untitled

Size: px

Start display at page:

Download "untitled"

은혁 송
5 years ago
Views:

pissn 2287-3368 / eissn 2287-3376 ORIGINAL ARTICLE Korean Journal of Acupuncture Vol.34, No.3, pp.146-155, 2017

1 pissn / eissn ORIGINAL ARTICLE Korean Journal of Acupuncture Vol.34, No.3, pp , 김형기 1 ㆍ김철홍 2 ㆍ윤현민 2 ㆍ강경화 3 ㆍ송춘호 1 동의대학교한의과대학 1 경락경혈학교실, 2 침구학교실, 3 생리학교실 Effects of Crataegi Fructus Hot-Water Extract on Hair Growth and Growth Factor Gene Expression of Human Dermal Papilla Cells Hyeong-Key Kim 1, Cheol-Hong Kim 2, Hyun-Min Yoon 2, Kyung-Hwa Kang 3, Choon-Ho Song 1 Departments of 1 Meridian & Acupoint and 2 Acupuncture & Moxibustion and 3 Physiology, College of Korean Medicine, Dong-Eui University Objectives : This study was carried out to investigate the effects of Crataegi Fructus water extract(cfwe) on hair growth in an alopecia model of C57BL/6N mice and human dermal papilla cells(hdpcs). Methods : Six-week old mice were depilated and separated in 3 groups ; CON, MXD(2% Minoxidil), and CFWE. The treatments were applied twice a day for 18 days. The hair growth was determined photographically. The hair density, thickness and length were identified by Folliscope and the weights of body were measured. In dorsal skin tissue, the expression of hair growth-related protein was analyzed by Western blot. In hdpcs with/without IFN-γ, cell proliferation and the expression of hair growth-related genes were analyzed. Results : We observed that CFWE promoted hair growth compared to CON. CFWE improved the hair density, thickness and length compared to CON. CFWE increased the Wnt/β-catenin signaling in dorsal skin. In hdpcs, CFWE accelerated the cell proliferation and inhibited IFN-γ-induced hdpcs degeneration. CFWE increased the mrna expression of β-catenin, Axin-2, BMP-4, FGF-7, FGF-10, and ALP compared to CON and IFN-γ treated cells. Conclusions : These results suggest that CFWE has a hair regrowth activity via Wnt/β-catenin signaling and can be useful for the treatment of alopecia. Key words : Crataegi Fructus water extract(cfwe), alopecia, C57BL/6N, human dermal papilla cells(hdpcs) 서론 모발의성장은모낭의형성과함께시작된다. 모낭은포유류에존재하는가장복잡한소형기관중하나이다. 모낭은성장기 (anagen), 퇴행기 (catagen), 휴지기 (telogen) 의주기적변화를반 복한다. 성장기때모유두에존재하는모기질세포와멜라닌형성세포의증식에의해모발이자라게되고, 퇴행기에모발의성장을종료하고모근이파괴되며상피막이수축되고혈액공급이중단되며, 휴지기에모유두활동이멈추고모발이모공가까이위치하여모발이탈락하게된다. 이러한모낭의주기는다양한인자에의해 Received August 29, 2017, Revised September 18, 2017, Accepted September 22, 2017 Corresponding author: Choon-Ho Song Department of Meridian & Acupoint, College of Korean Medicine, Dong-Eui University, 52-57, Yangjeong-ro, Busanjin-gu, Busan 47227, Korea Tel: , Fax: , chsong@deu.ac.kr This work was supported by Dong-eui University Grant( ). CC This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 146 Copyright 2017, SOCIETY FOR MERIDIAN AND ACUPOINT

