pissn X eissn PUBLIC HEALTH WEEKLY REPORT, PHWR Vol.11 No CONTENTS 0488 차세대염기서열분석법을이용한 A 형인플루엔자바이러스전장유전자생산 049

Transcription

1 pissn X eissn PUBLIC HEALTH WEEKLY REPORT, PHWR Vol.11 No CONTENTS 488 차세대염기서열분석법을이용한 A 형인플루엔자바이러스전장유전자생산 평창동계올림픽 패럴림픽검역대비대응 55 주요감염병통계환자감시 : 전수감시, 표본감시 병원체감시 : 인플루엔자및호흡기바이러스 급성설사질환, 엔테로바이러스 매개체감시 : 말라리아매개모기, 일본뇌염매개모기

2 주간건강과질병 제 11 권제 16 호 연구논문, Research article 차세대염기서열분석법을이용한 A 형인플루엔자바이러스전장유전자생산 질병관리본부감염병분석센터바이러스분석과김희만, 이남주, 김미선, 정윤석, 강춘 * * 교신저자 : kangchun@korea.kr, Whole genome sequencing of type A influenza virus by next-generation sequencing Kim Heui Man, Lee Namjoo, Kim Mi-Seon, Chung Yoon-Seok, Kang Chun Division of Viral Diseases, Center for Laboratory Control of Infectious Diseases, KCDC Background: Since influenza viruses are mutated frequently, the sequencing of their hemagglutinin (HA) antigen helps researchers to compare newly discovered clinical isolates with existing vaccine strains to characterize their receptor affinity and pathogenicity. Similarly, sequencing of the neuraminidase (NA) antigen is important for estimating anti-influenza drug resistance. Present condition: Traditional genetic sequencing techniques, such as the Sanger method, have has several limitations. First, sequencing of a single gene segment of a virus sample involves several laboratory steps that can cause contamination. Second, several polymerase chain reactions (PCRs) need to be performed successively due to the long length of some genes, such as the polymerase genes. Finally, in case of influenza A, frequent mutations make it necessary to redesign the primer sequences because of mismatches with the template sequence. Therefore, next-generation sequencing is employed to prevent contamination of samples and to allow whole genome sequencing regardless of mutations. Future Perspective: In this study, we performed whole-genome sequencing of influenza isolates obtained from respiratory specimens of Korean subjects and vaccine strain by multi-segment reverse transcription - PCR and NGS analyses. The continual use of NGS could produce a large amount of information for analysis of genetic characteristics of influenza strains as well as an estimation of the performance of commercial vaccine stocks. It could also be used to construct an effective diagnostic system and assess disease risks to humans by analysis of the mutations of recently evolved influenza A strains. Keywords: Whole genome sequencing, Influenza A virus, Next generation sequencing, Pathogenicity, Mutation 488

3 주간건강과질병 제 11 권제 16 호 들어가는말 인플루엔자바이러스는 A, B, C, D형으로나뉘며그중 A형과 B형은인체감염시임상증상을일으키므로 3가및 4가백신의주요항원으로사용된다 [1]. A형인플루엔자바이러스에는계절인플루엔자 A/H1N1과 A/H3N2 뿐만아니라모든조류인플루엔자가속하며변이가빈번하게발생되어여러번의대유행 (Pandemic) 을일으킨바이러스이다. A형인플루엔자는 8개의 (-)RNA 분절로이루어져있으며그중 HA와 NA 유전자는표면당단백질 (Glycoprotein) 을구성하는주요항원이다. 현재까지 HA는 1 18, NA는 1 11의아형이보고되었으며 [2] HA 단백질은바이러스가숙주세포에부착하는부위로바이러스의특성을결정하는주요항원 부위이다 [3]. NA는숙주세포내에감염된인플루엔자바이러스가밖으로나올수있도록 HA 단백질을끊어주는가위의역할을하며 [4] 인플루엔자치료제로사용되는 Oseltamivir, Zanamivir 및 Peramivir 등은이 NA의가위기능을억제시켜체내에서바이러스의증식을막는다. 그러나 NA 염기서열중 H275Y 등의변이를갖는인플루엔자바이러스는인플루엔자치료제에내성 [5] 을보이므로 NA 염기서열분석은내성주를감별하는데필수적이다. HA와 NA 염기서열뿐만아니라전장유전자분석을통하여인플루엔자의병원성 (Pathogenesis), 전파능력 (Transmissibility), 적응성 (Adaptation) 과숙주면역원성저하와관련된변이를확인함으로써신종인플루엔자발생시신속한위해도평가 (Risk assessment) 를할수있다. 기존의 Sanger sequencing 방법을통한 (a) RT-PCR method (b) M-RTPCR method Fig. 2. Schematic representation of the RT-PCR methods. Viral RNA was purified from virus particles, and the eight negative-sense vrnas were reverse transcribed with the Uni12 primer, which is complementary to the 12 conserved nucleotides at the 3 -end of the vrna (the sequence is in the box on the left; the conserved sequence at the 5 end is in the box on the right). The single-stranded DNA (ssdna) was then amplified by PCR using a primer pair complementary to the segment-specific regions. The sizes of the RNA segments range from 89 nucleotide (NS segment) to nucleotides (PB1 segment) E. Hoffmann et. al. Arch Virol. 2;146: Bin Zhou et. al. Journal of Virology. 29;83: Figure 1. Classical two step RT-PCR (a), multi-segment RT-PCR to get whole genome sequence of type A influenza (b)[7] 489

4 주간건강과질병 제 11 권제 16 호 Table 1. Primers used for multi-segment RT-PCR[7] Primers Sequence (5 3 ) Uni12/Inf-1 Uni12/Inf-3 Uni13/Inf-1 GGGGGGAGCAAAAGCAGG GGGGGGAGCGAAAGCAGG CGGGTTATTAGTAGAAACAAGG Ref. Bin Zhou et al., 214. Table 2. Amplification condition for multi-segment RT-PCR[7] Steps Temperature Time Cycles cdna synthesis 42 6 min 1 cycle Activate the enzyme 94 2 min Denature 94 2 sec 5 cycle Anneal and extend 44 3 sec Extension 68 3 min Denature 94 3 sec 31 cycle Anneal and extend 57 3 sec Extension 68 7 min Final extension 68 7 min 1 Cycle 4 Hold 인플루엔자유전자분석은역전사 (Reverse transcription) 로 cdna를합성하고 8개의 RNA 분절에대한각각의특이프라이머로 PCR을수행해야한다. 또한 DNA 산물을정제한후 sequencing을위한 PCR 반응을다시수행해야한다 [6]. 따라서 Polymerase(PB2, PB1, PA) 와같이상대적으로길이가긴유전자의경우분절로나누어서 PCR을해야하는번거로움이있다. 더욱이 A형인플루엔자는변이가빈번하기때문에프라이머에 mismatch가있는경우이를다시디자인해야하는번거로움도있다. 이글에서는차세대염기서열분석법 (Next generation sequencing, NGS) 을이용하여 29년인플루엔자대유행의원인바이러스인국내분리주 A/Korea/1/29(H1N1) 와 절기 A형인플루엔자 H3N2 북반구백신주인 A/Switzerland/ /213 에대한전장유전자를생산하기위한최적의 NGS 실험방법을확립하였다. 뿐만아니라호흡기검체에서직접 NGS법을적용하여전장유전자를확인하고각유전자분절의변이에대한의미를해석하였으며, NA 유전자의 Quasispecies sequencing을통하여 H275Y 변이에의한인플루엔자치료제내성을분석하였다. Figure 2. Genomic amplification of type A influenza using multi-segment RT-PCR 49

