04 (06-04-OK).hwp
|
|
- 원 계
- 7 years ago
- Views:
Transcription
1 J Korean oc Food ci Nutr 한국식품영양과학회지 43(10), 1491~1499(2014) 고콜레스테롤식이투여마우스에서복분자미숙과추출물과홍삼농축액복합투여의콜레스테롤개선효과 이민정 1 이수정 1 최혜란 1 이정현 1 정종태 1 최경민 2 차정단 2 황승미 2 박종혁 3 이주희 3 이태범 1 1 고창복분자연구소 2 진안홍삼연구소 3 임실치즈과학연구소 Cholesterol Improvement Effects of Co-treatment with Black Rasperry and Red Ginseng Extracts in Mice Fed a High Cholesterol Diet Min Jung Lee 1, u Jung Lee 1, Hye Ran Choi 1, Jung-Hyun Lee 1, Jong Tae Jeong 1, Kyung-Min Choi 2, Jeong-Dan Cha 2, eung-mi Hwang 2, Jong Hyuk Park 3, Joo Hee Lee 3, and Tae Bum Lee 1 1 Gochang Black Rasperry Research Institute 2 Institute of JinAn Red Ginseng 3 Imsil Research Institute of Cheese cience ABTRACT We examined the effects of unripe lack rasperry (UBR) and red ginseng (RG) extracts on cholesterol improvement in C57BL/6J mice fed a HCD (high cholesterol diet) for 12 weeks. Hepatic total lipid and total cholesterol contents were significantly induced in hyperlipidemic mice. However, supplementation with UBR, RG and simvastatin effectively reduced these lipid profiles. Further, UBR and co-treatment with UBR and RG increased expression of LDL receptor, REBP2, and R-B1 mrna compared with HCD. The ApoB/ApoA1 ratio was reduced y co-treatment with UBR and RG compared to treatment with UBR. In addition, histopathologic evaluation showed that co-treatment with UBR and RG suppressed lipid accumulation as well as FA and leptin expression in plasma. These results indicate that co-treatment with UBR and RG may e useful for the prevention of hypercholesterolemia. Key words: unripe lack rasperry, red ginseng, imvastatin, high cholesterol diet, hypercholesterolemia 서 식습관, 비만, 음주, 운동부족등으로인해발생하는건강문제, 즉잘못된생활습관으로인해발생하는생활습관병중에최근대사성질환이급증하고있으며, 특히심혈관계질환의발병률은수십년간지속적으로증가하여주요사망원인중하나가되어의학및영양학적측면에서사회적인문제가되고있다 (1,2). 대사증후군은복부비만, 고혈압, 이상지질혈증, 공복혈당장애가한사람에서군집적으로나타나는것을말하는데주요요인중의하나인고지혈증은저밀도지단백 (low density lipoprotein, LDL) 농도의이상증가, 중성지방의증가, 고밀도지단백 (high density lipoprotein, HDL) 의감소, 리포단백의증가, 지질분해감소와같은지방의생화학대사이상에의해발생하게된다 (3). 이러한질병의치료약물들 Received 13 June 2014; Accepted 5 August 2014 Corresponding auteror: Tae-Bum Lee, Gochang Black Rasperry Research Institute, Jeonuk , Korea tlee01@gri.re.kr, Phone: 론 은장기간복용으로인한부작용발생의문제점이있어치료보다는예방이필요한질환으로여겨지고있으며, 최근에는천연물의건강기능성에대한연구가활발히이루어지고있고이에대한관심과수요도증가하고있다 (4-6). 전국적으로재배되고있는복분자 (Ruus occidentalis) 는폴리페놀과플라보노이드, 안토시아닌, 트리테르페노이드등다양한생리활성물질을함유하고있어항암활성 (7), 면역개선 (8), 항염증 (9), 항산화및항균효과 (10) 등다양한생리활성에대한효능이밝혀진바있다. 최근연구에의하면복분자완숙과추출물보다복분자미숙과추출물이시험관시험에서 LDL을억제시키고체내에서는콜레스테롤생합성을억제하였으며, CD 36, scavenger receptor type A(R-A) 수용체를억제시킴으로써세포내의 ox- LDL의흡수를차단시키고세포안에서는 macrophage에있는 PPAR-γ를억제시킴으로인해 LDL 산화가억제되었으며, adipophilin의활성이억제됨에따라세포안에있는콜레스테롤방출을촉진시켜동맥경화를완화시킬수있다고보고한바있다 (11,12). 또한동물실험에서도 LDL을억제함으로써고지혈증및지질대사에효능이있음을확인하
2 1492 이민정 이수정 최혜란 이정현 정종태 최경민 차정단 황승미 박종혁 이주희 이태범 였다 (13). 홍삼 (red ginseng) 은인삼 (Panax ginseng C.A. Meyer) 을껍질을벗기지않은상태로장시간증기로쪄서건조한것을말하는데, 이러한가공과정을거치면서인삼의생리활성물질인사포닌 (saponin) 의함량이증가하고인삼에없는새로운생리활성성분인 ginsenoside-rg2, Rg3, Rh1, Rh2 가생성된다 (14). 특히 R2는혈중콜레스테롤수치저하와배설촉진, 고콜레스테롤혈증으로야기되는동맥경화의개선효과가보고된바있다 (15). 이러한홍삼내에존재하는 ginsenoside는지방이나콜레스테롤의흡수, 이동속도를촉진시키고, 혈청콜레스테롤증가를억제한다는연구결과 (16,17) 와고지방식이를한실험동물에서 LDL 수용체의합성억제를완화시켜콜레스테롤을저하시켰다는보고가있다 (18). 이전시험관시험연구에서복분자미숙과와홍삼물추출물을이용하여인간간암세포주 (HepG2) 에서콜레스테롤합성억제효과를보였으며, 위장관세포주 (Caco-2) 에서는 HMG-CoA reductase 활성억제, LDL 억제및 HDL 증가, 콜레스테롤배출증가에관련된유전자를조사하였고, 단독투여시보다복합투여시부가적인효과를보였다. 하지만복분자미숙과 (100 μg/ml) 에비해홍삼 (800 μg/ml) 은높은농도에서효과를보여 (11) 이에본연구는복분자미숙과추출물과홍삼농축액을복합투여하여저농도에서고콜레스테롤식이를급여한실험동물에있어지질농도, 지질대사관련유전자발현등에미치는영향을조사하여기능성제품을개발하는기초자료로활용하고자하였다. 