2 영향을받는다. 유전적요인, 심리적스트레스, 약물부작용등은모낭주위성장인자, 사이토카인과호르몬변화를초래하고모낭의성장기단축, 퇴행기로의조기진행등을유도하여탈모를일으킨다 1). 한의학에서모발의상태는血의상태에영향을받는데, 血이부족하면모발에윤기가없으며, 血이열을받으면모발이누렇게되고, 血이상하면모발이희어진다고하였다 2). 또젊어서머리털이빠지는것은火, 怒火또는기름진음식으로인해가슴에熱과濕痰이생겨서훈증되어血이마르기때문이라고보았다 2). 山楂는장미과 (Rosaceae) 산사나무 (Crataegus pinnatifida Bunge) 의잘익은열매로성미가酸甘微溫하고脾胃肝經에귀경하여消食健胃, 行氣散瘀, 化濁降脂등의효능을지닌다 3). 山楂에대한실험적연구는산화스트레스와고지혈증 4), 비만 5), 당뇨 6), 동맥경화증 7) 등에대한억제효과보고가있으며, 山楂의육모에대한선행연구로모낭의퇴행기를유도하는 apoptosis 기전을억제하는효과가보고되었다 8). 현재탈모치료를위해가장일반적으로사용되고있는약물인 Minoxidil(MXD) 은접촉성피부염, 다모증, 피부소양감등의부작용이보고되어있다 9). 반면, 山楂는평소잘못된식습관등으로인한두피열감, 지루성피부염등濕熱로인한모발의이상에효과적일것으로생각되어본연구를진행하였다. 본연구에서는한의학적으로신ㆍ방광이모발성장과연관된점에주목하여경락경혈학적으로족태양방광경이순행하는 C57BL/6N 마우스의등부위皮部에山楂열수추출물을도포하여약물을흡수시키고, MXD 를양성대조군으로사용하여모발성장효과와모발성장에관여하는 Wnt/β-catenin 신호전달경로활성화를확인하였다. 또한사람유래모유두세포 (human dermal papilla cells, hdpcs) 의증식과모발성장인자의유전자발현증가를확인하여이에유효한결과를얻었기에보고하는바이다. 재료및방법 1. 시약본실험에사용된시약으로 Mobarin(Minoxidil, MXD) 과 Bikiro cream은 Tai Geuk Pharm. Co., Ltd.(Hwaseong, Korea) 로부터, chloroform, isopropanol 은 Sigma(St. Louis, MO, USA) 로부터, RT-PCR kit(one-step RT-PCR premix kit) 는 Intron Biotechnology, Inc.(Sungnam, Korea) 로부터, primer 는 Bioneer (Daejeon, Korea) 로부터구입하여사용하였다. Wnt3α, Wnt5α, β-catenin과 β-actin primary antibody 는 Santa Cruz Biotechnology(Santa Cruz, CA, USA) 로부터, goat anti-mouse IgG (HRP)-conjugated secondary antibody는 Enzo Life Sciences, Inc(Farmingdale, NY 11735, USA) 로부터, nitrocellulose membrane은 Bio-RAD Laboratories, Inc(Germany) 로부터구입하여사용하였다. 2. 실험동물실험동물은 6주령의 C57BL/6N male mice 를 ( 주 )Samtako(Osan, Korea) 로부터구입하여, 온도 23±3 C, 상대습도 50±10%, 12시간조명주기조건하에서식이와식수를자유롭게섭취하도록하였으며 7일간의적응기간을거친후실험에사용하였다. 실험동물의관리와모든실험과정은 Guide for the care and use of laboratory animals(8th edition, The National Academies Press, Washington, D.C.) 에준하여시행하였다. 3. 山楂열수추출물의준비본실험에사용된山楂 (Crataegi Fructus) 는국내경북에서생산된것으로옴니허브 (Yeongcheon, Korea) 에서구입하여사용하였다. 山楂 100 g을물로세척후증류수 (distilled water, DW) 1 L를첨가하여 100 C 에서 2시간 30분동안가열하여추출하였다. 여과후실온에서냉각시킨뒤동결건조하여건중량 4.5 g의추출물 (Crataegi Fructus water extract, CFWE) 을획득하였다. 추출물은 20 C 에보관하였다가실험직전 DW와 propylene glycol 을 3:1 혼합한용액에 2% 의농도로녹여사용하였다. 4. 실험군설정및처치실험군은제모후대조군 (CON), CFWE 도포군 (CFWE), Minoxidil 도포군 (MXD) 으로나누었고, 한군에 5마리씩배정하였다. Mice는일차적으로마우스용 clipper 를이용하여등부위의털을깎고, 이차적으로제모제 Bikiro cream 을발라피부속에남아있는모낭과미세한털을모낭이눈에보이지않을때까지제거하고 24시간동안방치하여미세상처가회복되도록하였다. CON 군은 DW와 propylene glycol 을 3:1 혼합한용액을, MXD 군은 2% Minoxidil 용액을, CFWE 군은 2% 山楂추출물을각각 200 μl씩, 하루에 2번, 제모한부위에면봉을이용하여 18일간도포하였다 (Scheme 1). 5. 피부의육안적관찰및모발측정제모를시행한날부터 3일주기로체중을측정하였으며, 시료를도포하기시작한날을실험 1일째로정하여피부에서일어나는발모와관련된특징들을관찰하면서디지털카메라 (SONY, Japan) 를 147