5 주간건강과질병 제 11 권제 16 호 A. Library Preparation B. Cluster Amplification C. Sequencing D. Alignment and Data Anaylsis Figure 3. Next generation sequencing chemistry overview A. Library preparation - Nextra R XT DNA Library kit를사용하여 Multi-segment RT-PCR법으로생산된유전자산물을단일가닥의 DNA로만든후조각을내고말단에 double stranded linker(adapter) 를붙임. B. Cluster amplification - Flow cell 바닥에는 adapter 서열에상보적인 DNA가고정되어있으므로 adapter가붙어있는 library는 flow cell에부착됨. PCR 과정을통하여단일가닥의 library를주형으로이중의 DNA를얻음. 주형으로사용된 library는제거되고복제된단일가닥 DNA는 flow cell의 adapter와결합되어 bridge를형성함. PCR 과정을통하여이단일가닥의 DNA를주형으로이중가닥의 DNA가증폭되며이러한과정이반복되어 clonal cluster를생성함. C. Sequencing - 이중가닥의 DNA 중한쪽가닥을이용하여염기의종류에따라각각다른빛을내는형광물질이결합된 dntp를사용하여 DNA polymerase에의해한염기씩합성될때마다형광물질을분석하여염기서열을생산함. D. Alignment and data analysis - Library에따라생성된수많은염기서열 (Reads) 은 bio-informatics software(clc workbench 등 ) 를이용하여 reference 염기서열을기준으로 alignment 를수행하여최종유전자정보를생산함

6 주간건강과질병 제 11 권제 16 호 Table 3. Alignment metrics Virus A/Korea/1/29 (H1N1) A/Switzerland/ /213 (H3N2) Gene segment Reference length (bps) Mapped reads Average coverage % GC Consensus length (bps) PB2 2,28 169,537 11, ,28 PB1 2, ,211 8, ,274 PA 2, ,465 8, ,151 HA 1,71 251,16 23, ,71 NP 1, ,175 45, ,497 NA 1,41 293,11 34, ,41 MP ,46 16, NS ,84 13, PB2 2,28 172,828 12, ,28 PB1 2, ,969 12, ,274 PA 2, ,452 9, ,151 HA 1,71 423,59 41, ,71 NP 1, ,293 38, ,497 NA 1,41 62,72 72, ,41 MP 983 1,336, , NS 838 4,896 8, %GC: GC ratio 1: 24 ng/ μl, 2: 12 ng/ μl, 3: 6 ng/ μl, 4: 3 ng/ μl, 5: 15 ng/ μl, 6: 7.5 ng/ μl, 7: 3.75 ng/ μl, 8: ng/ μl, 9: 1 ng/ μl, 1: 1 pg/ μl, 11: 1 pg/ μl, 12: 1 pg/ μl, 13: 1 fg/ μl, 14: 1 fg/ μl, 15: 1 fg/ μl Figure 4. Detection limit of RNA concentration for next generation sequencing 492

7 주간건강과질병 제 11 권제 16 호 input RNA (ng) vs Ct value Ct : Ct value input RNA (ng) Figure 5. Detection limit of Ct value for next generation sequencing Table 4. Genomic variation between vaccine strains and viruses in respiratory specimens Virus Sample PB2 PB1 PA HA NP NA MP NS A/H1N1 Respiratory specimen Respiratory specimen Respiratory specimen A/H3N2 Respiratory specimen Respiratory specimen Respiratory specimen Respiratory specimen 몸말 기존 Sanger sequencing 방법보다신속하게인플루엔자바이러스의전장유전자정보를생산하기위하여 Multi-segment RT-PCR법 [7] 과 NGS 방법을활용하였다. Sanger sequencing 방법에서는 E. Hoffman 등이제시하였던 RNA 3 말단에상보적인프라이머 (U12) 를이용하여역전사효소 (Reverse transcriptase) 로 cdna를합성하고, 각유전자분절에특이적프라이머를이용하는 RT-PCR 방법으로각각의 8개유전자를합성하였다 (Figure 1A). 반면 Bin Zhou 등 [7] 에의해제시된 Multi-segment RT-PCR법은인플루엔자바이러스 RNA의 3 및 5 말단부의프로모터부위에보존적인염기서열을이용하여단한번의 RT-PCR과정으로 8개분절에대한유전자의증폭이가능하며유전자산물을이용하여 Reverse genetics 에도활용이가능하도록고안하였다 (Figure 1B). 이연구에서는 Bin Zhou 등 [7] 이보고한 universal 프라이머 (U12, U13) 를이용하였으며, Multi-segment RT-PCR 법을통해바이러스국내분리주인 A/Korea/1/29(H1N1) 와 절기백신주인 A/Switzerland/ /213 H3N2를사용하여전장유전자생산방법을확립하였다 (Table 1,2). Multi-segment RT-PCR 산물을전기영동한결과 A형인플루엔자바이러스의 8종유전자 (PB2, PB1, PA, NP, HA, NA, M, NS) 로예상되는유전자산물을확인할수있었다 (Figure 2). Multi-segment RT-PCR법을통해생산된유전자산물은 Miseq(Illumina Inc.) 장비로 library preparation, cluster generation, sequencing 및 data analysis 단계를거쳐 A형인플루엔자에대한전장유전자정보를생산하였다 (Figure 3). Miseq를활용한 NGS 수행결과 A형인플루엔자바이러스의전장유전자에대한유전정보가생산되었다. 각바이러스당 493

8 주간건강과질병 제 11 권제 16 호 Table 5. Interpretation of genomic variation of influenza A/H1N1 Query Mutation Structural interaction(s) PB2 P453T Viral oligomerization interfaces, binding small ligand(s) PA T618K Binding other viral protein(s) HA S91R Viral oligomerization interfaces, binding small ligand(s), antibody recognition sites K226N I312V I341T E373K Viral oligomerization interfaces, antibody recognition sites Binding small ligand(s) Viral oligomerization interfaces, binding small ligand(s) Viral oligomerization interfaces, antibody recognition sites, binding small ligand(s) NA N28X Binding small ligand(s) S7N Viral oligomerization interfaces, creates a new potential N-glycosylation site at position 7 I18L I188T L412Q N449D Viral oligomerization interfaces, binding small ligand(s) Viral oligomerization interfaces Viral oligomerization interfaces, binding small ligand(s) Viral oligomerization interfaces, binding host protein(s), binding small ligand(s) MP S23N Viral oligomerization interfaces, binding small ligand(s) I28T Viral oligomerization interfaces, binding small ligand(s) NS M65V Viral oligomerization interfaces I111V E153G I156K V157A L163V Viral oligomerization interfaces Binding small ligand(s), viral oligomerization interfaces, binding host protein(s) Binding small ligand(s), viral oligomerization interfaces Binding small ligand(s), viral oligomerization interfaces Viral oligomerization interfaces 평균적으로 3만리드를생산하였으며, 생산된데이터중 9.1% 의데이터가 Q3(Q-score 3, base calling 정확도가 99.9%) 으로확인되었으며각시료당평균 4, 적용범위의데이터가생산되었다 (Table 3). 전장유전자분석을위한바이러스의최소농도를확인하기위하여국내분리주 (A/Korea/1/29) 에서 RNA를추출한후 2진및 1진으로희석하여단계별로 Multi-segment RT-PCR법을수행한결과 1 pg/ μl의 RNA 농도까지 NGS 분석이가능한농도를확인하였다 (Figure 4). Real-time RT-PCR을이용한 A형인플루엔자진단법에서 NGS 분석이가능한최소 Ct(Threshold cycle) 값을확인하기위하여국내분리주 (A/Korea/1/29) 에서 RNA를추출한후 494