재료및방법시료추출고창에서재배된복분자미숙과의 10배용량의물을첨가한후 2시간동안농축추출기 (Cosmo 660, Kyungseo Machine, Incheon, Korea) 를이용하여 2회가열추출하였다. 추출물은여과하여농축한후동결건조 (PVTFD10R, Ilsinioase, Dounducheon, Korea) 하여사용하였다. 진안에서재배된인삼을이용한홍삼농축액은에탄올로 3회추출하여원심분리기를이용하여전분질을여과하였다. 여과된추출액을 C에서감압농축하여농축액을얻은후 C에서 3일간숙성하여 85 C에서 2시간살균하여사용하였다. 실험동물의사육환경및식이투여실험동물은 5주령된 C57BL/6J종수컷마우스를 ( 주 ) 중앙실험동물 (eoul, Korea) 로부터구입하여 1주일간일반사료로적응시켰다. 그런다음각실험군마다평균체중이약 g이되도록 Z 자식으로각군당 9마리씩 5개군으로나누어 stainless steel ottomed cage에 3마리씩분리사육하였다. 실험동물사육실의온도는 22±2 C, 상대습도 는 50±5% 로유지하였으며명암은 12시간주기로조절하였다. 본동물실험에서실험군의분류는정상대조군은 AIN- 76A 식이 (Normal) 를하였고, 고콜레스테롤대조군은 highcholesterol diet 식이 (CTL), 복분자미숙과추출물투여군은 high-cholesterol diet 사료에복분자미숙과물추출물 250 mg/kg/day(ubr) 를투여하였고, 복분자와홍삼복합투여군은 high-cholesterol diet 사료에복분자미숙과물추출물 125 mg/kg과홍삼농축액 125 mg/kg/day(ubr+ RG) 를복합투여하였고, 양성대조군은 high-cholesterol diet 사료에 imvastatin 10 mg/kg/day(imvastatin) 군으로나누어경구용주사기를이용하여 12주간매일일정한시간대 ( 오전 10시 ) 에경구투여를하였으며, 정상대조군과고콜레스테롤대조군에는같은양의증류수를투여하였다. 사료는실험동물용고지질이함유된고형사료와필터및자외선살균기로여과살균된정제수를자유로이섭취하도록하였으며매주식이를공급하였고, 음수, 식이, 체중은일주일에한번일정한시간대에디지털계량기를사용하여측정하였다. 식이섭취효율은실험전기간동안의체중증가량을같은기간동안에섭취한식이섭취량으로나누어산출하였다. 실험에사용한 imvastatin은 statin계의기본약물로간에서콜레스테롤의생성을조절하며, HMG-CoA reductase inhiitor로알려져있는동맥경화치료제로사용되고있는약이다 (19-22). 본동물실험은고창복분자연구소동물실험윤리위원회승인 (GBRI IACUC 14001) 하에진행되었다. 혈액및조직적출희생전 12시간절식시킨후 diethyl ether로마취시켜개복한즉시복대정맥으로부터혈액을채취하였다. 혈액은헤파린튜브에수집후, 3,000 rpm에서 15분간원심분리하여획득한혈장 (plasma) 을분석에사용하였다. 채취한간조직의일부는 10% 중성포르말린에고정하여병리조직제작과정을거쳐 hematoxylin&eosin(h&e) stain 후간조직의지질침착정도를확인하였고, 나머지조직은 70 C 에냉동보관한후분석에사용하였다. 혈장에서 ApoB/ApoA1 ratio는 Enzyme-Linked Immunosorent Assay(ELIA) Kit for Apolipoprotein A1과 ApoB(Cloud-Clone Corp, Houston, TX, UA) 를각각측정하여 ratio 값을구하였고, 렙틴 (leptin) 의농도는 Quantikine Human Leptin Immunoassay(R&D ystem, Inc., Minneapolis, MN, UA) kit로측정하였으며, FA(fatty acid synthase) 는 MOUE Fatty Acid ynthase ELIA kit(cusaio, Wuhan, China) 를사용하였다. 간조직중의지질분석간의총지질은간조직을 Folch법으로추출한후정량하였으며, 추출한간지질을시료로하여간의총콜레스테롤 (Biovision Cholesterol Quantitation kit, Bio-Vision Inc.,
3 복분자와홍삼의콜레스테롤개선효과 1493 Mountain View, CA, UA) 과중성지방 (Triglyceride Fluorometric Assay Kit, Cayman, Ann Aror, MI, UA) 양을측정용 kit를사용하여측정하였다. RNA 분리간조직으로부터 RNA를추출하기위하여실험동물의간 20 mg을 RNA 추출시약 (RNAiso PLU, Takara, Otsu, Japan) 1 ml에넣고, homogenizer로균질화한후상온에 5분동안방치하였다. 이후 chloroform 200 µl를넣어 20 초간 vortex 하였고 15,000 rpm으로 10분동안원심분리한후상층액을새로운튜브에옮겼다. 상층액과동량으로 isopropanol을첨가한다음 10분동안방치한후이를다시 15,000 rpm에서 10분동안원심분리하여 RNA 침전물을획득하였다. RNA 침전물을 0.1% diethyl pyrocaronate (DEPC) 와혼합한 75% 에탄올을넣어 washing 하여 15,000 rpm에서 5분동안원심분리한후에탄올을제거하여실온에서침전물을건조시켜 0.1% DEPC water에녹였다. RNA 농도 (1 OD=40 µg/ml) 는 spectrophotometer (DUR 730 spectrophotometer, Beckman, Fullerton, CA, UA) 를이용하여 260 nm에서측정하였다. YBR Green Ⅰ kit(roche, Mannheim, Germany) 를이용하여 Light Cycler 2.0(Roche) 에서증폭하였다. 실험에사용된 primer의염기서열과 PCR 조건은 Tale 1과같으며유전자의정량분석은 Light Cycler oftware 4.0(Roche) 을이용하였다. 간의병리조직학적분석간조직내지방의축적을확인하기위해서적출된간조직의일부를 10% 중성포르말린에고정하였다. 병리조직학적검사를위한통상적인방법을사용하여파라핀포매한다음 4 µm의두께로절편을만들고슬라이드제작한후 H&E 염색을실시하고 Nikon Eclipse E200(Nikon, Kanagawa, Japan) 현미경을이용하여 NAH(nonalcoholic steatohepatitis) score를측정하였다. NAH score란비알코올성지방간염수치로거대수포성지방증, 간세포손상과혼합염증반응이라는 3가지병변이주로 3구역, 중심소엽에분포하는것을특징으로한다. NAH score 측정은 H&E 염색을한슬라이드를광학현미경으로조사하여지방증, 풍선변성, 소엽염증정도의점수를합산하여 5점이상이면 NAH로, 2점이하이면 NAH가아닌것으로판정하였다 (23). 실시간역전사중합효소연쇄반응 (real-time PCR quantification) First strand cdna를 50 mm Tris-HCl(pH 8.3), 75 mm KCl, 3 mm MgCl 2, 10 mm DTT(Invitrogen, Carlsad, CA, UA), 1 U/µL RNasin(Invitrogen), 1 mm each dntp, oligo(dt) ng과 MMLV reverse transcriptase(invitrogen) 200 U가함유된 20 µl의용액에서총 RNA 2 µg으로부터합성하였다. cdna를합성한뒤 HMG-CoA reductase, LDL 생성관련인자인 LDL receptor(ldlr) 와전사인자인 sterol regulatory element inding protein-2(rebp-2) mrna 발현정도와 HDL 관련인자인 scavenger receptor B1(R-B1) 및콜레스테롤배출관련 transporter인 ATP inding cassette transporter A1(ABCA1) mrna의발현정도를확인하였다. 