354-07(07-55).fm
|
|
- 홍철 감
- 7 years ago
- Views:
Transcription
1 Kor. J. Microbiol. Biotechnol. Vol. 35, No. 4, (2007) 고광도와질소결핍이 Haematococcus pluvialis 의색소생합성에미치는영향 윤지현 곽인규 진언선 * 한양대학교생명과학과 Influence of High Light and Nitrate Deprivation on the Carotenoid Biosynthesis in Haematococcus pluvialis. Yun, Ji-hyun, In-kyu Kwak, and EonSeon Jin*. Department of Life Science, Hanyang University of Korea The unicellular green alga, Haematococcus pluvialis used as a biological production system for astaxanthin. It accumulates large amounts of the red ketocarotenoid astaxanthin when exposed to various environmental stress such as active oxygen species and high light intensities. To induce astaxanthin biosynthesis of H. pluvialis, cells were incubated in either nitrate free at 25 o C under continuous high light intensity (1,000 µmol photons m -2 s -1 ) for 2 days or high light stress only. Expressions of astaxanthin biosynthetic genes such as carotenoid hydroxylase, IPP isomerase and β-carotene ketolase were monitored under different culture conditions by using real time RT-PCR. All the subjected genes increased their expression under highlight and N- deprivation condition where a large amount of astaxanthin was accumulated. Key words: Haematococcus pluvialis, carotenoids, astaxanthin 서 단세포녹조류인, Haematococcus pluvialis 는활성산소에의한산화적스트레스, 고광도고염도, 고온등의배양조건에서 ketocarotenoid astaxanthin (3,3'-dihydroxy-β, β-carotene-4,4'-dione) 을다량으로축적한다 [9]. 일반적으로 carotenoid 는광수확색소로서중요한역할을하며, 과도한빛에의한광합성기관의광산화적손상에대한보호에도중요한역할을한다 [2]. 일반적으로 astaxanthin 이축적되는것은이생물체와이와연관된다른생물체들이환경적스트레스에대응하는생존전략기작이라고생각되고있다 [3]. 현재 H. pluvialis 내의다수의 carotenoid 생합성유전자들이분리되었고, 일부유전자들의특성이밝혀졌다 [4, 10, 11, 16, 17]. 하지만, 스트레스에대응하는 H. pluvialis 의분자적인방어기작은아직완전히보고되지않았다. Astaxanthin 은 red-orange 색소로자연계의여러생물체내에서강력한생물학적항산화제역할을한다. Astaxanthin 은인간의건강과영양에대해다양한잠재력과실용성을지니고있다. 이색소는항산화능력으로인해점점상업적관심이증가하고있으며, 이는제약과화장품산업에중요한요인으로작용한다 [9, 14]. 최근연구에서 astaxanthin 의항산화능력, 항염증성기능, 암과당뇨병에관한영향, 면역계와눈의건강등다른측면에서매우중요한활성을나타낸다고보고되고있다 [5,9,16]. 그리고미세녹조류인 H. 론 pluvialis는자연계에풍부하게존재하며, 항고혈압성능력과신경보호에대한잠재력등을포함하는인간건강증진에이용할수있다. Astaxanthin은 free astaxanthin, astaxanthin monoester, astaxanthin diester 세가지의형태로존재한다고알려져있는데 astaxanthin 의구조가 Fig. 1에나타나있으며, astaxanthin monoester는 3번탄소에지방산이결합되어있는형태이고 diester는각각고리구조의 3번탄소에지방산이결합되어있는형태이다. Fig. 2에서는 astaxanthin 생합성경로와관련효소들을보여주고있다. 이들생합성효소중에특히 β-carotene ketolase (BKT), isopentenyl pyrophosphate isomerase(ipp isomerase), carotenoid hydroxylase유전자들에대한발현양상을본연구에서집중적살펴보게되었다. BKT는 β-carotene을 canthaxanthin으로전환시키며, zeaxanthin을 astaxanthin으로전환시키는역할을한다. 그러므로이효소는 H. pluvialis의 astaxanthin 생합성에중요한역할을한다. IPP isomerase는 isoprenoid 전구체의생합성과관련있으며고광도의빛에의해발현량이증가한다 [17]. IPP isomerase는 IPP는가역적인이성질체의합성을촉매하여 dimethylallyl pyrophosphate 을생산하며, dimethylallyl pyrophosphate은 carotenoid의생합성과다른많은 long-chain isoprenoids가반응을시작할 *Corresponding author Tel: , Fax: esjin@hanyang.ac.kr Fig. 1. Astaxanthin structure.