9 주간건강과질병 제 11 권제 16 호 Table 6. Interpretation of genomic variation of influenza A/H3N2 Query Mutation Structural interaction(s) PB2 K34R Viral oligomerization interfaces PA F15Y Binding small ligand(s), viral oligomerization interfaces K158R Viral oligomerization interfaces E165D Viral oligomerization interfaces H713Q Binding other viral protein(s) HA E78G Viral oligomerization interfaces, binding small ligand(s) K18R Viral oligomerization interfaces, binding small ligand(s), antibody recognition sites T151K Binding small ligand(s), antibody recognition sites, viral oligomerization interfaces, removes a potential N-glycosylation site at position 149 K176T Binding small ligand(s), antibody recognition sites, viral oligomerization interfaces, creates a new potential N-glycosylation site at position 174 P21L Host cell receptor binding, binding small ligand(s), antibody recognition sites, a T-cell epitope presented by MHC molecules T219X Viral oligomerization interfaces, binding small ligand(s) H327Q Viral oligomerization interfaces, binding small ligand(s), a T-cell epitope presented by MHC molecules, binding host protein(s) E495G Binding small ligand(s), viral oligomerization interfaces, antibody recognition sites NA R6K Binding small ligand(s), viral oligomerization interfaces P126L Viral oligomerization interfaces, binding small ligand(s) I212V Viral oligomerization interfaces K22N Binding small ligand(s), viral oligomerization interfaces, antibody recognition sites N329S Antibody recognition sites, binding small ligand(s), viral oligomerization interfaces, removes a potential N-glycosylation site at position 329 1진희석하여농도별로 Real-time RT-PCR을수행한결과대략 32 Ct 값에서 1 pg/ μl의 RNA 농도가확인되었으므로 32 이하의 Ct 값을갖는호흡기검체에서도 NGS를이용한분석이가능할것으로판단되었다 (Figure 5) 절기 A/H1N1과 A/H3N2로진단된호흡기검체중 Ct 값 32 이하검체로부터 NGS법으로 2만 ~3만리드가생산되었으며전장유전자를확보하였다 절기백신주대비변이분석을수행한결과유전자별로변이가 495

10 주간건강과질병 제 11 권제 16 호 확인되었다 (Table 4). 각유전자분절의변이는 FluSurver( 를이용하여현재까지밝혀진변이에의한기능적분석을수행할수있다 (Table 5, 6). 또한 NA의유전자에대하여 Quasispecies sequence 분석을수행한결과, H1N1과 H3N2의호흡기검체에서생산된 NA 유전자에는치료제내성에관여하는 H275Y 변이가확인되지않았다. 맺는말 이연구를통하여 A 형인플루엔자바이러스유전자말단에 viruses. PLoS pathogens. 213;9(1);e Steinhauer, David A. Role of hemagglutinin cleavage for the pathogenicity of influenza virus. Virology. 1999;258(1): Nayak, Debi P., Eric Ka-Wai Hui, and Subrata Barman. Assembly and budding of influenza virus. Virus research. 24:16(2): Hurt, Aeron C., Hui-Ting Ho, and Ian Barr. Resistance to antiinfluenza drugs: adamantanes and neuraminidase inhibitors. Expert review of anti-infective therapy. 26;4(5): Hoffmann, E., et al. Universal primer set for the full-length amplification of all influenza A viruses. Archives of virology. 21;146(12): Zhou, Bin, et al. Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and Swine origin human influenza a viruses. Journal of virology. 29;83(19): universal 프라이머 (U12, U13) 를이용한 Multi-segment RT- PCR법으로단일 PCR 반응에서인플루엔자바이러스의 8개분절에대한전장유전자정보를확보하였다. 뿐만아니라국내분리주와백신주에대한전장염기서열을생산함으로써, 차세대염기서열분석법을활용할경우, 기존의 Sanger sequencing 방식보다간단하고신속하게전장유전자분석이가능함을확인하였다. 따라서차세대염기서열분석법을지속적으로활용한다면국내인플루엔자분리주의유전적특성을분석하고백신주와의상동성을분석할수있는대량의유전자정보를생산할수있을것이다. 또한신종인플루엔자발생시유전적특성을신속하게분석함으로써효율적인진단체계구축및변이분석을통한인체위해도평가에활용할수있을것이다. 이원고는질병관리본부연구과제 (214-NI431-) 와질병조사관리및실험실감시망운영 ( ) 지원으로수행된내용입니다. 참고문헌 1. Influenza (Seasonal) Fact sheet N 211". March 214. Archived from the original on 3 November 214. Retrieved 25 November Tong, Suxiang, et al. New world bats harbor diverse influenza A 496

11 주간건강과질병 제 11 권제 16 호 연구단신, Brief report 218 평창동계올림픽 패럴림픽검역대비대응 질병관리본부감염병관리센터검역지원과황지혜, 손태종, 박기준 * * 교신저자 : gj6223@korea.kr, Quarantine Preparedness & Responses to 218 Pyeongchang Winter Olympics and Paralympics Games Hwang Ji-Hye, Son Tae-Jong, Park Gi-Jun Division of Quarantine Support, Center for Control of Infectious Diseases, KCDC For the 218 Pyeongchang Winter Olympics and Paralympics Games in Korea from February 9 through March 18, we prepared possible quarantine countermeasures about 6 months prior to the competition in order to prevent the inflow of emerging infectious disease and to respond promptly to the suspected cases with infectious disease in collaboration with relevant institutions for training of quarantine officers, and on-site inspection of quarantine stations. During the two international events, the national quarantine stations performed quarantine inspection for a total of 5,53 passengers from 14 countries: 4,725 persons from quarantinable disease risk areas, 75 persons from the DPRK, 28 transit passengers from overseas. Among them, although 184 entrants with symptoms such as fever and diarrhea were detected, including 6 athletes for Olympics and Paralympics, there were no suspected cases of quarantinable diseases. To protect the public s health from emerging infectious diseases, the Korea Centers for Disease Control is striving for establishing more efficient and advanced quarantine system to enable prompt quarantine response to international events at the point of entry to Korea. Keywords: 218 Pyeongchang Winter Olympics, Paralympics, Quarantine, Emerging infectious disease 들어가는말 1988 년서울하계올림픽이후 3 년만에겨울종합스포츠 대회인동계올림픽및패럴림픽대회가올해우리나라에서개최됨에 따라동계올림픽 92 개국, 패럴림픽 5 개국의선수단및응원단등 관계자들이우리나라를방문함으로써해외감염병국내유입 확산 497