실시간역전사중합효소연쇄반응은 Fasttart DNA Master 통계분석모든분석자료는평균 ± 표준오차 (mean±e) 로나타내었으며실험결과는 P 12.0K(P Inc., Chicago, IL, UA) 를이용하여 Duncan's multiple range test에의해 P<0.05 수준에서통계처리하였다. 결과및고찰체중증가량, 음수섭취량, 식이섭취량 C57BL/6J 5주령마우스에고콜레스테롤식이를급여하여복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군인 imvastatin을 12주간경구투여하여각군의체중증가량, 음수섭취량, 식이섭취량을 Tale 2에나타내었다. 체중증가량은정상대조군에비해고콜레스테롤식이군에서체중증가를보였으나, Tale 1. PCR primers and condition for real-time PCR Gene & A Nucleotide sequences HMG-CoA reductase LDL receptor REBP2 ABCA1 β-actin A A A A A CCTGACACTGAACTGAAGCG TCTTTCCAGAACACAGCACG AAGACGTGCTCCCAGGATGACTTC GTGCTCCTCATCTGACTTGTCCTTG ATATCATTGAAAAGCGCTAC ATTTTCAAGTCCACATCACT AGTCACAGCTCTGTGCTCTGG GTTTGTCTCCTTCGAAATGTCA AGAGAAGCTGTGCTATGTT CACAGGATTCCATACCCAAG Length of PCR products (p) Annealing ( C)
4 1494 이민정 이수정 최혜란 이정현 정종태 최경민 차정단 황승미 박종혁 이주희 이태범 Tale 2. Effects of extracts of unripe lack rasperry and red ginseng supplementation on ody weight gain, water intake, and food intake in C57BL/6J mice fed a HCD for 12 weeks Group Normal CTL UBR250 UBR125+RG125 imvastatin Initial ody weight (g) 20.92±0.44 N 20.66± ± ± ±0.34 Final ody weight (g) 28.76±0.72 N 30.07± ± ± ±0.75 Body weight gain (g/90 days) 0.65±0.04 N 0.78± ± ± ±0.04 Water intake (g) 27.08±0.64 a 25.76±0.41 a 23.67± ± ±0.69 a Food intake (g) 18.8±0.24 N 20.5± ± ± ±1.42 1) Normal: normal group, CTL: high cholesterol diet, UBR250: high cholesterol diet+unripe lack rasperry water extract 250 mg/kg, UBR125+RG125: high cholesterol diet+unripe lack rasperry water extract 125 mg/kg+red ginseng 125 mg/kg, imvastatin: high cholesterol diet+imvastatin 10 mg/kg. Values are expressed as mean±e (n=9). N: not significant. Different superscript letters (a,) in the same column indicate significant differences etween groups at P<0.05 y Duncan's multiple range test. 고콜레스테롤식이군과비교하였을때복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군간의체중증감, 식이섭취량에서는큰차이를보이지않았다. 간조직중의지질분석 C57BL/6J 5주령마우스에복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군인 imvastatin을 12주간실험식이를급여한후간조직의지질함량에미치는영향은 Tale 3과같다. 간조직중에정상대조군과비교했을때고콜레스테롤식이군에서 total lipid와 total cholesterol의양이유의성있게증가되었다. 증가된고콜레스테롤식이군에비해 total lipid와 total cholesterol은양성대조군을처리한그룹에서각각 26.6%, 22.8% 의유의성있는감소결과를보여주었다. 고콜레스테롤식이군과비교하였을때 total cholesterol은복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군에서각각 26.2%, 31.7% 의감소를나타내었으며, 이는복분자와홍삼복합투여군의부가적효과 (additive effect) 를나타내는것으로확인하였다. Triglyceride는투여군간의차이를나타내지않았다. Tale 3. Effects of extracts of unripe lack rasperry and red ginseng supplementation on hepatic total lipid, total cholesterol and triglyceride in C57BL/6J mice fed a HCD for 12 weeks Group Normal CTL UBR250 UBR125+RG125 imvastatin Total lipid (mg/g tissue) 0.06±0.01 c 0.15±0.02 a 0.11± ± ±0.04 Total cholesterol (mg/g tissue) 1.64±0.07 c 3.50±0.22 a 2.58± ± ±0.13 Triglyceride (mg/g tissue) 329.5± ± ± ±17.53 a 244.3±13.6 c Values are expressed as mean±e (n=9). Different superscript letters (a-c) in the same column indicate significant differences etween groups at P<0.05 y Duncan's multiple range test. 간의병리조직학적관찰각실험군들의간조직의병리조직학적변화는 Fig. 1과같다. 일반사료를먹은정상대조군은모든개체에서간에유의한병변과지방간이관찰되지않았다. 반면비만이유도된고콜레스테롤식이군에서는간세포내크고작은공포모양의지방구가침착되어간손상과지방간소견이관찰되었다 (Fig. 1). 병리조직학적검사를위하여통상적병리조직을제작한다음 H&E 염색을실시한후먼저 NAH score 를실시하였다 (Fig. 1). NAH score는비알콜성지방간염을말하며알코올성간질환에서보이는병리학적인특징을수치화한결과로서, 본실험그룹의 NAH score는정상대조군 0.2±0.14, 고콜레스테롤식이군 5.8±0.83, 복분자미숙과추출물투여군 2.6±0.50, 복분자미숙과물추출물과홍삼농축액복합투여군 1.4±0.53, 양성대조군은 3.1±0.60 으로, 복분자미숙과물추출물과홍삼농축액복합투여군이고콜레스테롤식이군에비교하여비알콜성지방간염의점수가유의적으로낮게나타났다. 복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군에서는고콜레스테롤식이군에비교하여간손상의정도가현저히감소되어있으며, 간세포내크고작은공포모양의지방구가현저히감소되었음을확인하였다. 고콜레스테롤식이로비만을유도하고대조약물로 imvastatin을투여한양성대조군에서발견된간세포내크고작은공포모양의지방구가현저히줄어들었다. 병리조직학적검사결과고콜레스테롤식이로비만이유도된군에서지방간병변이유의하게유발되어있는것을확인하였으며, 복분자미숙과추출물만투여한군과복분자미숙과물추출물과홍삼농축액복합투여군모두에서지방세포침윤과같은지방간병변의감소를확인하였다. 그중에서복분자미숙과물추출물과홍삼농축액복합투여군은고콜레스테롤식이군보다간세포내지방구가현저히줄어든것을확인할수있었고, 양성대조군보다지방세포침윤과같은지방간병변의감소가확인되었다. 간조직내 LDL과 HDL 관련유전자에미치는영향 C57BL/6J 5주령마우스에복분자미숙과추출물투여군,