3 김형기ㆍ김철홍ㆍ윤현민ㆍ강경화ㆍ송춘호 Scheme 1. Experimental process. Dorsal hairs of 6-week-old C57BL/6N mice were depilated to synchronize anagen induction. The mice were divided into following three groups: group 1, normal vehicle-treated negative control; group 2, CFWE-treated experimental group; group 3, 2% Minoxidil-treated positive control. Each agent were topically twice a day after hair depilation. Dorsal skin lesions were collected at the 7th day after depilation and analyzed by western blotting., Topical treatment with normal vehicle(dw plus propylene glycol(3:7) mixture), 2% CFWE or 2% Minoxidil. 이용하여촬영하였다. 모낭이형성된부위와발모부위는 Folliscope(Lead M, Seoul, Korea) 로촬영하여모발의밀도와굵기를관찰하였고, 핀셋을사용하여털을뽑아 Folliscope(Lead M, Seoul, Korea) 하에서길이를측정하였다. 6. Western blotting 마우스의등피부조직으로부터 Wnt3α, Wnt5α 와 β-catenin 단백질의발현을분석하기위하여 80 C에보관하고있던등피부조직 0.2 g에 lysis buffer 500 μl 를첨가하여 homogenizer 로분쇄시켜원심분리하여단백질을정량하였다. 단백질 25 μg을 l0% sodium dodecyl sulfate polyacrylamide gel electrophoresis(sds-page) 로분리하고, nitrocellulose membrane으로 transfer 하였다. Transfer된 membrane은 Tris-buffered saline Tween-20(TBST) (20 mm Tris, ph 7.6, 136 mm NaCl, 0.1% Tween 20) 에용해된 5% skim milk 에 1시간동안실온에서 blocking 하였다. Primary antibody는 1:1000으로희석하여 4 C에서 overnight 하였으며, TBST 로 3회세척하고 HRP-conjugated secondary antibody(1:1000 dilution) 로 1시간동안실온에서반응시킨후, ECL system 을이용하여각 factor 의발현을조사하였다. 7. 세포배양 hdpcs 는 Cefobio(Seoul, Korea) 에서구입하였으며, 5% fetal bovine serum(fbs; Invitrogen/Gibco-BRL) 과 1% penicillin을함유한 Dulbecco s modified Eagle s medium(dmem; Invitrogen/Gibco-BRL, Grand Island, NY, USA) 에서배양하였다. hdpcs 는 4번째계대배양의세포를실험에사용하였다. 8. 세포증식측정 hdpcs의증식은 MTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide) assay 를사용하여측정하였다. 모낭의퇴행기를강력하게유도하는인자인 IFN-γ 를 100 ng/ml 의농도로처리하지않거나처리한상황에서 CFWE 를농도별 (0, 25, 50, 100, 200 ng/ml) 로처리한후 3일간배양하였다. MTT(0.5 mg/ml) 를처리하여 4시간동안배양한후배지를제거하였다. 실온에서생성된 formazan 을용해하기위해 DMSO 를처리한후흡광도 540 nm에서값을측정하였다. 9. RT-PCR IFN-γ(100 ng/ml) 를처리하지않거나처리한상황에서 25 ng/ml CFWE 를 3일간처리한모유두세포는 Trizol 법을사용하여 RNA 를추출하였다. RT-PCR은 one-step RT-PCR premix kit(intron Biotechnology Inc., Sungnam, Korea)) 를사용하여 45 C 에서 30분, 94 C에서 5분간반응시킨후 94 C 에서 30초간 denaturation 시키고, 적정온도에서 30초간 annealing 시킨다음, 72 C 에서 1분간 extension 시키는 cycle 을 30회반복한뒤, 마지막 extension 은 72 C에서 5분간 PCR machine(geneamp, PCR system 9700, USA) 에서수행하였다. 각 PCR products 는 2% agarose gel에 loading 하여 100 V 조건에서 30분간전기영동을통하여분석하였다. Primer는 β-catenin, Axin-2, BMP-4, FGF-7, FGF-10, ALP 148