12 주간건강과질병 제 11 권제 16 호 Table 1. Quarantine responses for the 218 Pyeongchang Winter Olympics and Paralympics Period Action items Cooperation institutions Six months before the Olympics - Establish action plans for quarantine response - Request entry information of entrants - National Quarantine Stations - Olympics Organizing Committee Three months before the Olympics - Develop of Information on quarantine for entrants - Notify any changes to quarantinable diseases risk areas - Olympics Organizing Committee One month before the Olympics - Development of a Quarantine Response Manual - Establish action plans for quarantine response for DPRK entrants - Conduct training for quarantine response - Conduct site inspections at the National Quarantine Stations - Production and distribution of banners and other informative materials - Establish a coordination system with related organizations (CIQ, etc.) - National Quarantine Stations - Immigration Office, Customs of major airports, Public health centers, etc. Two s before the Olympics / During the Olympics and Paralympics - Establish quarantine plans for transfer passengers - Consult with related organizations to implement quarantine measures for transit passengers - Conduct on-site training for suspected Emerging infectious disease patients - Strengthen quarantine capacity for athletes and Olympic staff and keep the public updated - Ready teams(the National Quarantine Station officers) on standby to perform emergency work when needed - Conduct daily quarantine reports - Conduct monitoring of symptomatic athletes during quarantine process - Incheon International Airport Corporation - Korean Air - National Quarantine stations - Donghae National Quarantine station - Olympics Organizing Committee 방지를위한감염병관리가필요할것으로예상되었다. 전세계적으로중동호흡기증후군 (Middle East respiratory syndrome, MERS), 조류인플루엔자인체감염증 (Avian Influenza virus to human infection, AI) 등신 변종감염병이지속적으로출현하고있으며교통 통신의발달과세계화로인해해외감염병의국내유입우려가높아짐에따라출입국단계에서의검역에대한관심과중요성이대두되고있다. 이에질병관리본부검역지원과와 13개국립검역소는평창동계올림픽및패럴림픽대회전부터검역대응계획을수립하여해외감염병국내유입을조기에차단하고, 감염병의심환자발생시신속한대응을통해성공적인대회개최에기여하고자하였다. 이논고를통해 218 평창동계올림픽및 몸말 질병관리본부는평창동계올림픽및패럴림픽참가자중검역감염병오염지역입국자에대한검역을강화하고자대회전부터검역대응계획을수립하고, 해외유입감염병관리를위한검역관대상의교육 훈련, 감염병예방주의안내홍보및유관기관협조체계구축등을통해검역대응을준비하였다. 국립검역소는평창동계올림픽 패럴림픽기간중선수단등관계자 5,53명에대한검역을실시하였다. 그중발열, 설사등단순유증상자가 184명이있었으나감염병의심환자로분류되지않아특이사항없이입국자검역을성공적으로완료하였다. 패럴림픽검역대응준비과정과입국자검역현황, 유증상자조치등의 검역대응결과를공유함으로써향후국내에서개최되는다양한 국제행사의검역관리 대응에활용하고자한다

13 주간건강과질병 제 11 권제 16 호 In relation to the PyeongChang 218 Olympic and Paralympic Winter Games Information on Quarantine for Entrants The National Quarantine Station of Korea Centers for Disease Control & Prevention is conducting quarantine activities on all entrants into the country in order to block the importation of infectious diseases from overseas. First, to ensure swift quarantine processing for entrants, each country must submit a list of athletes participating in the PyeongChang 218 Olympic and Paralympic Winter Games in advance through the Olympic Organizing Committee. All entrants to the Republic of Korea shall be checked for fever using thermal cameras and, in particular, for those from countries where MERS is widespread, an individual body temperature assessment will be measured. In addition, entrants from countries where the six infectious diseases (cholera, yellow fever, plague, MERS, AI, polio) designated as infectious diseases subject to quarantine in Korea must accurately fill out a Health Questionnaire and submit it to quarantine officers upon entry. Entrants who are experiencing such symptoms as fever and coughing at the time of quarantine may be transported to a designated hospital during the quarantine inspection and receive treatment in isolation. Your patience with this inconvenience and cooperation with the quarantine procedures of the Republic of Korea is requested. * For a list of countries with infectious diseases subject to quarantine and details of the Health Questionnaire, please refer to the Attachments. Figure 1. Information on Quarantine for Entrants 각국체육회에배포하는 PyeongChang 218 Olympic Games Health Care Guide 에국내검역절차안내문을게재하여검역감염병오염지역선수단등관계자와모든입국자에게입국전우리나라검역절차를인지할수있도록하였다 (Figure 1). 또한, 218년 1월 1일에검역감염병오염지역이변경 (62개국 59개국) 됨에따라조직위원회에변경사항을안내하였다. ( 다 ) 대회 1개월전 : 매뉴얼개발, 교육 훈련실시, 검역소시설 장비점검, 홍보실시검역관이효율적인검역업무를수행할수있도록평창동계올림픽 패럴림픽입국자검역절차를수록한 218 평창동계올림픽 패럴림픽감염병검역대응세부매뉴얼 을개발하였다. 아울러검역소별매뉴얼자체교육, 생물테러대응훈련등을통해올림픽대비검역관들의대응역량을강화하였다. 평창동계올림픽및패럴림픽관련입국자들이주로이용예정인 1) 대회전검역대응준비 공항의검역관련장비와진단실험실, 격리시설 ( 실 ) 등의장비 및시설을점검하였으며, 건강상태질문서제출안내및감염병 ( 가 ) 대회 6개월전 : 검역계획수립및조직위원회와협조체계구축질병관리본부는평창동계올림픽및패럴림픽참가국선수단등입국자검역을위해 217년 7월부터검역대응계획을수립하였다. 또한, 평창동계올림픽및패럴림픽선수단등관계자중검역단계의심환자발생시검역, 역학조사, 정보공유, 이송등신속하고원활한검역업무수행을위해세관, 출입국사무소, 조직위원회 증상시신고안내등의배너를제작 설치하고입국자들에게감염병예방 주의 신고관련홍보를지속실시하였다. 또한, 북한에서선수단이대회에참가하고예술단및응원단의파견에대한논의가있음에따라북한으로부터의국내입경자에대한입경경로별검역계획을마련하였으며, 주요입경예정경로인도라산및고성남북출입사무소의발열감시카메라등의검역장비, 격리실, 감염병예방주의안내홍보물품등을점검하였다. 등유관기관과의지속적인업무협의를실시하여협조체계를 구축하였다. 그중검역강화를위한검역감염병오염지역선수단등관계자의개별입국정보사전제공, 검역단계유증상자발생시신속한정보공유및입국후건강상태모니터링등을위해대회 6개월이전부터조직위원회와협조체계를구축하여감염병확산예방을위해노력하였다. ( 라 ) 대회 2주전 ~ 대회기간중 : 감염병대응현장훈련실시, 입국자검역실시질병관리본부는인천공항의구조상입국자중환승객일부가인천공항입국장에서검역조치를받지않고환승통로를이용하여국내도착지 ( 양양공항 ) 까지이동할수있는검역사각지대 (4곳) 를 확인하였다. 이에인천국제공항공사및올림픽기간동안국내 ( 나 ) 대회 3 개월전 : 국내검역절차안내문개발, 검역 감염병오염지역안내 질병관리본부는조직위원회에서참가국대상으로올림픽전에 환승기 ( 인천 양양 ) 를운영하는 ( 주 ) 대한항공과지속적으로 업무협의를실시하여인천공항환승기게이트내발열감시카메라를 설치하였고, 환승기내에서승무원이건강상태질문서작성안내및 499