5 복분자와홍삼의콜레스테롤개선효과 1495 Non-alcoholic steatohepatitis (NAH) score d a Normal CTL UBR250 UBR125+ simvastatin RG125 c Fig. 1. NAH score and histologic findings of liver tissue y the extracts of unripe lack rasperry and red ginseng treatment in hyperlipidemic mice fed the HCD for 12 weeks. NAH, non-alcoholic steatohepatitis. H&E stain, 400. cale ar=20 µm. Values are expressed as mean±e (n=9). Different letters (a-d) aove the ars indicate significant differences etween groups at P<0.05 y Duncan's multiple range test. 복분자와홍삼복합투여군과양성대조군인 imvastatin을 12주간경구투여한후에간조직내에서콜레스테롤관련유전자발현을조사하였다 (Fig. 2). HMG-CoA reductase는콜레스테롤생합성과정에중요하게작용하는효소이다. 현재동맥경화치료에사용되고있는 statin 계열의약물들은 HMG-CoA reductase의저해제로작용하고있으며, HMG-CoA reductase의활성은감소시키지만감소된콜레스테롤에대한항상성유지를위해 HMG-CoA reductase 유전자의발현은증가하게된다 (24). 따라서 HMG-CoA reductase의활성을조절하면혈중콜레스테롤의수치를조절할수있다는사실을바탕으로복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군에서고콜레스테롤식이군과비교하였을때각각 2.6배, 1.8배, 3.0배증가로양성대조군이가장많이증가하였지만복분자미숙과추출물도비슷한효과를보였다. 복분자미숙과추출물이 HMG-CoA reductase를저해함으로써활성을감소시키고, 이것이원인이되어결과적으로간에공급되는콜레스테롤의양이감소하는현상을보상하기위해 HMG-CoA reductase mrna 의발현이증가되는것으로생각된다 (25). uzuki 등 (26) 의연구결과에서도 C57BL/6 mice에녹차추출물을섭취시켰을때고지방및고당질 (sucrose) 식이에의해혈장콜레스테롤농도가상승하는것을억제시키는효과가관찰되었으며, 이는녹차가 HMG-CoA reductase 활성을억제하였기때문이라고설명하였다. 혈중지단백질은 LDL과 HDL로나뉘는데 LDL은혈관에쌓이는지질단백질로서혈중콜레스테롤의약 3/4를형성하고 (27) 간에서조직과세포로콜레스테롤을운반한다. 간에서의 LDLR은혈중의 LDL cholesterol과 IDL cholesterol 을간으로흡수하여다시담즙의형태로재흡수되도록한다. 또한혈중콜레스테롤을제거하고세포내콜레스테롤 양에따라발현이조절되어균형을유지하는데중요한역할을한다. LDLR의발현은콜레스테롤농도를낮출뿐만아니라세포내콜레스테롤항상성을유지하기위해 HMG-CoA reductase의발현을증가시킨다고알려져있다 (24). 포화지방과콜레스테롤의급여는혈중의 LDLR의활성을낮아지게하는데이와같이본실험에서도정상대조군에비해고콜레스테롤식이군에서 LDLR 활성이떨어졌다. 반면에복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군에서콜레스테롤식이군과비교하였을때각각 6.7배, 2.6배, 2.3배증가하여복분자미숙과추출물투여군이가장높은 mrna 발현을보였다. 이는 LDLR 발현을높여혈중의콜레스테롤수치를낮추는기작으로작용했을것으로추측된다. 복분자는생리활성물질의일종인폴리페놀과플라본 (flavone) 이풍부하게함유되어있는데, 폴리페놀중 ellagic acid 및 gallic acid 와홍삼의사포닌계열의 ginsenoside 중에서 Rg2, Rd, Rg3 등은혈중콜레스테롤의함량을낮춰고지혈증과동맥경화에예방효과가있는것으로알려져있다 (11,28,29). Bursill 등 (30) 의연구에서토끼에서카테킨을다량함유한녹차추출물의투여시 LDLR이증가하였다는보고와일치하는결과를얻었다. 혈중콜레스테롤이증가하면 LDLR 유전자발현을조절하는 REBPs의발현이증가하고, 증가된 REBPs 유전자는 LDLR의발현을증가시켜세포내로의콜레스테롤흡수를촉진하여혈중콜레스테롤농도를낮춘다 (24). REBPs 는 LDLR 외에도지방합성효소, HMG-CoA reductase 발현을조절한다 (31). REBPs 유전자는 REBP-1 과 REBP- 2로나눠지는데 REBP-1은지질대사관련중성지방과인지질의생합성에관련된유전자의조절에관여하며, REBP- 2는콜레스테롤의생합성과대사에관련된유전자를조절한다 (32). 실험결과고콜레스테롤식이군에비해복분자미숙
6 1496 이민정 이수정 최혜란 이정현 정종태 최경민 차정단 황승미 박종혁 이주희 이태범 A D B E C Fig. 2. Effects of extracts of unripe lack rasperry and red ginseng on hepatic mrna levels of HMG-CoA reductase, LDL receptor, REBP-2, ABCA1, and R-B1 genes in HCD fed mice for 12 weeks. The level of mrna expression was determined y real-time RT-PCR quantification and normalized y that of mrna β-actin, which was used as a control for RNA. Values are expressed as mean±e (n=9). Different letters (a-c) aove the ars indicate significant differences etween groups at P<0.05 y Duncan's multiple range test. 과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군모두유의적으로증가하였으며, 특히복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군에서는 4배이상의발현률을보여콜레스테롤대사에관여하여유전자를조절할것으로사료된다. 