4 Table 1. Primers for RT-PCR Analysis Target gene Sequence 5-3 Annealing C/cycles β Catenin Sense ATGACTCGAGCTCAGAGGCT 53/30 GAACTTGCCACACGTGCAAT Axin-2 Sense GTGAAGGCCAATGGCAGAGT 56/30 CTCACACTCAATTCGCGGGA BMP-4 Sense ACCGAATGCTGATGGTCGTT 54/30 GGAGGAGGAGGAAGAGCAGA FGF-7 Sense TCTTCTGTCTGGCAGTTGGA 53/30 TTGCCATAGGAAGAAAGTGG FGF-10 Sense ACTTTCGGAGAACTGCATCG 53/30 AGTGGGAGCTCCTTTTCCAT ALP Sense TCGTTGACACCTGGAAGAGC 57/30 AGGAGGCAGAATTGACCACG GAPDH Sense GAGAAGGCTGGGGCTCATTT 55/30 CCACAGTCCATGCCATCACT 시하였다. 결 과 Fig. 1. Photograph of hair regrowth in depilated C57BL/6N mice after topical application of CFWE and MXD on 4, 7, 11, 14, and 18 days. The dorsal skins of mice were shaved and applied hair removal cream externally, and the test treatments were applied twice a day for 18 days. CON was treated with 200μl of DW: propylene glycol(3:7) solution as a vehicle. CFWE was treated with 200μl of 2% CFWE in vehicle. MXD was treated with 200μl of 2% Minoxidil in vehicle. 와 GAPDH 를사용하였으며염기서열은다음과같다 (Table 1). 10. 통계처리실험결과는통계프로그램패키지 GraphPad Prism R 5(GraphPad Software Inc., San Diego, CA, USA) 를사용하여평균치 ± 표준편차로나타내었고유의수준은 p<0.05 로하였다. 각실험군간의통계학적분석은 one way-anova 와 Dunnett s post hoc multiple comparison tests 또는 two-way repeated-measures ANOVA 와 Bonferroni post hoc multiple comparison tests 를실 1. 발모현상관찰제모한배부의발모상태를육안적으로관찰한결과실험 4일째는모든군에서육안적인발모현상을전혀관찰할수없었다. 실험 7일째는 CON 군에서는피부가부분적으로연한회색으로변하였으나육안적인발모현상은관찰할수없었다. CFWE 군과 MXD 군에서는모두피부가부분적으로진한회색으로변하고부분적인발모현상이관찰되었으며 CFWE군, MXD 군, CON 군순으로발모현상이촉진되는것이관찰되었다. 실험 11일째는 CON 군에서는모두피부가부분적으로회색으로변하였고부분적인발모현상이관찰되었다. CFWE 군과 MXD군에서는부분적으로증가된발모현상이관찰되었으며 CFWE군, MXD 군, CON 군순으로발모현상이촉진되는것이관찰되었다. 실험 14일째는 CON 군에서는전체적으로발모가시작되는현상이관찰되었다. CFWE군과 MXD군에서는모두전체적으로증가된발모현상이관찰되었으며 MXD 군, CFWE 군, CON 군순으로발모현상이촉진되는것이관찰되었다. 실험 18일째는 CON 군에서는전체적으로증가된발모현상이관찰되었다. CFWE 군과 MXD 군에서는모두전체적으로현저하게증가된발모현상이관찰되었다 (Fig. 1). 2. 모발의밀도, 굵기및길이변화에미치는영향 1) 모발의밀도변화 : Folliscope 50배율에서 1 cm 2 내의모발 149

째는 CON군, MXD군, CFWE군이 각각 2162.0±604.5, 2678.0± 420.9, 30

5 김형기ㆍ김철홍ㆍ윤현민ㆍ강경화ㆍ송춘호 의 밀도를 측정한 결과, 실험 7일째는 CON군, MXD군, CFWE군이 2 째는 CON군, MXD군, CFWE군이 각각 0.51±0.26, 0.92±0.38, 각각 25.2±17.99, 210.6±145.9, 291.0±98.18/cm 으로 나타났고, 1.00±0.46 mm로 나타났으며, 실험 14일째는 CON군, MXD군, 실험 11일째는 CON군, MXD군, CFWE군이 각각 ±504.7, CFWE군이 각각 1.16±0.63, 2.88±1.05, 2.60±0.77 mm로 나타 ±614.6, ±360.6/cm 으로 나타났으며, 실험 14일 났다(Fig. 4). 째는 CON군, MXD군, CFWE군이 각각 ±604.5, ± 420.9, ±461.6/cm2으로 나타났다(Fig. 2). 3. 체중변화에 미치는 영향 2) 모발의 굵기 변화: Folliscope 100배율에서 모발의 굵기를 CFWE군과 MXD군에서 시험물질의 피부 도포가 체중변화에 미 측정한 결과, 실험 7일째는 CON군, MXD군, CFWE군이 각각 치는 영향을 확인하기 위해 제모 후 4일, 7일, 11일, 14일, 18일째 0.006±0.004, 0.008±0.001, 0.011±0.002 mm로 나타났고, 실 체중을 측정한 결과 CON군, CFWE군과 MXD군의 체중은 각 실험 험 11일째는 CON군, MXD군, CFWE군이 각각 0.010±0.006, 군 간의 유의한 차이는 없었다(Fig. 5) ±0.006, 0.025±0.005 mm로 나타났으며, 실험 14일째는 CON군, MXD군, CFWE군이 각각 0.015±0.004, 0.025±0.007, 4. Wnt/β-catenin 신호전달 단백질 발현에 미치는 영향 CFWE군과 MXD군에서 시험물질의 피부 도포가 Wnt3α, 0.029±0.007 mm로 나타났다(Fig. 3). 3) 모발의 길이 변화: 제모 후 7일, 11일, 14일째 모발의 길이를 Wnt5α와 β-catenin 발현에 미치는 효과를 살펴본 결과 마우스 측정한 결과, 실험 7일째는 CON군, MXD군, CFWE군이 각각 의 7일째 등 피부 조직 CFWE군에서 MXD군과 유사하게 Wnt3α, 0.10±0.05, 0.52±0.17, 0.43±0.16 mm로 나타났고, 실험 11일 Fig. 2. Effect of CFWE on hair density in an alopecia model of C57BL/6N mice by Folliscope( 50 magnification). All data are expressed as the mean±standard deviation(s.d.) of 5 mice per group. One-way ANOVA and Dunnett s post hoc multiple comparison tests were used to assess statistical significance. *p 0.05, **p 0.01 vs CON. 150 Fig. 3. Effect of CFWE on hair thickness in an alopecia model of C57BL/6N mice by Folliscope( 100 magnification). All data are expressed as the mean±s.d. of 5 mice per group. One-way ANOVA and Dunnett s post hoc multiple comparison tests were used to assess statistical significance. *p 0.05, **p 0.01, ***p vs CON.