14 주간건강과질병 제 11 권제 16 호 Figure 2. Banners for entrants and transit passengers 수거등을통해효율적인검역관리를할수있도록조치하였다. 또한, 올림픽개막식 2주전에는올림픽개최도시강원도내국제공항인양양공항에서 AI인체감염증의심환자의입국상황을대비한현장훈련을실시함으로써검역관리, 절차를점검하여선제적으로검역대응을준비하였다 (Figure 3). 상시협조체계를운영하여선수단중유증상자발생시입국후건강상태모니터링을실시하였다. 또한, 감염병의심환자발생등의비상시를대비하여 평창올림픽및패럴림픽감염병대책본부검역팀 ( 검역지원과 ) 과국립검역소는 218년 2월 1일부터비상근무및검역일일상황보고를실시하였다. 올림픽개최전인 218 년 1 월 21 일부터검역감염병오염지역 선수단등관계자들의입국자검역및강화하였으며, 조직위원회와 5

15 주간건강과질병 제 11 권제 16 호 Figure 3. Field training against novel infectious diseases at YangYang International Airport (January 25, 218) 2) 입국자검역조치 실시하였다. ( 가 ) 검역감염병오염지역입국자국제올림픽위원회 (International Olympic Committee, IOC) 는선수단개인정보노출등의우려로선수단개별입국정보제공을승인하지않아조직위원회로부터선수단의일부입국정보 ( 소속, 도착시간, 편명 ) 만제공받았다. 그러므로, 중국등입국자가많은직항노선의경우선수단이탑승한항공기의탑승객전수게이트검역을실시하였으며, 제3국을경유하여입국한검역감염병오염지역선수단등관계자는검역정보시스템을활용하여 ( 다 ) 국내환승객이번대회기간동안해외에서입국한외국인환승객중인천공항에서양양공항으로가는국내환승객을대상으로인천공항환승기게이트에서발열감시를실시하였다. 또한, 오염지역입국자여부와상관없이기내에서모든환승객을대상으로건강상태질문서를배포하고작성안내후승무원이일괄수거하여검역관에게제출하도록하였으며, 양양공항검역심사대에서환승객발열감시를추가로실시하였다. 타깃 (target) 검역 1) 을실시하였다. ( 나 ) 북한선수단등관계자북한은현재검역감염병비오염지역이지만, 이번올림픽기간에는검역조치를강화하여선박 ( 만경봉 92호 ) 의경우검역관이직접선박에승선하여승객 승무원 (21명) 발열감시및식품보관상태, 감염병매개체서식유무와번식상태조사등선박보건위생관리를 3) 검역조치결과 평창동계올림픽참가 92개국 6,5여명과패럴림픽참가 5개국 1,5여명중검역감염병오염지역은올림픽참가국중 13개국, 패럴림픽참가국중 3개국이었다. 218년 1월 21일부터 1) 감염병유행국가 ( 오염지역포함 ) 입국자명단을검역정보시스템으로사전에파악하여항공기가도착하는주기장게이트에서해당입국자대상발열감시및개별체온측정, 건강상 태질문서를징구하는검역조치방법 51

16 주간건강과질병 제 11 권제 16 호 Table 2. Entry quarantine status during the 218 Pyeongchang Winter Olympics and Paralympics, Jan. 21-Mar. 18 Unit: person, (%) No. of quarantine targets for the Olympics No. of quarantine targets for the Paralympics Total Subtotal Quarantinable disease risk areas DPRK Transit passengers Subtotal Quarantinable disease risk areas DPRK Transit passengers 5,53 4,69 (1.%) 3,94 (84.%) 722 (15.4%) 28 (.6%) 813 (1.%) 785 (96.6%) 28 (3.4%) (.%) DPRK: Democratic People s Republic of Korea Table 3. Status of people with symptoms during the entry into the 218 Pyeongchang Winter Olympics and Paralympics, Jan. 21-Mar. 18 Unit: person, (%) No. of people with symptoms for the Olympics No. of people with symptoms for the Paralympics Total (No. of athletes) Subtotal (No. of athletes) Quarantinable disease risk areas (No. of athletes) DPRK (No. of athletes) Transit passengers (No. of athletes) Subtotal (No. of athletes) Quarantinable disease risk areas (No. of athletes) DPRK (No. of athletes) Transit passengers (No. of athletes) 184 (6) 171 (5) 171 (5) () () 13 (1) 13 (1) () () DPRK: Democratic People s Republic of Korea 3월 18일까지 57일동안조직위원회에서사전입국정보를제공한검역감염병오염지역선수단및북한선수단등관계자, 그리고국내환승객 ( 외국인 ) 을포함하여총 5,53명에대한검역을실시하였다. 5,53명중검역감염병오염지역검역인원은 4,725명이며 유증상자의국내입국후에는질병관리본부와조직위원회의상황정보공유등의유기적협조를통하여해당자에대한건강상태를모니터링하였으며선수단등관계자 6명모두증상이소실되어건강상태가양호한것으로확인하였다 (Table 3). 건강상태질문서징구율 2) 은 99.5% 이었다. 북한과관련된검역 인원은총 75명이며이중선수단, 예술단, 응원단등북한관계자가 63명이었고, 남한관계자는 12명이었다. 남한관계자의경우북한선수단등관계자출경시차량지원등으로인해검역을받은사례이다. 그리고인천공항에서양양공항으로국내환승기를이용한환승객 28명에대해서도검역을완료하였다 (Table 2). 올림픽및패럴림픽관련검역인원 5,53명중발열, 설사등유증상자로확인된입국자는총 184명 (3.3%) 이며, 그중선수단등관계자가 6명 (3.3%), 중국등직항노선탑승객 ( 일반승객 ) 이 178명 (96.7%) 이었다. 선수단 6명은보건교육및선수촌내폴리클리닉진료안내후질병관리본부긴급상황실을통해조직위원회로해당유증상자의인적사항, 증상등을통보하였다. 맺는말 질병관리본부는평창동계올림픽및패럴림픽대회 6개월이전부터입국자검역계획을사전에수립하고유관기관과협력체계를구축하는등철저한대응준비와입국자검역강화조치를통해검역단계에서해외감염병환자가단한명도발생하지않음으로써성공적인대회가이루어질수있도록기여하였다. 향후질병관리본부는국제행사개최시지금보다체계적인입국자검역관리를수행하기위해 국제행사검역관리매뉴얼 을마련하여행사 ( 대회 ) 전부터유관기관과정보공유및협조체계를더욱더 2) 건강상태질문서제출대상이아닌국내미입국승무원과국내외환승객 539 명제외 52