2 CAROTENOID BIOSYNTHESIS IN HAEMATOCOCCUS PLUVIALIS 293 재료및방법 Fig. 2. Biosynthethic pathway of astaxanthin in Haematococcus pluvialis. Isopentenyl pyrophosphate; IPP, Dimethylally pyrophosphate; DMAPP, Phytoene synthesae; PSY, Phytoene desaturase; PDS, ζ-carotene desaturase; ZDS, Lycopene β cyclase; LYC, β-carotene ketolase; BKT, Carotenoid hydroxylase; CHY. 수있도록유도한다. Phytoene desaturase(pds) 와 ζ-carotene desaturase(zds) 는구조적으로나기능적으로비슷한효소이다. 이효소들은 phytoene 을 ζ-carotene 을거쳐 lycopene 으로전환시키는역할을한다. 광합성기관의 carotenoid 와 secondary carotenoid 는 2 환식화합물이다. Lycopene 에서 α- carotener 과 β-carotene 으로생합성경로가나누어질때 carotenoid 생합성에있어서중요한경로가되고, lycopene 에서 β-carotene 로의경로는 lycopene β-cyclases (LYC) 가촉매한다 [8]. Carotenoid hydroxylase 는 canthaxanthin 의초기형성을촉매하고, 그후 canthaxanthin 초기형성은 astaxanthin 으로전환된다 (Fig. 2). 그동안 astaxanthin 합성유전자들의단편적이고개별적인연구들이보고되었으나 [6, 11, 17] 본연구에서는고광도스트레스와더불어질소결핍스트레스에노출된 H. pluvilais 의생합성관련유전자변화를총체적으로살펴보기위해 Northern 및 Real-time PCR 을수행하여이들의발현양상을살펴보았다. 또한배양조건의차이로인한색소의변화를알아보기위해 HPLC 분석도수행하였다. Cell의배양액조성과 carotenoid 생합성유도본연구에사용된 Haematococcus pluvialis는 Texas 대학의 Culture Collection (UTEX) 에서구입되어배양된것으로인하대해양생물공학실험실로부터분양받았으며, MV(Mes- Volvox)medium에서배양되었다. MV medium에서배양되는영양생장단계의세포 (green cell) 의배양조건은 ph 6.7의배지에, 25 o C의온도와 15 µmol photons m -2 s -1 의지속적인광도로 120 rpm에서진탕배양하였다. MV medium의조성은다음과같다. Ca(NO 3 ) 2 4H 2 O, 11.8 mg/l; Na 2 glycerophosphate 5H 2 O, 6 mg/l; MgSO 4 7H 2 O, 4 mg/l; KCl, 5 mg/ L; NH 4 Cl, 2.67 mg/l; biotin, 25 µg/l; vitamin B 12, 15 µg/ L; PIV total solution(na 2 EDTA, mg/l; FeCl 3 6H 2 O, mg/l; MnCl 2 4H 2 O, mg/l; ZnCl 2, 0.03 mg/ L; CoCl 2 6H 2 O, mg/l; Na 2 MoO 4 2H 2 O, mg/l; MES 1.95 g/l. Astaxanthin 생합성이유도된세포 (red cell) 배양하기위하여지수성장기에있는 ( cell ml -1 ) cell 을 N free media인 Ca(NO 3 ) 2 4H 2 O와 NH 4 Cl 대신 CaCl 2 20 mg/l을첨가한 MV에접종하고 25 o C의온도조건과 1,000 µmol photons m -2 s -1 의광도를주어이틀동안배양하였다. 세포의수는 hemocytometer로측정하였다. 색소분석 Astaxanthin의색소분석은 HPLC(High Performance Liquid Chromatography) 를이용하였다. 샘플을 90% acetone으로 3 분간 homogenizer를이용하여색소를추출하고원심분리를 13,000 rpm로 2분간하여, 상층액만주사기필터 (0.2 µm nylon filter) 를이용해여과하였다. HPLC 분석을하기위해 20 µl의샘플을주입하였고분리시간은 25분동안진행되었다. HPLC는 Shimadzu 사의 LC-20A Prominence를이용하였다. Column은 Waters Spherisorb S5 ODS mm, 5 um Cartridge Column(Maple St. Milford, Massachusetts, USA) 을사용하였고 column 온도는 40 o C로하였다. 색소를분리하는용매로 0.1M Tris-HCl ph 8.0, acetonitrile, methanol, ethyl acetate가이용되었다. 기기가작동하는동안용매의농도는다음과같다 : 14% 0.1M Tris- HCl(pH 8.0), 84% acetonitrile, 2% methanol(0분 ~15분 ), 68% methanol and 32% ethyl acetate(15분 ~19분 ). 그후 6분의 post-run 동안은처음시작할때의용매농도와같다. Column 내의유속은분당 1.2 ml로지속되었다 [7]. 분리된 carotenoid와 astaxanthin ester form은 photodiode array detector(spd-m20a, Shimadzu) 를통해분석하였고인증된 standard로비교하였다. 피크를정량하기위해 ketocarotenoid 는 476 nm에서다른 carotenoid는 445 nm에서확인하였다. Astaxanthin standard는 Sigma-Aldrich에서구입하였고그밖에다른 standard는 DHI(Agern Allé, HØrsholm,