Effect of CFWE on protein expression of Wnt/β-catenin signaling involved in anagen development. Dorsal skins were collected from C57BL/6N mice on day7 after depilation.

6 Fig. 4. Effect of CFWE on hair length in an alopecia model of C57BL/6N mice. All data are expressed as the mean±s.d. of 5 mice per group. One-way ANOVA and Dunnett s post hoc multiple comparison tests were used to assess statistical significance. *p<0.05, **p< 0.01, ***p<0.001 vs CON. Fig. 6. Effect of CFWE on protein expression of Wnt/β-catenin signaling involved in anagen development. Dorsal skins were collected from C57BL/6N mice on day7 after depilation. Western blot method was used to determine the expression of Wnt3α, Wnt5α, and β-catenin at the translational level. β-actin was used as internal control protein. Fig. 5. Effect of CFWE on body weight in an alopecia model of C57BL/6N mice. All datas are expressed as the mean±s.d. of 5 mice per group. Wnt5α 와 β-catenin 발현이모두현저하게증가하였다 (Fig. 6). 5. hdpcs의증식에미치는영향성장기모낭을퇴행기로유도하는 IFN-γ 를처리하지않은조건과처리한조건에서모발의생성과성장에핵심적인역할을하는모유두세포의증식에미치는 CFWE의영향을확인하였다. IFN-γ 는 hdpcs 증식을현저하게감소시켰으며, CFWE 는농도의존적이지는않으나 ng/ml 의농도에서 IFN-γ 의처리하지않은조건과처리한조건에서모두 hdpcs 증식의유의한증가를나타내었다 (Fig. 7). 6. 모낭및모발의성장조절유전자발현에미치는영향 1) β-catenin 관련유전자발현변화 : 모발의발생과성장은세포내 Wnt신호전달경로의활성과관련된다. Wnt 신호전달경로 Fig. 7. Effect of CFWE on the hdpcs proliferation and IFN-γ-mediated hdpcs reduction. hdpcs were treated with 100 ng/ml of IFN-γ, 25, 50, 100 and 200 ng/ml of CFWE, or with both IFN-γ and CFWE for 3 days, and MTT assay was assessed on day 3. MXD served as a positive control for hdpcs promotion. Results were expressed as mean±sd of compared to the control. Statistically significant differences were determined by ANOVA(*p<0.05, **p<0.01, ***p<0.001 vs untreated cells, ### p<0.001 vs IFN-γ treated cells). 의핵심적인유전자인 β-catenin 과 Axin-2 의유전자발현증가를관찰하여 CFWE 가모낭및모발의성장조절유전자발현에미치는영향을확인하였다. 그결과시험물질처리 3일후 CFWE 는 CON 에비해 β-catenin 과 Axin-2 유전자발현을증가시켰다. 그러나 IFN-γ 는 CON에비해 β-catenin 과 Axin-2 유전자발현을감소시키지는 151

그결과시험물질처리 3일후 CFWE 는 CON 에비해 BMP-4, FGF-7 과 FGF-10 유전자발현을증가시켰다. 그러나 IFN-γ 는 CON 에비해 BMP-4, FGF-7 과 FGF-10 유전자발현의변화를보이지않았으나, CFWE가 IFN-γ 처리하에서이들유전자의발현을증가시키는것을확인하였다 (Fig. 9). Fig. 8.