17 주간건강과질병 제 11 권제 16 호 강화할수있도록할것이다. 또한, 참가국입국자대상으로는국내검역절차를사전에인지할수있도록하고, 유증상자발생시주최기관과협력하여신속한대응및건강상태모니터링수행으로해외유입감염병의확산을조기에차단하는등선제적인검역관리조치를수행할것이다. 앞으로도질병관리본부와 13개국립검역소는효율적이고선진화된검역체계를구축 운영함으로서해외감염병으로부터국민의건강과생명을지켜내고자최선을다할것이다. 참고문헌 1. 질병관리본부. 218 검역업무지침 질병관리본부. 218 평창올림픽 패럴림픽감염병검역대응세부매뉴얼 질병관리본부. 평창올림픽감염병대응종합계획 질병관리본부. 해외감염병검역대응표준매뉴얼

18 54

19 주요감염병통계, Statistics of selected infectious diseases 1.1 환자감시 : 전수감시감염병주간발생현황 (15th Week) Table 1. Reported cases of national infectious diseases in Republic of Korea, ending April 14, 218 (15th Week)* Category Ⅰ Category Ⅱ Category Ⅲ Category Ⅳ Classification of disease 218 ly average 55 Total no. of cases by year Cholera Typhoid fever Paratyphoid fever Shigellosis Imported cases of current : Country (no. of cases) EHEC Vietnam(1), China(1) Viral hepatitis A ,419 4,679 1,84 1, Pertussis Tetanus Measles Mumps 511 4, ,924 17,57 23,448 25,286 17,24 Rubella Viral hepatitis B (Acute) Japanese encephalitis Varicella 1,521 18, ,92 54,6 46,33 44,45 37,361 Streptococcus pneumoniae Philippines(1) Malaria Scarlet fever 478 6, ,838 11,911 7,2 5,89 3,678 Meningococcal meningitis Legionellosis Vibrio vulnificus sepsis Murine typhus Swaziland(1) Scrub typhus ,528 11,15 9,513 8,13 1,365 Leptospirosis Brucellosis Rabies HFRS Syphilis ,148 1,569 1,6 1, CJD/vCJD Tuberculosis 626 8, ,161 3,892 32,181 34,869 36,89 HIV/AIDS ,5 1,62 1,18 1,81 1,13 Viral hepatitis C 221 3,37-6, VRSA CRE 212 2,922-5, Dengue fever Vietnam(2), Philippines(2), Malaysia(1), Myanmar(1), Indonesia(1), Thailand(1) Q fever West Nile fever Lyme Borreliosis Melioidosis Chikungunya fever Malaysia(1), Philippines(1) SFTS MERS Zika virus infection Unit: No. of cases Abbreviation: EHEC= Enterohemorrhagic Escherichia coli, HFRS= Hemorrhagic fever with renal syndrome, CJD/vCJD= Creutzfeldt-Jacob Disease / variant Creutzfeldt-Jacob Disease, VRSA= Vancomycin-resistant Staphylococcus aureus, CRE= Carbapenem-resistant Enterobacteriaceae, SFTS= Severe fever with thrombocytopenia syndrome, MERS-CoV= Middle East Respiratory Syndrome Coronavirus. Cum: Cumulative counts from 1st to current in a year. * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. The reported surveillance data excluded Hansen s disease and no incidence data such as Diphtheria, Poliomyelitis, Haemophilus influenzae type b, Epidemic typhus, Anthrax, Plague, Yellow fever, Viral hemorrhagic fever, Smallpox, Severe Acute Respiratory Syndrome, Animal influenza infection in humans, Novel Influenza, Tularemia, Newly emerging infectious disease syndrome and Tick-borne Encephalitis. Data on scarlet fever included both cases of confirmed and suspected since September 27, 212. 문의 : (43)

20 Table 2. Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Diseases of Category Ⅰ Unit: No. of cases Reporting area Cholera Typhoid fever Paratyphoid fever Shigellosis Overall Seoul Busan Daegu Incheon Gwangju Daejeon Ulsan 5 Sejong 2 2 Gyonggi Gangwon 9 3 Chungbuk Chungnam Jeonbuk Jeonnam Gyeongbuk Gyeongnam Jeju 1 Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years. 56

21 Table 2. (Continued) Reported cases of infectious diseases by geography, s ending April 14, 218 (15th Week)* Unit: No. of cases Diseases of Category Ⅰ Diseases of Category Ⅱ Reporting area Enterohemorrhagic Escherichia coli 218 Viral hepatitis A Pertussis Tetanus Overall Seoul Busan Daegu Incheon Gwangju Daejeon Ulsan Sejong Gyonggi Gangwon Chungbuk Chungnam Jeonbuk Jeonnam Gyeongbuk Gyeongnam Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years. 57

22 Table 2. (Continued) Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Diseases of Category Ⅱ Unit: No. of cases Reporting area Measles Mumps Rubella Viral hepatitis B (Acute) 218 Overall ,33 4, Seoul Busan Daegu Incheon Gwangju Daejeon Ulsan Sejong Gyonggi , Gangwon Chungbuk Chungnam Jeonbuk Jeonnam Gyeongbuk Gyeongnam Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years. 58

23 Table 2. (Continued) Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Unit: No. of cases Diseases of Category Ⅱ Diseases of Category Ⅲ Reporting area Japanese encephalitis Varicella Malaria Scarlet fever Overall 1,521 18,11 12, ,271 2,637 Seoul 172 2,31 1, , Busan Daegu Incheon Gwangju Daejeon Ulsan Sejong Gyonggi 417 4,887 3, , Gangwon Chungbuk Chungnam Jeonbuk Jeonnam Gyeongbuk Gyeongnam 115 1, Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years. 59

24 Table 2. (Continued) Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Diseases of Category Ⅲ Unit: No. of cases Reporting area Meningococcal meningitis Legionellosis Vibrio vulnificus sepsis Murine typhus Overall Seoul Busan Daegu 4 1 Incheon Gwangju Daejeon 2 Ulsan 2 1 Sejong Gyonggi Gangwon 1 1 Chungbuk 2 Chungnam Jeonbuk 2 1 Jeonnam 1 Gyeongbuk 14 1 Gyeongnam Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years. 51

25 Table 2. (Continued) Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Diseases of Category Ⅲ Unit: No. of cases Reporting area Scrub typhus Leptospirosis Brucellosis Hemorrhagic fever with renal syndrome 218 Overall Seoul Busan Daegu Incheon Gwangju Daejeon Ulsan Sejong 1 Gyonggi Gangwon Chungbuk Chungnam Jeonbuk Jeonnam Gyeongbuk Gyeongnam Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years

26 Table 2. (Continued) Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Unit: No. of cases Diseases of Category Ⅲ Diseases of Category Ⅳ Reporting area Syphilis CJD/vCJD Tuberculosis Dengue fever Overall ,441 9, Seoul ,446 1, Busan Daegu Incheon Gwangju Daejeon Ulsan Sejong Gyonggi ,846 1, Gangwon Chungbuk Chungnam Jeonbuk Jeonnam Gyeongbuk Gyeongnam Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years