콜레스테롤유출 (cholesterol efflux) 에관여하는 transporter인 ABCA1 유전자의발현또한콜레스테롤대사에있어매우중요하며콜레스테롤을세포외로분비시켜분비된콜레스테롤이간에서담즙산으로바뀌어체외로배출하는역할을담당한다 (33). 따라서본연구에서는복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군에서 ABCA1 유전자의발현이높아졌으나유의적인차이는보이지않았다. Lee 등 (11) 의연구에의하면위장관세포주에복분자미숙과추출물을 100 µg/ml 처리한결과, ABCA1의발현이농도의존적으로증가됨을보고하였다. 본연구에서복분자미숙과 추출물이 ABCA1 유전자발현을 1.6배증가시키는것으로나타나혈중콜레스테롤을배출시키고, 혈중에서 free Apo A1에콜레스테롤을전달하는기전에중요한역할을할것으로생각된다. R-B1은체내콜레스테롤대사에있어서 HDL의선택적흡수에관여하며간과지방대사조직에가장많이분포한다 (34). 기존의연구자들에의해 R-B1 유전자는체내의콜레스테롤을간을통해체외로배출하는역할을담당하며이러한기능을통해뇌심혈관계질환의원인이되는동맥경화에대응하는기작을가지는걸로알려졌다 (35). 복분자미숙과추출물투여군과복분자미숙과물추출물과홍삼농축액복합투여군에서 R-B1 유전자의발현이 3.2 배증가하여혈중 HDL 농도를올리는데중요한역할을할것으로사료된다. 폴리페놀중 caffic acid와 ferulic acid가 ABCG1과 R-B1의발현을증가시켜 HDL 콜레스테롤을증가시킨다고보고하였고 (36), resvertrol이 ABCA1의발현을증가시켜콜레스테롤배출을촉진시킨다고보고된바
7 복분자와홍삼의콜레스테롤개선효과 1497 Tale 4. Effects of extracts of unripe lack rasperry and red ginseng supplementation on ApoB/ApoA1 ratio in C57BL/6J mice fed a HCD for 12 weeks ample ApoB (ng/ml) ApoA1 (ng/ml) Normal CTL UBR250 UBR125+RG125 imvastatin 0.57±0.02 a 0.43± ± ± ± ±0.06 a 1.39± ±0.12 a 1.99±0.09 a 1.68±0.18 a Values are expressed as mean±e (n=9). Different superscript letters (a,) in the same column indicate significant differences etween groups at P<0.05 y Duncan's multiple range test. 있다 (37). 홍삼의주성분인진세노사이드중 R1이동맥경화유도세포주에서콜레스테롤배출을촉진한다는보고도있다 (38). ApoB는 LDL을구성하는지질단백질로 chylomicron에존재하며중성지방이풍부한초저밀도지질단백과저밀도지질단백의체내양을반영하고 ApoA1은 HDL의가장큰구성요소이다. Apolipoprotein B/Apolipoprotein A1 ratio(apob/apoa1 ratio) 는이상지질혈증, 비만, 대사성질환, 심혈관질환의위험도를예측하는데유용한임상적지표로알려져있다. 간으로의비에스테르화지방산 (nonesterified fatty acid) 유입이증가하는경우간에서의 ApoB 분비가증가되고이화작용 (cataolism) 에장애가생겨 ApoB의상승을일으킨다. 최근연구결과에의하면 LDLcholesterol보다는 ApoB가더중요하며 LDL-c/HDL-c보다 ApoB/ApoA1 ratio가더중요하다고발표하였다 (39). 복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군모두에서고콜레스테롤식이군과비교하여 ApoB/ApoA1 ratio가유의적으로감소하는경향을보였고, 특히복분자미숙과물추출물과홍삼농축액복합투여군에서가장높은감소율을나타내었다 (Tale 4). 이결과로미루어보아복분자와홍삼복합투여가콜레스테롤개선에효과가있는것으로사료된다. Leptin (pg/ml) c a 0 Normal CTL UBR250 UBR125+ simvastatin RG125 Fig. 3. Effects of extracts of unripe lack rasperry and red ginseng on plasma leptin level in mice fed with HCD. Values are expressed as mean±e (n=9). Different letters (a-c) aove the ars indicate significant differences etween groups at P<0.05 y Duncan's multiple range test. 하게증가하였으며, 홍삼과상엽복합투여군에서유의성있게감소하여 leptin의저항성이증가하였다는보고가있다 (41). 복분자미숙과추출물은 ellagic acid, ferulic acid, gallic acid, kaempferol, luteolin, quercetin, resveratrol, rutin 등다양한폴리페놀을함유하고있는데 (12), 이중 gallic acid가고지방식이동물모델에서콜레스테롤저하및혈청 leptin을억제한다고보고한바있다 (42). 또한홍삼은 Rg1, R1, R2 및 Rg3 등다양한진세노사이드를함유하고있는데, 이중 R1이비만동물모델에서염증성사이토카인을억제하고 p-tat3 전사인자에의해 leptin의함량을증진시킨다고보고하였다 (43). 지방산합성효소 (fatty acid synthase, FA) 는 ATP 등의 nucleoside triphosphate를요구하지않고 condensation 반응을촉매시키며간에서합성된지방산은중성지방으로전환되어초저밀도리포단백질 (very low density lipoprotein, VLDL) 의형태로혈관을순환하며지방조직에중 40 a c a 혈장의지질대사관련효소측정 Leptin은지방세포에서분비되어체지방을일정하게유지하기위한호르몬으로혈액순환을통해 adipocyte에서분비되며식욕조절인자로지방조직이많을수록혈중 leptin 의농도는증가하게되는데이는 leptin 작용에대한저항성때문이다 (40). Leptin의농도는고콜레스테롤식이군에서가장높이나타났으며, 투여군모두에서감소하였지만복분자미숙과물추출물과홍삼농축액복합투여군에서만유의적으로감소하였다 (Fig. 3). 본실험은복분자미숙과물추출물과홍삼농축액복합투여군의농도가가장낮게나타났으나체중과는상관관계를보이지않았다. 이와같은연구결과로홍삼과상엽을복합투여하였을때체중감소는나타나지않았으나혈중 leptin의농도는고과당식이에서현저 FA (pg/ml) a 0 Normal CTL UBR250 UBR125+ simvastatin RG125 Fig. 4. Effects of extracts of unripe lack rasperry and red ginseng on plasma fatty acid synthase (FA) level in mice fed with HCD. Values are expressed as mean±e (n=9). Different letters (a,) aove the ars indicate significant differences etween groups at P<0.05 y Duncan's multiple range test.