7 김형기ㆍ김철홍ㆍ윤현민ㆍ강경화ㆍ송춘호 못했으나, CFWE 가 IFN-γ 처리하에서이들유전자의발현을증가시키는것을확인하였다 (Fig. 8). 2) hdpcs 특징적유전자발현변화 : 모발의성장과관련된 hdpcs 특징유전자 bone morphogenic protein-4(bmp-4), fibroblast growth factor-7(fgf-7) 과 FGF-10 유전자발현변화를관찰하여 CFWE가모낭및모발의성장조절유전자발현에미치는영향을확인하였다. 그결과시험물질처리 3일후 CFWE 는 CON 에비해 BMP-4, FGF-7 과 FGF-10 유전자발현을증가시켰다. 그러나 IFN-γ 는 CON 에비해 BMP-4, FGF-7 과 FGF-10 유전자발현의변화를보이지않았으나, CFWE가 IFN-γ 처리하에서이들유전자의발현을증가시키는것을확인하였다 (Fig. 9). Fig. 8. Effect of CFWE on the expression of β-catenin and Axin-2 mrna in hdpcs and IFN-γ-mediated hdpcs. RNA was isolated from the hdpcs at day 3. Detection of mrna was examined by RT-PCR analysis as described in Materials and Methods. GAPDH was used as internal control genes. 3) Alkaline phosphatase(alp) 유전자발현변화 : hdpcs의증식과모발성장을유도하는 ALP 유전자발현변화에미치는 CFWE 의영향을확인하였다. 그결과시험물질처리 3일후 CFWE는 CON 에비해 ALP 유전자발현을증가시켰다. 그러나 IFN-γ 는 CON 에비해 ALP 유전자발현의변화를보이지않았으나, CFWE 가 IFN-γ 처리하에서 ALP 유전자의발현을증가시키는것을확인하였다 (Fig. 10). 고찰 모발은광범위한기능을수행하는데, 포유동물에서신체보호, 보온, 위장, 땀과피지의분산, 감각및촉각기능, 사회적상호작용을한다. 인간에서도모발은정신사회적중요성을지니고있으며많은질병이탈모와관련되어있다 1). 탈모는일생동안절반정도의남성과여성에게발생하고 10), 국소형탈모로는원형탈모와두부백선이있으며, 범발성탈모로는여성형탈모, 남성형탈모, 휴지기탈모, 성장기탈모등이있다 10). 발병요인으로유전적요인, 호르몬변화, 심리적스트레스, 약물부작용등이모낭주위성장인자, 사이토카인과호르몬변화를초래하고모낭의성장기단축, 퇴행기로의조기진행등을유도하여탈모를일으키는것으로알려져있다 1). 山楂는신농본초경집주에적조목의열매로수록되어있는데일명 羊梂 또는 鼠査 라하였으며그맛은시고성질은冷하며무독하다고하였고, 水痢를주치하며머리나몸의瘡癢에는달인물로씻는다고하였다 11). 본연구에서는 CFWE가제모후모발의재생성과성장을유도하는효능과기전에대해조사하였다. 육안적관찰결과 CFWE 군은 CON 군에비해현저하게빠른모발성장을나타내었고, MXD 군에 Fig. 9. Effect of CFWE on the expression of BMP-4, FGF-4, and FGF-10 mrna in hdpcs and IFN-γ-mediated hdpcs. RNA was isolated from the hdpcs at day 3. Detection of mrna was examined by RT-PCR analysis as described in Materials and Methods. GAPDH was used as internal control genes. Fig. 10. Effect of CFWE on the expression of ALP mrna in hdpcs and IFN-γ-mediated hdpcs. RNA was isolated from the hdpcs at day 3. Detection of mrna was examined by RT-PCR analysis as described in Materials and Methods