3 294 YUN et al. Table 1. Gene specific primers sets and PCR product characteristics. Primer Primer sequence (5'-3') Gene bank ID Actin forward GTGGACACCTCAGCGTTTAGC DV Actin reverse ACCATCAACAAGTGCGACATT Carotenoid hydroxylase forward GCGCGGGCGATGAGCACAG AY Carotenoid hydroxylase reverse GAGCATGGCGGGCAGTCCTTTGAT Phytoene desaturase forward GGACGGCGCCCCACCTGAG AY Phytoene desaturase reverse GGCCGGCGCAAACACCA IPP isomerase forward CGGGCAGTCGCAGGATGAGC AY IPP isomerase reverse ACGTTGGCCCGGATGAATAAGATG β-carotene ketolase forward CCAAATCAGGCTACCGACATCCAT D45881 β-carotene ketolase reverse GCCCCCAGCATTTGCATCACCACT Chlorophyll a,b binding protein forward TGAAGGACATGAAGACGAAAGAGC AY Chlorophyll a,b binding protein reverse GCGCAGCACAGGGATGG Denmark) 에서구입하였다. RNA 추출과 Real-time PCR 두가지조건의세포 (green과 red cell) 에서 total RNA 를추출하기위해 TRIzol reagent(invitrogen, California, USA) 를이용하였다. Reverse transcription으로부터 first strand의 cdna를얻기위해 Invitrogen의 superscript III Reverse Transcriptase kit(california, USA) 를제조사의설명서에따라사용하였다. 각조건에서추출한 6 µg의 total RNA를이용하여 cdna로합성하였다. 이렇게얻어진 cdna로 real-time PCR을수행하였다. Real-time PCR은 Thermal Cycler Dice TM Real Time System TP 800(Takara, Naginatahokocho, Koyto, Japan) 로수행하였으며. 증폭을확인하기위해 SYBR Premix Ex Taq TM ((Takara, Naginatahoko-cho, Koyto, Japan) 을사용하였다. PCR 조건은 95 o C에서 10초동안 (pre-denaturation) 1cycle, 95 o C에서 5초 (denaturation), 56 o C에서 45초동안 (annealing) 40 cycle로실행하였다. Primer 정보는 Table 1에정리하였고대조구로 actin 유전자를사용하였다. 결과및고찰 Astaxanthin 생합성이유도된 H. pluvialis 배양조건영양생장중의세포인 green cell 은 ph 6.7 인 MES-Volvox 배지에서온도 25±1 o C, 15 µmol photons m -2 s -1 의꾸준한광도로 growth chamber 에서배양하였다. Green cell 에서 red cell 로되기위해질소가결핍된배지에서 1000 µmol photons m -2 s -1 의꾸준한광도로 48 시간동안스트레스를주어배양하였다. Fig. 3a 에서녹색이었던세포가질소결핍배지에서높은광도를주어배양하였더니 Fig. 3b 와같이 astaxanthin 을합성한상태인 red cell 로바뀌었다. 세포질에서 astaxanthin 이생합성되어뭉쳐있는것을볼수있다. Fig. 3. Light micrographs of H. pluvialis at different culture condition. (A) Green cells were in MES-volvox growth medium at 25 under a continuous light intensity of 15 µmol photons m -2 s -1. (B) Red cells were incubated under light intensity 1000 µmol photons m -2 s -1, nitrate free medium for 48 h. 각조건에따른 H pluvialis의광합성색소변화각배양조건에따른광합성색소의변화를보기위해 HPLC를이용하여색소분석을하였다. Green cell에거의없던 peak들 (2, 9, 12) 이 red cell에서보여지고있다 (Fig. 4). 