8 1498 이민정 이수정 최혜란 이정현 정종태 최경민 차정단 황승미 박종혁 이주희 이태범 성지방을전달한다. FA의발현은 Fig. 4에나타내었다. 복분자미숙과추출물투여군, 복분자미숙과물추출물과홍삼농축액복합투여군과양성대조군모두고콜레스테롤식이군에비해유의적으로낮아졌다. 이와같이복분자미숙과추출물투여군과복분자미숙과물추출물과홍삼농축액복합투여군은지방산합성효소를저해함으로써고콜레스테롤식이를급여한마우스의체내지질저하에기여한것으로사료된다. Wang 등 (44) 은녹차 catechin의 galloyl moiety 가 FA의활성을억제한다고보고하였고, Yasui 등 (45) 또한 EGCG 를제외한녹차의수용성성분역시 Bal/c mice의간에서 FA, HMG-CoA reductase 및 acetyl-coenzyme A caroxylase alpha 등지질대사에관련하는효소의발현을낮추어혈중지질을낮추었다는연구결과를보고하였다. 요 본연구는복분자미숙과물추출물과홍삼농축액으로 C57BL/6J 수컷마우스를이용하여콜레스테롤억제효과및지질대사에미치는영향을살펴보고, 기능성식품으로의가능성을알아보았다. 실험동물은 C57BL/6J 수컷마우스를사용하였으며, 12주동안고콜레스테롤식이를급여하면서복분자미숙과물추출물과홍삼농축액을경구투여하였다. 그결과로고콜레스테롤식이군과비교하였을때복분자미숙과추출물과홍삼농축액식이군에서체중증가량, 식이섭취량에는변화가없었다. 콜레스테롤합성의가장중요한기작인 LDL receptor와 REBP2 발현에서는복분자미숙과추출물투여군과복분자와홍삼복합투여군모두유의적으로증가하여세포안으로의 LDL 흡수를촉진시킴으로써체내콜레스테롤을낮추는것으로판단된다. HDL 관련유전자발현에서도복분자미숙과추출물투여군과복분자와홍삼복합투여군에서 HDL uptake 유전자인 R-B1의발현을증가시켜콜레스테롤개선효과를보였다. 또한간의형태학적변화에서는고콜레스테롤식이군과비교하였을때복분자미숙과물추출물과홍삼농축액복합투여군에서지방형성이현저히줄어들었고, leptin과 FA의농도를측정한결과유의적으로감소하였다. 결과적으로복분자미숙과물추출물과홍삼농축액복합투여가콜레스테롤과고지혈증예방에긍정적인효과를보일것으로사료된다. 약 감사의글 본연구는산업통산자원부의지역특화기술융복합연구지원사업의 2013년도연구비지원으로이루어졌으며이에감사드립니다. REFERENCE 1. Lim, hin H, ong JH, Kwak H, Kang M, Yoon JW, Choi H, Cho I, Park K, Lee HK, Jang HC, Koh KK Increasing prevalence of metaolic syndrome in Korea. Diaetes Care 34: MHWK Yearook of Health and Welfare tatistics. Report of the Ministry of Health and Welfare, eoul, Korea. p Moon J Nutritional prolems of Korean. Korean J Nutr 29: Mckenny JM Lipid management: tools for getting to the goal. Am J Manag Care 7: Miettinen TA Cholesterol asorption inhiition: a strategy for cholesterol-lowering therapy. Int J Clin Pract 55: hin MK, Han H Effects of methanol extracts from amoo (Pseudosasa japonica Makino) leaves extracts on lipid metaolism in rats fed high fat and high cholesterol diet. Korean J Dietary Culture 17: Eu G, Chun BY, Bandopadhyay R, Yoo NH, Choi DG, Yun J Phylogenic relationships of Ruus species revealed y randomly amplified polymorphic DNA markers. J Crop ci Biotech 11: eeram NP, Adams L, Zhang Y, Lee R, and D, cheuller H, Heer D Blackerry, lack rasperry, lueerry, cranerry, red rasperry and strawerry extracts inhiit growth and stimulated apoptosis of human cancer cells in vitro. J Agric Food Chem 54: Chen T, Hwang HJ, Rose ME, Nines RG, toner GD Chemopreventive properties of lack rasperries in N-nitrosomethylenzylamine-induced rat esophageal tumorigenesis: down regulation of cyclooxygenase-2, inducile nitric oxide synthase and c-jun. Cancer Res 66: Wang Y, Jiao H cavenging capacity of erry crops on superoxide radicals, hydrogen peroxide, hydroxyl radicals and singlet oxygen. J Agric Food Chem 48: Lee J, Lee MJ, Ko YJ, Choi HR, Jeong JT, Choi KM, Cha JD, Hwang M, Jung HK, Park JH, Lee TB Effects of extracts of unripe lack rasperry and red ginseng on cholesterol synthesis. Korean J Food ci Technol 45: Choi HR, Lee J, Lee JH, Kwon JW, Lee HK, Jeong JT, Lee TB Cholesterol lowering effects of unripe lack rasperry water extract. J Korean oc Food ci Nutr 42: Yang HM, Oh M, Lim, hin HK, Oh Y, Kim JK Antiinflammatory activities of Ruus coreanus depend on the degree of fruit ripening. Phytother Res 22: Lee H, Park JH, Cho N, Yu HJ, You K, Cho CW, Kim DC, Kim YH, Kim KH ensory evaluation and ioavailaility of red ginseng extract (Rg1, R1) y complexation with γ-cyclodextrin. Korean J Food ci Technol 41: Yokozawa T, Koayashi T, Oura H, Kawashima Y tudies on the mechanism of the hypoglycemic activity of ginsenoside-r2 in streptozotocin-diaetic rats. Chem Pharm Bull (Tokyo) 33: Joo CN, Koo JH Biochemical study of some parmacological effects of Panax ginseng C. A. Meyer. Korean Biochem J 13: Yoon H, Joo CN tudy on the preventive effect of ginsenosides against hypercholesterolemia and its mechanism. Korean J Ginseng ci 17: Kang BH, Koo JH, Joo CN Effect of saponin fraction of Panax ginseng C. A. Meyer on lood serum lipoprotein distriution of cholesterol fed raits. Korean J Ginseng ci 10:
9 복분자와홍삼의콜레스테롤개선효과 Molcányiová A, tancáková A, Javorský M, Tkác I Beneficial effect of imvastatin treatment on LDL oxidation and antioxidant protection is more pronounced in comined hyperlipidemia than in hypercholesterolemia. Pharmacol Res 54: ong G, Liu J, Zhao Z, Yu Y, Tian H, Yao, Li G, Qin imvastatin reduces atherogenesis and promotes the expression of hepatic genes associated with reverse cholesterol transport in apoe-knockout mice fed high-fat diet. Lipids Health Dis 10: Zhang X, Mao, Luo G, Wei J, Berggren-öderlund M, Nilsson-Ehle P, Xu N Effects of imvastatin on apolipoprotein M in vivo and in vitro. Lipids Health Dis 10: Lei YF, Chen JL, Wei H, Xiong CM, Zhang YH, Ruan JL Hypolipidemic and anti-inflammatory properties of Aacopterin A from Aacopteris penangiana in high-fat diet-induced hyperlipidemia mice. Food Chem Toxicol 49: Neuschwander-Tetri BA, Clark JM, Bass NM, Van Natta ML, Unalp-Arida A, Tonascia J, Zein CO, Brunt EM, Kleiner DE, McCullough AJ, anyal AJ, Diehl AM, Lavine JE, Chalasani N, Kowdley KV Clinical, laoratory and histological associations in adults with nonalcoholic fatty liver disease. Hepatology 52: Pal, Ho N, antos C, Duois P, Mamo J, Croft K, Allister E Red wine polyphenolics increase LDL receptor expression and activity and suppress the secretion of ApoB100 from human HepG2 cells. J Nutr 133: Vinson JA, Teufel K, Wu N Red