8 비해서도빠른모발성장을나타내었다 (Fig. 1). 모발의밀도, 굵기, 길이관찰결과도육안적관찰결과와유사하게 CFWE 군, MXD군, CON 군순으로증가효과를나타내었다 (Figs. 2 4). 반면, 각실험군간체중은유의한변화가없었는데 (Fig. 5) 이러한결과는시료의도포가 stress 로작용하지않은것으로생각된다. Wnt family는분화, 세포이주및성장에관여하는분비성당단백질로다양한 Wnt단백질이발견되었다. 분비된세포외부 Wnt ligands 는세포막표면수용체 (Frizzled family) 를통해 Wnt 신호전달을활성화시킴으로써 β-catenin 을안정화시키고핵내로이동하여 TCF/LEF 전사인자에결합하도록유도한다. 이러한복합체는증식, 분화와이주에서 Wnt 신호전달의다양한기능을수행하기위한하위표적유전자의전사를조절한다. Wnt/β-catenin 신호전달의활성은모발의생성과유지뿐만아니라모낭의재생산과모기질의성장에도중요하다 12,13). Wnt3α는 canonical Wnt 신호전달경로를매개하여 β-catenin 안정화를유도하여모발성장에영향을미치며, 모낭멜라닌세포의항상성을유지한다 13,14). Wnt5 α는많은발달과정에연루되고다양한세포내신호전달을활성화시킬수있다. Wnt5α 는 Wnt/β-catenin 신호를약화시킴으로써모낭공간을조절하여이소성 β-catenin/tcf 신호에의해초래될수있는조숙하거나불필요한모낭형성을예방한다 15,16). 본연구에서실험 7일째 C57BL/6N 마우스의등피부조직을채취하여모발의재생성과성장과관련된 Wnt/β-catenin 신호전달기전의활성을살펴본결과, MXD 군과 CFWE 군은대조군에비해 Wnt3α, Wnt5α 와 β-catenin 의활성이증가하였다 (Fig. 6). 이러한결과는 CFWE의모발생성과조절효과가직접적으로 Wnt3 α와 Wnt5α 를통하여 β-catenin 의활성을조절함으로써일어난다는것을나타낸다. 모발의성장은모유두세포에존재하는모기질세포와멜라닌형성세포의증식에의해일어난다. IFN-γ 는모낭주기의조절에관여하는많은사이토카인중의하나로 17-20), IFN-γ 를과발현시킨두계통의유전자변형마우스에서모두탈모를유발하였다 21,22). 최근연구들은 IFN-γ 가정상사람의두피모낭에서강력한퇴행기유도제이며모기질과모유두세포에서모두 IFN-γRβ 를발현한다고보고하였다 23). 따라서본연구에서는모낭의조기퇴행기를유도하는 IFN-γ 가존재하거나존재하지않는조건에서 CFWE 가 hdpcs 의증식에미치는영향을조사하였다. 그결과 CFWE는 hdpcs 의증식을유의하게증가시켰으며, IFN-γ 로인한 hdpcs 의증식감소를회복하였다 (Fig. 7). 이는 CFWE가 hdpcs 에서성장기상태를유지시키고모낭의 IFN-γ 유도퇴행기전환을방지하는것을보여주는결과 이다. β-catenin knockout mice 는모낭의퇴행기와휴지기가조기에유도되어모낭재형성에실패하였다. 이는모유두세포에서 β-catenin 의활성화가모낭의성장기를연장하고모발성장을촉진할수있다는것을나타낸다 24). 본연구에서 hdpcs 에서모낭및모발의성장조절유전자발현에미치는영향을알아보았다. 그결과, CFWE 는 Wnt/β-catenin 기전과관련된핵심유전자인 β-catenin 과 Axin-2 의발현, 모발의성장과관련된특징적인유전자인 BMP-4, FGF-7, FGF-10 유전자의발현과 hdpcs 의증식과모발성장을유도하는 ALP 유전자의발현을증가시켰다 (Figs. 8 10). 이는 CFWE가 β-catenin 유전자발현을증가시킴으로써 IFN-γ 유도모낭퇴행기변화에대응할수있는 hdpcs 의특징적인유전자들발현을증가시키고모낭주기와모발의성장을조절하는것을보여주는결과이다. 이러한결과를종합해볼때 CFWE는 Wnt/β-catenin 신호전달경로의활성화를통해 C57BL/6N 마우스의모발성장을촉진하고, hdpcs 의증식과모낭의성장을촉진하며, IFN-γ 로인한 hdpcs 의감소와모낭의조기퇴행기유도회복에유의한효과가있는것이확인되었다. 또한추가적인연구를통해잘못된식습관으로인한두피열감과지루성피부염으로인한濕熱을동반하는탈모와 IFN-γ 매개병리적탈모에 CFWE 가적용될수있을것으로기대되며, 향후경락과경혈을활용한탈모치료에대한약침요법의임상적효능을입증할수있는기초자료마련에조금이나마일조를할것으로생각된다. 결론 C57BL/6N 마우스모델에서山楂열수추출물 (CFWE) 의모발성장과모유두세포의성장인자유전자발현에대한영향을연구하여다음과같은결과를얻었다. 1. 피부의육안적관찰결과 CFWE 군과 MXD 군은 CON 군에비해발모현상이촉진되는것을관찰하였다 2. Folliscope 를이용한모발의밀도, 굵기및길이를관찰한결과 CFWE군과 MXD 군은 CON 군에비해증가를보였다. 3. 체중변화를관찰한결과각실험군간의유의한차이는없었다. 4. 모발의성장과관련된 hdpcs 의 β-catenin, Axin-2, BMP-4, FGF-7, FGF-10 과 ALP 유전자의발현량을증가시켰다. 또한모낭의퇴행기를유도하는 IFN-γ 에의한 β-catenin, Axin-2, BMP-4, FGF-7, FGF-10과 ALP 유전자감소를회복시켰다