이들은 green cell에서 stress를받아유도된 astaxanthin 으로각각 astaxanthin, astaxanthin monoester, astaxanthin diester 로확인되었다. HPLC 결과로얻은각 carotenoid의정량을통해 total carotenoid에서 total astaxanthin과 lutein 그리고 β-carotene의비율을보았다. Total carotenoid를 100% 로기준하였을때, green cell에서 4.62% 이었던 total astaxanthin이 red cell에서 83.43% 로늘어난것을볼수있다. 반면, lutein은 42.83% 에서 7.53% 로, β-carotene은 13.32에서 2.64% 로 green cell 보다 red cell에서감소한것을볼수있다. 즉, total astaxanthin의비율이늘어난반면 lutein과 β-carotene의비율이줄어든것을볼수있다 (Fig. 5a). Total astaxanthin은 free astaxanthin, astaxanthin monoester, astaxanthin diester의 3가지그룹으로나뉜다 [15]. Total astaxanthin을 100% 로기준하였을때 monoester는 48.76% 에서 76.65% 로증가하였으며, free astaxanthin은
4 CAROTENOID BIOSYNTHESIS IN HAEMATOCOCCUS PLUVIALIS 295 Fig. 4. HPLC profiles of pigments in H. pluvialis. (A) Pigment profile of H. pluvialis before stress, (B) cells exposed to nitrogen deficiency and high light for 48 hrs. 1: neoxanthin 2: violaxanthin 3: astaxanthin free form 4: antheraxanthin 5: lutein 6: zeaxanthin 7: chlorophyll a 8: chlorophyll b 9: astaxanthin monoester 10: α-carotene 11: β-carotene 12: astaxanthin diester 세그룹의비율이각각약 5%, 70%, 25% 정도로존재하는것으로보고되고있으나 [12], 본실험에서는 Fig. 3b 처럼 astaxnathin 이축적중인 red cell 의경우각각의 astaxanthin ester 타입의조성이다르게나타나고있음을알수있다. 여러형태의 astaxanthin 의조성비는, 각 cell 을키우는배지의종류마다혹은환경조건에따라차이가나타나는것을알수있다. 고광도와질소결핍스트레스를받게되면 lycopene 에서 α-carotene 의경로가저해되어 lutein 합성이줄어들고 β- carotene 은하위경로인 astaxanthin 합성경로는가속화되어 β-carotene 의농도가줄어드는대신 astaxnthin 의합성이증가되고있다고유추할수있다. Fig. 5. Changes in carotenoid composition in green and red cell. Peak identification as given in Fig. 4. Changes in concentration of total astaxanthin, lutein, β-carotene (a) and astaxanthin (b). 17.9% 에서 11.9% 로, diester 그룹은 33% 에서 11.5% 로감소하는변화를보였다. Fig. 5b 는세가지 astaxanthin 형태의절대량을나타내고있다. Green cell 에서 free form 은 mg/l, astaxanthin monoester 에서는 mg/l, astaxanthin diester 에서 mg/l 의함량을보이고있으나, red cell 에서는각각 1.19 mg/l, 7.7 mg/l, 1.15 mg/l 로각각의농도가증가하였다. 완전하게 red cell 로전환되었을경우에 고광도와질소결핍스트레스에따른 astaxanthin 생합성관련유전자의발현 Real-time RT-PCR을통해 green cell와 red cell에서의 astaxanthin 생합성관련유전자의발현차이여부를보았다 (Fig. 7). Astaxanthin 생합성관련 gene인 isopentenyl pyrophosphate isomerase, β-carotene ketolase, carotenoid hydroxylase 유전자들의발현정도를정확하게정량하기위해 real-time RT-PCR을수행하였는데먼저각조건의 cell에서추출한 total RNA를 cdna로역전사하였다. 각유전자에대한고유의 primer를설정하여사용하였고 melting curve를분석하여단일밴드가나오는지확인하였다. Fig. 8 의 Real-time PCR 결과는 housekeeping gene인 actin과대조군인 green cell을기준으로하였을때의상대적정량을나타낸다. 기준점 1 보다클때는발현양의증가를, 낮을때는발현양의감소를의미한다. Carotenoid hydroxylase의경