27 Table 2. (Continued) Reported cases of infectious diseases by geography, ending April 14, 218 (15th Week)* Diseases of Category Ⅳ Unit: No. of cases Reporting area Q fever Lyme Borreliosis SFTS Zika virus infection year year Overall Seoul Busan Daegu Incheon Gwangju 4 - Daejeon 4 - Ulsan Sejong 5 - Gyonggi Gangwon 1 - Chungbuk Chungnam Jeonbuk Jeonnam 1 - Gyeongbuk Gyeongnam Jeju Cum: Cumulative counts from 1st to current in a year * The reported data for year 217, 218 are provisional but the data from 213 to 216 are finalized data. According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years

28 1.2 환자감시 : 표본감시감염병주간발생현황 (15th ) 1. Influenza, Republic of Korea, s ending April 14, 218 (15th ) 218 년도제 15 주인플루엔자표본감시 ( 전국 2 개표본감시기관 ) 결과, 의사환자분율은외래환자 1, 명당 6.8 명으로지난주 (6.2 명 ) 대비증가 절기유행기준은 6.6 명 (/1,) ILI per 1, Figure 1. Weekly proportion of influenza-like illness per 1, outpatients, to flu seasons 2. Hand, Foot and Mouth Disease(HFMD), Republic of Korea, s ending April 14, 218 (15th ) 218 년도제 15 주차수족구병표본감시 ( 전국 95 개의료기관 ) 결과, 의사환자분율은외래환자 1, 명당.4 명으로전주 (.6 명 ) 대비감소 수족구병은 29 년 6 월법정감염병으로지정되어표본감시체계로운영 No. of outpatients / 1, Figure 2. Weekly proportion of hand, foot and mouth disease per 1, outpatients,

29 3. Ophthalmologic infectious disease, Republic of Korea, s ending April 14, 218 (15th ) 218 년도제 15 주차유행성각결막염 ( 전국 92 개의료기관 ) 결과, 외래환자 1, 명당분율은 17.4 명으로전주 14.9 명대비증가 동기간급성출혈성결막염의환자분율은 1.1 명으로전주.6 명대비증가 6 5 No. of outpatients / 1, Figure 3. Weekly proportion of epidemic keratoconjunctivitis per 1, outpatients 5 4 No. of outpatients / 1, Figure 4. Weekly proportion of acute hemorrhagic conjunctivitis per 1, outpatients 515

30 4. Sexually Transmitted Diseases, Republic of Korea, s ending April 14, 218 (15th ) 218 년도제 15 주성매개감염병표본감시기관 ( 전국보건소및의료기관 58 개참여 ) 에서신고기관당성기단순포진 2.6 건, 첨규콘딜롬 2.4 건, 클라미디아감염증 2.2 건, 임질 1.3 건발생을신고함. 제 15 주차신고의료기관수 : 임질 24 개, 클라미디아 62 개, 성기단순포진 62 개, 첨규콘딜롬 43 개 Unit: No. of cases/sentinels Gonorrhea Chlamydia Genital herpes Condyloma acuminata Cum: Cumulative counts from 1st to current in a year According to surveillance data, the reported cases may include all of the cases such as confirmed, suspected, and asymptomatic carrier in the group. average is mean value calculated by cumulative counts from 1st to current for 5 preceding years. 문의 : (43) , 7132 자세히보기 : 질병관리본부 정책 / 사업 감염병감시 표본감시주간소식지 1.3 수인성및식품매개감염병집단발생주간현황 (15th ) Waterborne and foodborne disease outbreaks, Republic of Korea, s ending April 14, 218 (15th ) 218 년도제 15 주보고기관 (254 개보건소 ) 에서집단발생이 13 건발생하였으며누적발생건수는 153 건 ( 사례수 2,142 명 ) 이발생함 No. of outbreaks Average no. of cases in last 5 years( ) Figure 5. Number of waterborne and foodborne disease outbreaks reported by,

31 2.1 병원체감시 : 인플루엔자및호흡기바이러스주간감시현황 (15th ) 1. Influenza viruses, Republic of Korea, s ending April 14, 218 (15th ) 218 년도제 15 주에전국 52 개감시사업참여의료기관에서의뢰된호흡기검체 264 건중 7 건양성 (A/H1N1pdm9 2 건, A(H3N2) 3 건, B 형 2 건 ) No. of positives A(H3N2) A(not subtyped) A(H1N1)pdm9 B Percent positive Percent positives (%) Figure 6. Number of specimens positive for influenza by subtype, to flu season 2. Respiratory viruses, Republic of Korea, Weeks ending April 14, 218 (15th ) 218 년도제 15 주호흡기검체 (264 개 ) 에대한유전자검사 (17 개시 도보건환경연구원및 52 개참여기관 ) 결과, 7.1% 의호흡기바이러스가 검출되었음. ( 최근 4 주평균 261 개의호흡기검체에대한유전자검사결과를나타내고있음 ) 주별통계는잠정통계이므로변동가능 218 () Weekly total Detection rate (%) No. of samples Detection rate (%) HAdV HPIV HRSV IFV HCoV HRV HBoV HMPV , , HAdV : human Adenovirus, HPIV : human Parainfluenza virus, HRSV : human Respiratory syncytial virus, IFV : Influenza virus, HCoV : human Coronavirus, HRV : human Rhinovirus, HBoV : human Bocavirus, HMPV : human Metapneumovirus the rate of detected cases between March April , (Average No. of detected cases is 261 in last 4 s) 217 : the rate of detected cases between January December 자세히보기 : 질병관리본부 알림 주간질병감시정보 517

32 2.2 병원체감시 : 급성설사질환실험실표본주간감시현황 (14th ) Acute gastroenteritis-causing viruses and bacteria, Republic of Korea, s ending April 7, 218 (14th ) 218 년도제 14 주실험실표본감시 (17 개시 도보건환경연구원및 7 개의료기관 ) 급성설사질환유발바이러스검출건수는 16 건 (28.6%), 세균 검출건수는 17 건 (8.4%) 이었음. Acute gastroenteritis-causing viruses Week No. of sample No. of detection (Detection rate, %) Group A Rotavirus Norovirus Enteric Adenovirus Astrovirus Total (2.3) 6 (9.4) 1 (1.6) (.) 2 (31.3) (1.2) 4 (8.2) 1 (2.) (.) 1 (2.4) (2.5) 13 (16.7) 3 (3.8) (.) 32 (41.) (12.5) 7 (12.5) 1 (1.8) 1 (1.8) 16 (28.6) (16.6) 167 (18.7) 19 (2.1) 9 (1.) 343 (38.5) * The samples were collected from children 5 years of sporadic acute gastroenteritis in Korea. Acute gastroenteritis-causing bacteria Week No. of sample Salmonella Pathogenic spp. E.coli Shigella spp. No. of isolation (Isolation rate, %) V.parahaem V. cholerae Campylobacter C.perfringens S. aureus B. cereus Total olyticus spp () 2 (1.3) () () () () 1 (.7) 6 (3.9) () 9 (5.9) (1.2) 1 (.6) () () () () 1 (.6) 3 (1.9) 2 (1.2) 9 (5.6) (.5) 4 (2.2) () () () () () 3 (1.6) 2 (1.1) 1 (5.4) (4.4) 6 (3.) () () () () 2 (1.) () () 17 (8.4) 2, (1.6) 46 (1.8) 2 (.1) () () 1 (.4) 38 (1.5) 32 (1.3) 2 (.8) 188 (7.6) * Bacterial Pathogens ; Salmonella spp., E. coli (EHEC, ETEC, EPEC, EIEC), Shigella spp., Vibrio parahaemolyticus, Vibrio cholerae, Campylobacter spp., Clostridium perfringens, Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes, Yersinia enterocolitica. * Hospital participating in laboratory surveillance in 218 (7 hospitals) 자세히보기 : 질병관리본부 알림 주간질병감시정보 518