9 김형기ㆍ김철홍ㆍ윤현민ㆍ강경화ㆍ송춘호 이상에서 CFWE 가모발성장을촉진하고모유두세포의증식과모낭의성장을촉진하며모유두세포의감소와모낭의조기퇴행회복에유의한효과가있음을확인하였다. 감사의글 This work was supported by Dong-eui University Grant ( ). References 1. Schneider MR, Schmidt-Ullrich R, Paus R. The hair follicle as a dynamic miniorgan. Current biology: CB ; 19(3) : R Heo J. Dongeuibogam. Seoul: Koryeomoonwhasa : Defining Dictionary for Medicinal Herbs [Korean, Hanyak Giwon Sajeon ] [Internet] [cited ]. Available from: 4. Shao F, Gu L, Chen H, Liu R, Huang H, Ren G. Comparation of Hypolipidemic and Antioxidant Effects of Aqueous and Ethanol Extracts of Crataegus pinnatifida Fruit in High-Fat Emulsion-Induced Hyperlipidemia Rats. Pharmacognosy magazine ; 12(45) : Lee YH, Kim YS, Song M, Lee M, Park J, Kim H. A Herbal Formula HT048, Citrus unshiu and Crataegus pinnatifida, Prevents Obesity by Inhibiting Adipogenesis and Lipogenesis in 3T3-L1 Preadipocytes and HFD-Induced Obese Rats. Molecules(Basel, Switzerland) ; 20(6) : Chowdhury SS, Islam MN, Jung HA, Choi JS. In vitro antidiabetic potential of the fruits of Crataegus pinnatifida. Research in pharmaceutical sciences ; 9(1) : Zhang J, Liang R, Wang L, Yan R, Hou R, Gao S, et al. Effects of an aqueous extract of Crataegus pinnatifida Bge. var. major N.E.Br. fruit on experimental atherosclerosis in rats. J Ethnopharmacol ; 148(2) : Shin HS, Lee JM, Park SY, Yang JE, Kim JH, Yi TH. Hair growth activity of Crataegus pinnatifida on C57BL/6 mouse model. Phytother Res ; 27(9) : American Academy of Pediatrics Committee on Drugs: The transfer of drugs and other chemicals into human milk. Pediatrics ; 93(1) : Mounsey AL, Reed SW. Diagnosing and treating hair loss. American family physician ; 80(4) : Tang SW. Classified Emergency Materia Medica. Beijing : People s Medical Publishing House : Leiros GJ, Attorresi AI, Balana ME. Hair follicle stem cell differentiation is inhibited through cross-talk between Wnt/beta-catenin and androgen signalling in dermal papilla cells from patients with androgenetic alopecia. The British journal of dermatology ; 166(5) : Guo H, Yang K, Deng F, Ye J, Xing Y, Li Y, et al. Wnt3a promotes melanin synthesis of mouse hair follicle melanocytes. Biochemical and biophysical research communications ; 420(4) : Ouji Y, Nakamura-Uchiyama F, Yoshikawa M. Canonical Wnts, specifically Wnt-10b, show ability to maintain dermal papilla cells. Biochemical and biophysical research communications ; 438(3) : van Amerongen R, Fuerer C, Mizutani M, Nusse R. Wnt5a can both activate and repress Wnt/beta-catenin signaling during mouse embryonic development. Developmental biology ; 369(1) : Narhi K, Jarvinen E, Birchmeier W, Taketo MM, Mikkola ML, Thesleff I. Sustained epithelial beta-catenin activity induces precocious hair development but disrupts hair follicle down-growth and hair shaft formation. Development ; 135(6) : Stenn KS, Paus R. Controls of hair follicle cycling. Physiological reviews ; 81(1) : Cotsarelis G, Millar SE. Towards a molecular understanding of hair loss and its treatment. Trends in molecular medicine ; 7(7) : Hoffmann R. The potential role of cytokines and T cells in alopecia areata. The journal of investigative dermatology Symposium proceedings / the Society for Investigative Dermatology, Inc [and] European Society for Dermatological Research ; 4(3) : Philpott MP, Sanders D, Westgate GE, Kealey T. Human hair growth in vitro: a model for the study of hair follicle biology. J 154

10 Dermatol Sci ; 7 Suppl : S Carroll JM, Crompton T, Seery JP, Watt FM. Transgenic mice expressing IFN-gamma in the epidermis have eczema, hair hypopigmentation, and hair loss. J Invest Dermatol ; 108(4) : Hirota R, Tajima S, Yoneda Y, Tamayama T, Watanabe M, Ueda K, et al. Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research ; 22(9) : Ito T, Ito N, Saathoff M, Bettermann A, Takigawa M, Paus R. Interferon-gamma is a potent inducer of catagen-like changes in cultured human anagen hair follicles. The British journal of dermatology ; 152(4) : Enshell-Seijffers D, Lindon C, Kashiwagi M, Morgan BA. beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. Developmental cell ; 18(4) :

α α α α α

α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를