5 296 YUN et al. 요 약 Fig. 6. HPLC chromatogram of pigments of H. pluvialis. Peak identification as given in Fig. 4. Fig. 7. Expression of astaxanthin biosynthesis genes calculated by quantitative Real-Time PCR. Each bar shows the relative expression using actin as the endogenous control. 1: actin 2: carotenoid hydroxylase 3: phytoene desaturase 4: isopentenyl pyrophosphate isomerase 5: β-carotene ketolase 6: chlorophyll a-b binding protein. 우 red cell 에서 green cell 보다약 20 배의높은발현율을보였고 phytoene desaturase 의경우는약 4 배, isopentenyl pyrophosphate isomerase 는 1.61 배, β-carotene ketolase 는 3.13 배의발현양의증가를보인반면, chlorophyll a-b binding protein(cab) 는 0.3 배로 red cell 보다 green cell 에서더높게발현되는양상을보였다. HPLC 를이용한색소분석에서광및질소결핍스트레스조건에서 total carotenoid 비율은 green cell 에서 red cell 이되면서증가하고, 반대로 total chlorophyll 은감소하는현상을보인다 (Fig. 6). 광스트레스에서는일반적으로엽록소의합성이감소되고더불어 Cab 유전자들의발현이줄어들기때문에 [7] 엽록소의농도가줄고더불어 Cab 유전자의발현이감소하고있다는것은세포가광스트레스를받고있다는강력한증거를제공한다. 이와같은조건에서 astaxanthin 합성경로에있는유전자들은생장하기좋은조건에서자란 green cell 일때보다고광도스트레스와질소결핍배지에서배양한 red cell 일때더높은발현을보이고있는것을확인함으로써 astaxanthin 생합성에관련한효소들의유전자가전사단계부터활성화되어 astaxanthin 생합성이촉진된다고사료되었다. H. pluviails는고광도와질소결핍배지조건에서 ketocarotenoid의일종인 astaxanthin을다량축적하는녹조류이다. 스트레스가없는조건에서키운 green cell과 astaxanthin이합성된 red cell을 HPLC를통해비교해본결과각색소의양이변화하는것을볼수있었다. 여러 ester 형태의 astaxanthin이생합성되고, zeaxanthin이늘어난반면, lutein과 β-carotene은감소하였다. 또한 total chlorophyll의양이줄어드는대신 total carotenoid의양이늘어남을보였다. H. pluvilalis에서찾아낸 astaxanthin 생합성경로에있는 carotenoid hydroxylase, phytoene desaturase, isopentenyl pyrophosphate isomerase, β-carotene ketolase 유전자는음성대조군인 chloroplast chlorophyll a-b binding protein와는달리 cell이성장하기좋은조건의상태보다 astaxanthin을생합성하기위해고광도의스트레스를받았을때더높은발현양상을보이는것을확인할수있었다. 감사의글 이연구는한국학술진흥재단의 2005 년도협동연구지원 ( 과제번호 : C0014) 에의하여이루어졌으며이에감사드립니다. REFERENCES 1. Arnon, D. I Copper enzymes in isolated chloroplasts. Polyphenoxidasein Beta vulgaris. Plant Physiol. 24: Bartley, G. E. and P. A. Scolink Pigment for photoprotection, visual attraction, and human health. Plant Cell. 7: Boussiba, S Carotenogenesis in the green alga Haematococcus pluvialis: Cellular physiology and stress response. Plant Physiol. 108: Grünewald, K., M. Eckert., J. Hirschberg. and C. Hagen Phytoene desaturase is localized exclusively in the chloroplast and upregulated at the mrna level during accumulation of secondary carotenoids in Haematococcus pluvialis (Volvocales, chlorophyceae). Plant Physiol. 122: Guerin, M., M. E. Huntley., and M. Olaizola Haematococcus astaxanthin: applications for human health and nutrition. Trends Biotechnol. 21: Huang, J. C., F. Chen. and G. Sandmann Stressrelated differential expression of multiple β- carotene ketolase genes in the unicellular green alga Haematococcus pluvialis. Journal of Biotechnol. 122: Jin, E. S., B. Feth. and A. Melis A Mutant of the green alga Dunaliella salina constitutively accumulates zeaxanthin under all growth conditions. Biothecnol. Bioeng.
