 21. Ying, S, Taborda-Barata, L, Meng, Q, Humbert, M, Kay, AB: The kinetics of allergen-induced transcription of messenger RNA for monocyte chemotactic protein-3 and RANTES in the skin of human atopic subjects:relationship to eosinophil, T cell, and macrophage recruitment. J Exp Med, 181: , Bronte V, Wang M, Overwijk WW, et al.:apoptotic death of CD8+T lymphocytes after immunization: induction of a suppressive population of Mac-1+/Gr-1+ cells. J Immunol, 161(10): , Ryouji Yagi, Haruko Nagai, Yutaka Iigo, Toshihiro Akimoto, Takao Arai and Masato Kubo: Development of Atopic Dermatitis-Like Skin Lesions in STAT6-Deficient NC/Nga mouse. The Journal of Immunology. 168: Young MR, Wright MA, Matthews JP, Malik I, Prechel M: Suppression of T cell proliferation by tumor-induced granulocyte macrophage progenitorcells producing transforming growth factor-b and nitric oxide. J Immunol, 156(5): , Rosenwasser, L.J., Busse, W.W., Lizambri, R.G., Olejnik, T.A., Totoritis, M.C : Allergic asthma and an anti-cd23+ mab (IDEC-152): results of a phase I, single-dose, dose-escalating clinical trial. J Allergy Clin Immunnol. 112(3): Heijden FL, Joost N, Katwijk M, Bos JD, Kapsenberg ML. Serum-IgE-facilitated allergen presentation in atopic disease. J Immunol. 1993;150(8): The Korean Academy of Asthma, Allergy and Clinical Immunology. Asthma and Allergic disease. Seoul: Koonja Publshing Co. 2002: Komai-Koma, M and PC Wilkinson. TGF-beta stimulates but IFN-gamma inhibits growth-related activation of locomotion of human B cells. The Journal of Immunology, 1997;(158):
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
ÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
Jksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
< FB5B5BAF1B6F32C20B8F1C2F D34292E687770>
Case Report J Sasang Constitut Med 2014;26(4):379-388 http://dx.doi.org/10.7730/jscm.2014.26.4.379 Abstract A Case Study of Soyangin Patient with Hyperhidrosis Treated Successfully with Hyungbangsabaek-san(
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
Kaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
The clinical experience of anti-IgE antibody treatment in patients with refractory chronic urticaria
The Clinical Experience of Omalizumab Treatment In Patients with Refractory Chronic Urticaria Young-Hee Nam, 1 Joo-Hee Kim, 2 Hyun Jung Jin, 3 Eui-Kyung Hwang, 4 Yoo-Seob Shin, 4 Young-Min Ye, 4 Hae-Sim
<302DBCD3C7A5C1F62E687770>
J Korean Med Ophthalmol Otolaryngol Dermatol 2014;27(4):141-157 pissn 1738-6640 eissn 2234-4020 http://www.ood.or.kr http://dx.doi.org/10.6114/jkood.2014.27.4.141 Original Article / 원저아토피양접촉피부염유발 NC/Nga
Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
Statistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
■ 경희대학교 약사
연 혁 경희대학교 한의과대학 경희대학교 약( 略 史 ) 한의과대학 연혁 역대 한의과대학 보직교수 경희대학교 약 ( 略 史 ) 경희대학교의 연원은 1946년에 설립된 배영대학관과 1947년에 설립된 신흥전문관이 합병하여 1949년 5월에 발족한 신흥초급대학(2년제 가인가)에서 시작되었다. 그러나 이 대학은 다음해에 6.25 전쟁을 맞아 심한 운영난에 부딪혔으며
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
untitled
Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
untitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
Journal of Educational Innovation Research 2018, Vol. 28, No. 2, pp DOI: IPA * Analysis of Perc
Journal of Educational Innovation Research 2018, Vol. 28, No. 2, pp.45-72 DOI: http://dx.doi.org/10.21024/pnuedi.28.2.201806.45 IPA * Analysis of Perception and Needs on Teaching Competencies of Faculty
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
<C6EDC1FD2D32382D34C8A32DBEC8C0CCBAF1C0CEC8C4B0FAC7D0C8B8C1F62E687770>
J Korean Med Ophthalmol Otolaryngol Dermatol 2015;28(4):156-164 pissn 1738-6640 eissn 2234-4020 http://www.ood.or.kr http://dx.doi.org/10.6114/jkood.2015.28.4.156 Report Case / 중례 한양방 치료를 병행한 삼출액을 주소로
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
untitled
- 685 - - 686 - - 687 - - 688 - - 689 - - 690 - - 691 - - 692 - - 693 - 실험군 대조군 - 694 - - 695 - - 696 - 개 자연살해세포활성 실험군 대조군 실험군 - 697 - - 698 - 자연살해세포활성 실험군 군 대조군 - 699 - - 700 - - 701 - - 702 - - 703 -
- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
Jkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
<30382E20B1C7BCF8C0E720C6EDC1FD5FC3D6C1BEBABB2E687770>
정보시스템연구 제23권 제1호 한국정보시스템학회 2014년 3월, pp. 161~184 http://dx.doi.org/10.5859/kais.2014.23.1.161 베이비붐세대의 디지털라이프 지수* 1) 권순재**, 김미령*** Ⅰ. 서론 Ⅱ. 기존문헌 연구 2.1 베이비붐세대의 현황과 특성 2.2 베이비붐의 세대이 정보화 연구 Ⅲ. 연구내용 및 방법 Ⅳ.
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: * Review of Research
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.79-102 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.79 * Review of Research Trends on Curriculum for Students with Severe and multiple
untitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
, ( ) * 1) *** *** (KCGS) 2003, 2004 (CGI),. (+),.,,,.,. (endogeneity) (reverse causality),.,,,. I ( ) *. ** ***
, 40 3 4 (2006 12 ) * 1) *** *** (KCGS) 2003, 2004 (CGI),. (+),.,,,.,. (endogeneity) (reverse causality),.,,,. I. 1998. 2005 12 ( ) *. ** *** 2, 40 3 4 37.2%, 20 60%. 80%..,..,.,,, (SCB),,,.,..,, /,..
항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
도비라
광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Study on the Pe
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.405-425 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.405 * A Study on the Perceptions and Factors of Immigrant Background Youth
歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)