wine, dealcoholized red wine, and especially grape juice, inhiit atherosclerosis in hamster model. Atherosclerosis 156: uzuki T, Kumazoe M, Kim Y, Yamashita, Nakahara K, Tsukamoto, asaki M, Hagihara T, Tsurudome Y, Huang Y, Maeda-Yamamoto M, hinoda Y, Yamaguchi W, Yamada K, Tachiana H Green tea extract containing a highly asorent catechin prevents diet-induced lipid metaolism disorder. ci Rep 3: Mahley RW, Innerarity TL, Rall C Jr, Weisgrader KH Plasma lipoproteins: apoprotein structure and function. J Lipid Res 25: Kim EJ, Lee HI, Chung KY, Noh YH, Ro YT, Koo JH The ginsenoside-r2 lowers cholesterol and triacylglycerol levels in 3T3-L1 adipocytes cultured under high cholesterol or fatty acids conditions. BMB Rep 42: Lee, Lee M, Kim CT, Kim IH, Kim Y Ginsenoside Rg3 reduces lipid accumulation with AMP-activated protein kinase (AMPK) activation in HepG2 cells. Int J Mol ci 13: Bursill CA, Aey M, Roach PD A green tea extract lowers plasma cholesterol y inhiiting cholesterol synthesis and upregulating the LDL receptor in the cholesterol-fed rait. Atherosclerosis 193: Magaña MM, Koo H, Towle HC, Osorne TF Different sterol regulatory element-inding protein-1 isoforms utilize distinct co-regulatory factors to activate the promoter for fatty acid synthase. J Biol Chem 275: himano H terol regulatory element-inding proteins (REBPs): transcriptional regulators of lipid synthetic genes. Prog Lipid Res 40: Tsujita M, Wu CA, Ae-Dohmae, Usui, Okazaki M, Yokoyama On the hepatic mechanism of HDL assemly y the ABCA1/apoA-I pathway. J Lipid Res 46: Brundert M, Heeren J, Bahar-Bayansar M, Ewert A, Moore KJ, Rinninger F elective uptake of HDL cholesteryl esters and cholesterol efflux from mouse peritoneal macrophages independent of R-BI. J Lipid Res 47: Krause BR, Auerach BJ Reverse cholesterol transport and future pharmacological approaches to the treatment of atherosclerosis. Curr Opin Investig Drugs 2: Uto-Kondo H, Ayaori M, Ogura M, Nakaya K, Ito M, uzuki A, Takiguchi, Yakushiji E, Terao Y, Ozasa H, Hisada T, asaki M, Ohsuzu F, Ikewaki K Coffee consumption enhances high-density lipoprotein-mediated cholesterol efflux in macrophages. Circ Res 106: Berrougui H, Grenier G, Loued, Drouin G, Khalil A A new insight into resveratrol as an atheroprotective compound: inhiition of lipid peroxidation and enhancement of cholesterol efflux. Atherosclerosis 207: Wang X, Mu H, Chai H, Liao D, Yao Q, Chen C Human immunodeficiency virus protease inhiitor ritonavir inhiits cholesterol efflux from human macrophage-derived foam cells. Am J Pathol 171: Walldius G, Jungner I The apob/apoa1 ratio: a strong, new risk factor for cardiovascular disease and a target for lipid-lowering therapy-a review of the evidence. J Intern Med 259: Behme MT Leptin: product of the oese gene. Nutr Today 31: Lee YJ, Kim HY, Yoon JJ, Lee M, Ahn YM, Kho JH, Kho MC, Lee H, Cho KM, Kang DG Beneficial effect of comination with Korean red ginseng and Morus ala in metaolic syndrome. Kor J Herology 27: Hsu CL, Yen GC Effect of gallic acid on high fat diet-induced dyslipidaemia, hepatosteatosis and oxidative stress in rats. Br J Nutr 98: Wu Y, Yu Y, zao A, Han M, Huang XF Central inflammation and leptin resistance are attenuated y ginsenoside R1 treatment in oese mice fed a high-fat diet. PLo One 9: e Wang X, ong K, Guo QX, Tian W The galloyl moiety of green tea catechins is the critical structural feature to inhiit fatty-acid synthase. Biochem Pharmacol 66: Yasui K, Paeng N, Miyoshi N, uzuki T, Taguchi K, Ishigami Y, Fukutomi R, Imai, Isemura M, Nakayama T Effects of a catechin-free fraction derived from green tea on gene expression of enzymes related to lipid metaolism in the mouse liver. Biomed Res 33: 9-13.
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationuntitled
Liver Plasma Dietary Cholesterol synthesis Bile FC CE CE CE LDLr CE CM-R VLDL CE CM FC Small Intestine Reverse Cholesterol Transport CE HDL CETP LDL CETP IDL FC CE LDLr Peripheral Tissue Fecal Sterol (cholesterol
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information02 (09-01-수정).hwp
J Korean oc Food ci Nutr 한국식품영양과학회지 2(), 199~1907(2013) http://dx.doi.org/.376/jkfn.2013.2..199 복분자미숙과물추출물의콜레스테롤개선효과 최혜란 이수정 이정현 권지웅 이희권 정종태 이태범 ( 재 ) 고창복분자연구소 Cholesterol-lowering Effects of Unripe Black
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationμ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
More informationμ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationTreatment and Role of Hormaonal Replaement Therapy
Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More informationuntitled
- 345 - - 346 - - 347 - - 348 - - 349 - - 350 - - 351 - - 352 - - 353 - - 354 - - 355 - - 356 - - 357 - - 358 - - 359 - - 360 - - 361 - 샘플발광억제율 샘플함량단위활성혈액샘플희석율표준품 실측샘플발광억제 샘플희석배율 비교활성 단위활성 혈액혈액 - 362 -
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information02 (05-17-수정).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 46(8), 910~918(2017) https://doi.org/10.3746/jkfn.2017.46.8.910 홍삼복합추출물의 AMPK 활성화를통한고지혈증개선 정하진 오승택 류천봉 최유라 이성미 전송희 전남대학교의과대학의과학과 Red Ginseng Alters Lipid Metabolism
More information박치영논문-1
HK-1000 55 DOI:10.3831/KPI.2008.11.3.055 HK-1000 A Study on the Effect of Herbal-acupuncture with HK-1000 Solution on Hyperlipidemia and Arteriosclerosis Induced Rats Park Chi-Young, Hong Kwon-Eui Dept.