6 CAROTENOID BIOSYNTHESIS IN HAEMATOCOCCUS PLUVIALIS : Jin, E. S., C. G. Lee, and J. E. W. Polle Secondary carotenoid accumulation in Haematococcus (chlorophyceae) biosynthesis, regulation and biotechnology. J. Microbiol. Biotechnol. 16: Kobayashi, M., Y. Kurimura., T. Kakizono., N. Nishio. and Y. Tsuji Morphological changes in the life cycle of the green alga Haematococcus pluvialis. J. Ferment. Bioeng. 84: Kobayashi, M Astaxanthin biosynthesis enhanced by reactive oxygen species in the green alga Haematococcus pluvialis. Biotech. Biopro. Eng. 8: Linden, H Carotenoid hydroxylase from Haematococcus pluvialis: cdna sequence, regulation and functional complementation. Biochim. Biophys. Acta. 1446: Lorenz, R. T. and G. R. Cysewski Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 18: Lotan, T. and J. Hirschberg Cloning and expression in Escherichia coli of the gene encoding β-4-c-oxygenase, that converts β-carotene to the ketocarotenoid canthaxanthin in Haematococcus pluvialis. FEBS. Lett. 364: Melis, A., M. Spangfort. and B. Andersson Lightabsorption and electrontransport balance between PSII and PSI in spinach chloroplasts. Photochem Photobiol. 45: Miao, F., D. Lu, M. Zeng, and Y. Li Charaterization of astaxanthin esters in Haematococcus pluvialis by liquid chromatography-atmospheric pressure chemical ionization mass spectrometry. Anal. Biochem. 352: Olaizola, M Commercial development of microalgal biotechnology: From the test tube to the marketplace. Biomol. Eng. 20: Steinbrenner, J. and H. Linden Light induction of carotenoid biosynthesis genes in the green alga Haematococcus pluvialis: Regulation by photosynthetic redox control. Plant Mol. Bio. 52: Sun, Z., F. X. Cunningham. and E. Gantt Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. Proc. Natl. Acad. Sci. USA 95: (Received Oct. 4, 2007/Accepted Nov. 20, 2007)
56(3)-14(하성호040).fm
Korean Chem. Eng. Res., 56(3), 376-380 (2018) https://doi.org/10.9713/kcer.2018.56.3.376 PISSN 0304-128X, EISSN 2233-9558 미세조류로부터의에너지효율적인 Astaxanthin 회수기술개발 김선영 오유관 *, 하성호 한남대학교화공신소재공학과 34054 대전광역시유성구유성대로
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More information<333020C0CEB8B8C1F8202D D61746F636F C3DFC3E2B9B020C1A6C1B620B0F8C1A42E687770>
한국산학기술학회논문지 Vol. 10, No. 1, pp. 194-199, 2009 Haematococcus pluvialis 로부터 Haematococcus 추출물제조공정에서효소처리가추출효율과항산화활성에미치는영향 인만진 1* Effect of Enzyme Treatments on the Extraction Efficacy and Antioxidant Activity
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information슬라이드 제목 없음
물리화학 1 문제풀이 130403 김대형교수님 Chapter 1 Exercise (#1) A sample of 255 mg of neon occupies 3.00 dm 3 at 122K. Use the perfect gas law to calculate the pressure of the gas. Solution 1) The perfect gas law p
More information한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과
한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information특허청구의 범위 청구항 1 Na-알지네이트(Na-alginate), 합성 제올라이트(synthetic zeolite)와 분말활성탄(powdered activated carbon) 을 혼합하여 2 ~ 6 %의 CaCl 2 용액에서 경화시켜 만들어진 직경 1 ~ 5 mm의
(51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) C02F 3/10 (2006.01) (21) 출원번호 10-2006-0053240 (22) 출원일자 2006년06월13일 심사청구일자 (56) 선행기술조사문헌 JP01207193 A KR1020030092674 A 2006년06월13일 (45) 공고일자 2007년10월29일
More information歯140김광락.PDF
2001 / Separation of Hydrogen Isotopes/Helium Using Gas Chromatography,,,, 150 196 C / He, H 2 D 2 Abstract In the hydrogen isotope facility and the fuel cycle of the fusion reactor, an effective means
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More informationÀ±½Â¿í Ãâ·Â
Representation, Encoding and Intermediate View Interpolation Methods for Multi-view Video Using Layered Depth Images The multi-view video is a collection of multiple videos, capturing the same scene at
More information51(2)-06.fm
Journal of the Korean Chemical Society 2007, Vol. 51, No. 2 Printed in the Republic of Korea f p ƒ š w er elk yw ½ Á y*» l, w w ywœw (2006. 12. 5 ) Separation of Caffeine and Catechin Compounds from Green
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information1
北 地 区 青 少 年 境 研 会 Международный детский симпозиум по проблемам экологии региона Северо-Восточной Азии. 1 2 5 6 7 9 1. 2. 11 12 13 13 14 15 16 . (Nature) 100.. 90%.. 3000 10% 385. 1 1, 500 2kg.........