33 2.3 병원체감시 : 엔테로바이러스실험실주간감시현황 (14th ) Enterovirus, Republic of Korea, s ending April 7, 218 (14th ) 218년도제14주실험실표본감시 (8개시 도보건환경연구원, 전국 63개참여병원 ) 결과, 엔테로바이러스검출률 6.3%(1 건양성 /16검체 ), 218년누적양성률 4.%(1 건양성 /251 검체 ) 임. - 무균성수막염 건 (218 년누적 2건 ), 수족구병및포진성구협염 건 (218 년누적 2건 ), 합병증동반수족구 건 (218 년누적 건 ), 기타 1건 (218 년누적 6건 ) 임. Aseptic meningitis 8 No. of cases Enterovirus detection cases 217 Enterovirus detection cases Figure 7. Detection cases of enterovirus in aseptic meningitis patients from 217 to 218 HFMD and Herpangina 25 2 No. of cases Enterovirus detection cases 217 Enterovirus detection cases Figure 8. Detection cases of enterovirus in HFMD and herpangina patients from 217 to 218 HFMD with Complications No. of cases Enterovirus detection cases 217 Enterovirus detection cases Figure 9. Detection cases of enterovirus in HFMD with complications patients from 217 to

34 3.1 매개체감시 / 말라리아매개모기주간감시현황 (14th ) Vector surveillance : Malaria vector mosquitoes, Republic of Korea, ending April 7, 218 (14th ) 218 년도제 14 주 3 개시 도 2 개지점에서말라리아매개모기수는평균 1 개체미만으로평년및전년대비동일 218 년도제 14 주전체모기수는평균 1 개체미만으로평년및전년대비동일 7 6 No. of mosquitoes Week Total Mosquitoes(Average) Malaria Vector Mosquitoes(Average) Total Mosquitoes Malaria Vector Mosquitoes Total Mosquitoes 218 Malaria Vector Mosquitoes Figure 1. Weekly incidences of malaria vector mosquitoes in 매개체감시 / 일본뇌염매개모기주간감시현황 (14th ) Vector surveillance : Japanese encephalitis vector mosquitoes, Republic of Korea, ending April 7, 218 (14th ) 218 년 14 주일본뇌염매개모기주간발생현황 : 1 개시 도보건환경연구원 ( 총 1 개지점 ) 년제 14 주전체모기수는평균 11 개체로평년 2 개체대비 9 개체 (45%) 증가및전년 2 개체대비 9 개체 (45%) 증가하였음 년제 14 주일본뇌염매개모기 ( 작은빨간집모기, Culex tritaeniorhynchus, C.t*) 수는평균 개체로평년 개체대비동일및전년 개체대비동일하였음. No. of mosquitoes 2, 1,8 1,6 1,4 1,2 1, Week Total C.t* Total C.t* Total C.t* Figure 11. Weekly incidences of Japanese encephalitis vector mosquitoes in 자세히보기 : 질병관리본부 민원 / 정부 3. 사전정보공개

35 주요통계이해하기 < 통계표 1> 은지난 5년간발생한법정감염병과 218 년해당주발생현황을비교한표로, 금주환자수 ( ) 는 218 년해당주의신고건수를나타내며, 218 년누계환자수 ( 218) 는 218년 1주부터해당주까지의누계건수, 그리고 5년주평균환자수 ( ly average) 는지난 5년 ( 년 ) 해당주의신고건수와이전 2주, 이후 2주의신고건수 ( 총 25주 ) 평균으로계산된다. 그러므로금주환자수 ( ) 와 5년주평균환자수 ( ly average) 의신고건수를비교하면해당주단위시점과예년의신고수준을비교해볼수있다. 연도별환자수 (Total no. of cases by year) 는지난 5년간해당감염병현황을나타내는확정통계이며연도별현황을비교해볼수있다. 예 ) 218 년 12 주의 5 년주평균환자수 ( ly average) 는 213 년부터 217 년의 1 주부터 14 주까지의신고건수를 총 25 주로나눈값으로구해진다. * 5 년주평균환자수 ( ly average)=(x1 + X2 + + X25)/25 1주 11주 12주 13주 14주 218년 해당주 217년 X1 X2 X3 X4 X5 216년 X6 X7 X8 X9 X1 215년 X11 X12 X13 X14 X15 214년 X16 X17 X18 X19 X2 213년 X21 X22 X23 X24 X25 < 통계표 2> 는 17 개시 도별로구분한법정감염병보고현황을보여주고있으며, 각감염병별로최근 5년누계평균환자수 (Cum, average) 와 218년누계환자수 (Cum, 218) 를비교해보면최근까지의누적신고건수에대한이전 5년동안해당주까지의평균신고건수와비교가가능하다. 최근 5년누계평균환자수 (Cum, average) 는지난 5년 ( 년 ) 동안의동기간신고누계평균으로계산된다. 기타표본감시감염병에대한신고현황그림과통계는최근발생양상을신속하게파악하는데도움이된다.

36 발간등록번호 주간건강과질병, PHWR 은질병관리본부에서시행되는조사사업을통해생성된감시및연구자료를기반으로근거중심의건강및질병관련정보를제공하고자최선을다할것이며, 제공되는정보는질병관리본부의특정의사와는무관함을알립니다. 본간행물에서제공되는감염병통계는 감염병의예방및관리에관한법률 에의거, 국가감염병감시체계를통해신고된자료를기반으로집계된것으로집계된당해년도자료는의사환자단계에서신고된것이며확진결과시혹은다른병으로확인될경우수정될수있는잠정통계임을알립니다. 주간건강과질병, PHWR 은질병관리본부홈페이지를통해주간단위로게시되고있으며, 정기적구독을원하시는분은 이메일을통해보내지는본간행물의정기적구독요청시구독자의성명, 연락처, 직업및이메일주소가요구됨을알려드립니다. 주간건강과질병 발간관련문의 : kcdc215@korea.kr/ /33 창 발 간 : 28 년 4 월 4 일 행 : 218 년 4 월 19 일 발행인 : 정은경 편집인 : 박도준 편집위원 : 최영실, 김기순, 최병선, 조신형, 조성범, 김봉조, 구수경, 김용우, 이동한, 조은희, 이은규, 신영림, 김청식, 전경아, 권효진 편 집 : 질병관리본부유전체센터의과학지식관리과 충북청주시흥덕구오송읍오송생명 2 로 187 오송보건의료행정타운 ( 우 )28159 Tel. (43) /33 Fax. (43)