More informationOverview -ingredient - mechanism 2. Biomarker 3. In vitro study 4. In vivo study 5. Human study 6. 기능성 인정서 7.기준규격 인정서
*CJ standard Mw 40500 standard Mw 8000 CJ CJ Chitosan 1. 70g Sprague Dawley 1 2. Stainless steel cage 3. Ingredient Basal Control CJ Sucrose Starch Casein DL-methionine Corn oil Lard Choline bitartarate
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information연구개발보고서초록 흑삼의콜레스테롤저하헬스케어드링크제상품화 Commercialization of healthcare drink for low-cholesterol from Black Ginseng 본연구개발최종목표는 흑삼의콜레스테롤저하헬스케어드링크제상품화 로고려인삼을가공
연구개발보고서초록 흑삼의콜레스테롤저하헬스케어드링크제상품화 Commercialization of healthcare drink for low-cholesterol from Black Ginseng 본연구개발최종목표는 흑삼의콜레스테롤저하헬스케어드링크제상품화 로고려인삼을가공처리하여특정성분이강화된흑삼의제조공정개선, 가공기술표준화확립, 흑삼의콜레스테롤저하효과를과학적이고체계적으로검증하고,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More informationmain.hwp
열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationKjcg007( ).hwp
25 Elderly People are the Major Target for Risk Reduction to Prevent Atherosclerotic Disease 동맥경화의정도 증상 (+) 증상 (-) 뇌졸중심근경색 위험인자 Hypercholesterolemia Hypertension Diabetes Mellitus Smoking Others 심장질환의고위험군이란?
More information전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More informationLehninger Principles of Biochemistry 5/e
David L. Nelson and Michael M. Cox LEHNINGER PRINCIPLES OF BIOCHEMISTRY Fifth Edition CHAPTER 17 Fatty Acid Catabolism 2008 W. H. Freeman and Company Chap. 17. Fatty acid oxidation 지방산의소화, 동원그리고운반 1. 식이성지방
More information노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : http://knrrb.knrrc.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과
한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationJkafm093.hwp
가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information(Microsoft PowerPoint - S13-3_\261\350\273\363\307\366 [\310\243\310\257 \270\360\265\345])
Cardiovascular Disease in Metabolic Syndrome 김상현 보라매병원내과 서울대학교의과대학내과학교실 Contents Metabolic syndrome and Cardiovascular system CVD Mortality Coronary artery disease Heart failure Atrial fibrillation Management
More informationePapyrus PDF Document
2008 년대한간학회학술연구기금당선과제발표 복부비만을가진한국인의내장지방세포에서 Adipokine 발현이비알코올지방간질환의진행정도에미치는영향 성균관대학교의과대학강북삼성병원내과 The effects of Adipokine expression in visceral fat tissue on Nonalcoholic liver disease progression in
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 -
- 1 - 주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 - 식품소비구조의변화가국민건강에미치는영향 硏究責任者 : 孟元在 ( 自然第 2 分科 ) 共同硏究者 : 洪熙玉 ( 祥明大學校兼任敎授 ) 1. 서론 2. 연도별식품소비변화추이 - 3 - (g/ / ) 1970 1980 1990
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information<B0E6C8F1B4EBB3BBB0FAC0D3BBF3B0ADC1C E687770>
개원의와함께하는임상강좌 2011 역류성식도질환제대로이해하기 Division of Gastroenterology, Department of Internal Medicine, Kyung Hee University College of Medicine, Seoul, Korea Jae-Young Jang, M.D., PhD. 개원의와함께하는임상강좌 2011 109 최신치료
More information슬라이드 제목 없음
물리화학 1 문제풀이 130403 김대형교수님 Chapter 1 Exercise (#1) A sample of 255 mg of neon occupies 3.00 dm 3 at 122K. Use the perfect gas law to calculate the pressure of the gas. Solution 1) The perfect gas law p
More informationBuy one get one with discount promotional strategy
Buy one get one with discount Promotional Strategy Kyong-Kuk Kim, Chi-Ghun Lee and Sunggyun Park ISysE Department, FEG 002079 Contents Introduction Literature Review Model Solution Further research 2 ISysE
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information歯기능성식품특허분석3.PDF
. - 199 - . 1. DB (IPC) 10938,,. KIPIRS, WIPS, KINIT I DB,,,,,,,,,,,,, IPC (A21, A23, A61, C12) 2450 2 1303.,, suplement food, health food, functional food, body control, biorhythm control, aging control
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information<3231B1C732C8A32DB8F1C2F75B315DC3D6C1BE2E687770>
대한내분비학회지 : 제 21 권제 2 호 2006 지상강좌 당뇨병과지질대사이상 연세대학교노화과학연구소 조홍근 Diabetes Mellitus and Disorder of Lipid Metabolism Hong Keun Cho Yonsei University Research Institute of Science for Aging 생활습관의변화로인해우리나라의당뇨병유병률이급속하게증가하고있다.
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : http://knrrb.knrrc.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More information발간등록번호 11-1543000-001029-01 콜레스테롤대사와경화성혈관질환퇴치를위한차즈기이용기술개발에관한연구 (Technical development with a Perilla frutescens Britton var. acuta Kudo targeting adverse cholesterol metabolism and atherosclerotic diseases)
More information<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
More information발간등록번호
발간등록번호 3. 보고서요약서 보고서요약서 - 2 - - 3 - 4. 국문요약문 - 4 - 5. 영문요약문 < SUMMARY > - 5 - 6. 영문목차 < CONTENTS > - 6 - - 7 - 7. 본문목차 목차 - 8 - - 9 - 제 1 장. 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 -
More information<BAF1B8B8C3DFB0E8C7D0BCFAB9D7BFACBCF62D323031322831302E3231292E687770>
대한비만학회 제5회 연수강좌 저칼로리 레시피를 활용한 저칼로리 식단 작성하기 김 우 정 강남세브란스병원 영양팀 비만인구는 전 세계적으로 급속히 증가되고 있으 며, 00년에는 005년 유병률의 배인 세계인구의 약 60% 정도가 과체중 또는 비만일 것으로 예측되기 도 한다. 00년 국민건강영양조사 결과에 따르면 우 리나라의 성인 비만 유병률은 998년 6. %에서
More information노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.atb.knrrc.or.kr http://aging.pharm.pusan.ac.kr/ Content
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information