More informationlastreprt(....).hwp
pheophytin Jukart.. 서론 재료및방법 . 650 nm (10). 3. 124 15 3 68 2 3 124 2, 3, 43 5, 5 23 (5). 4. 5 4 5 53. 650 nm (10),..,. 16 pheophytin Jukart.. IC 50 1mg/ml.. pheophytin Jukart.. IC 50 1mg/ml.
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More informationMicrosoft PowerPoint - ch03ysk2012.ppt [호환 모드]
전자회로 Ch3 iode Models and Circuits 김영석 충북대학교전자정보대학 2012.3.1 Email: kimys@cbu.ac.kr k Ch3-1 Ch3 iode Models and Circuits 3.1 Ideal iode 3.2 PN Junction as a iode 3.4 Large Signal and Small-Signal Operation
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information<C8B2BCBABCF62DB8D4B0C5B8AEBFCDB0C7B0AD2E687770>
먹거리와 건강 황성수 인도주의실천의협의회(humandoctor.org) 황성수 의사님의 글 http://humandoctor.org/technote/main.cgi?board=whang 서적 곰탕이 건강을 말아먹는다 로도 출판되어 있음. lightworker.kr 편집 1. 이 글을 읽는 분들에게 황성수의 먹거리와 건강 을 읽는 모든 분들에게 인사드립니다.
More informationKAERIAR hwp
- i - - ii - - iii - - iv - - v - - vi - Photograph of miniature SiC p-n and Schottky diode detector Photograph SiC chip mounted on a standard electrical package Photograph of SiC neutron detector with
More informationμ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More information(Microsoft PowerPoint - src.ppt [\300\320\261\342 \300\374\277\353] [\310\243\310\257 \270\360\265\345])
LC/MS, LC/MS/MS 기초개론 LC LC/MS(Liquid Chromatography/Mass Spectrometry) 액상의분석물질을기화및이온화하여고진공관에서원하는질량 (m/z) 이나질량범위만검출하여정량 정성분석하는시스템 High vacuum PC/Software Ion source Mass Analyzer Detector ESI APCI APPI
More information歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More informationBuy one get one with discount promotional strategy
Buy one get one with discount Promotional Strategy Kyong-Kuk Kim, Chi-Ghun Lee and Sunggyun Park ISysE Department, FEG 002079 Contents Introduction Literature Review Model Solution Further research 2 ISysE
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationVol.259 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M
2018.01 Vol.259 C O N T E N T S 02 06 28 61 69 99 104 120 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2018.1 3 4 2018.1 1) 2) 6 2018.1 3) 4) 7 5) 6) 7) 8) 8 2018.1 9 10 2018.1 11 2003.08 2005.08
More informationePapyrus PDF Document
Trans. of the Korean Hydrogen and New Energy Society(2013. 4), Vol. 24, No. 2, pp. 136~141 DOI: http://dx.doi.org/10.7316/khnes.2013.24.2.136 흡기관 분사식 수소 SI기관의 희박과급 적용에 관한 연구 이광주 1 ㆍ이종구 1 ㆍ이종태 2 1 성균관대학교
More information14.fm
Journal of the Korean Ceramic Society Vol. 44, No. 2, pp. 93~97, 2007. Preparation of High Purity Si Powder by SHS Chang Yun Shin, Hyun Hong Min, Ki Seok Yun, and Chang Whan Won Engineering Research Center
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) B09B 1/00 (2006.01) C09K 17/00 (2006.01) E02D 31/00 (2006.01) (21) 출원번호 10-2011-0016170 (22) 출원일자 2011년02월23일 심사청구일자 전체 청구항 수 : 총 9 항 2011년02월23일 (11)
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information43(1)-12(p.59-65).fm
The Korean Journal of Microbiology, Vol. 43, No. 1, March 2007, p. 59-65 Copyright 2007, The Microbiological Society of Korea w y x 1 y 1, * w t w w w y w w» w ³ e mw. x³ w y w 4% rice powder, 0.15% Bacto-peptone,
More informationSPOOBG_2008_v37n10_1363.hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 37(10), 1363~1368(2008) DOI: 10.3746/jkfn.2008.37.10.1363 연구노트 초음파처리를이용한 Haematococcus pluvialis로부터의아스타잔틴의추출및분석 김소영 1,2 조은아 1 유지민 1 인만진 3 채희정 1,2 1 호서대학교식품생물공학과, 식품기능안전연구센터
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information< 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ]
< 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 2010. 09. 28. 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ] 목 차 Ⅰ. 탐구주제 02 Ⅱ. 탐구하게된동기 02 Ⅲ. 배경이론 02 1. 유글레나의특징가. ph 나. 온도 Ⅳ. 선행연구고찰 03 1. 산소결핍과인체에미치는영향
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationuntitled
[ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information유용 천연 물질의 보고(寶庫)_ 광합성 미생물
유용천연물질의보고 ( 寶庫 )_ 광합성미생물 CJ 제일제당바이오연구소강창덕 광합성미생물은지구의무한자원인태양 ( 빛에너지 ), 물, 그리고이산화탄소를주영양원으로하여, 천연항암제를비롯한생리활성물질에서부터화석연료를대체할수있는바이오에너지까지인류에게다양한유용물질을제공할수있는무한잠재력을지닌친환경자연공장이다. 최근에는다양한광합성미생물들중에서특히 Algal Biotechnology
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과
한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information19(4)-03(33).fm
J. of Aquaculture Vol. 19(4) : 261-266, 2006 µ Journal of Aquaculture Korean Aquaculture Society ü paprika spirulina ƒƒ (Coreoleuciscus splendidus) tv k e w ½, 1, 1, * Ÿ w, 1 w wœw Effect of Dietary Supplementation
More informationuntitled
Chapter 5 Gases 3 5.1 2 NaN 3 (s) 2Na(s) + 3N 2 (g) Air bag 45.5L sodium azide?,,? 3 5.2 ? 1.,,, 2. P, V, n, T ( ) 3. 3 5.3 5.1,, = 1L = 10 3 cm 3 = 10-3 m 3 m=m n ( ) T k = t c + 273.15 : psi, mmhg, atm(
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information(72) 발명자 나리사꼬 마꼬또 일본 후꾸이껭 쯔루가시 와까이즈미쪼 1반찌 제이 엑스 닛코 닛세키 킨조쿠 가부시키가이샤 쯔루가 고오죠오 내 나까무라 야스오 일본 후꾸이껭 쯔루가시 와까이즈미쪼 1반찌 제이 엑스 닛코 닛세키 킨조쿠 가부시키가이샤 쯔루가 고오죠오 내 야마오
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) H01M 10/54 (2006.01) H01M 10/0525 (2010.01) B09B 3/00 (2006.01) H01M 4/36 (2006.01) (21) 출원번호 10-2011-0087017 (22) 출원일자 2011년08월30일 심사청구일자 2011년08월30일
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More informationmain.hwp
열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement
More information<313920C0CCB1E2BFF82E687770>
韓 國 電 磁 波 學 會 論 文 誌 第 19 卷 第 8 號 2008 年 8 月 論 文 2008-19-8-19 K 대역 브릭형 능동 송수신 모듈의 설계 및 제작 A Design and Fabrication of the Brick Transmit/Receive Module for K Band 이 기 원 문 주 영 윤 상 원 Ki-Won Lee Ju-Young Moon
More information33 lgae Vol. 1(3), 6 고있다(오와이1998). 호주, 미국 및 이스라엘은 상업적으 로 Dunaliella를 대량배양하고 있고, 이 미세조류를 이용하여 β-carotene을 제품화하는데 성공했다(Vonshak 1997). 최근 에는 사료 개발과 미세조류로
lgae Volume 1(3): 333-31, 6 EDT 대체용 천연 킬레이팅제를 함유한 발효 축산폐수의 배지조성률에 따른 Chlorella ovalis와 Dunaliella parva의 생산성 강화 전선미 1 전경희 1 김미경 * ( 1 영남대학교 생물학과, 환경문제연구소 해양과학연구센터) Enhanced Production of Chlorella ovalis
More information