13 (05-21-OK).hwp

Size: px

Start display at page:

Download "13 (05-21-OK).hwp"

세아 호
6 years ago
Views:

1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 (10), 11~1(201) 전통식품유래유산균의해조류발효및 Probiotic 특성 김진학 박나영 이신호 대구가톨릭대학교식품공학과 Seaweed Fermentation and Probiotic Properties of Lactic Acid Bacteria Isolated from Korean Traditional Foods JinHak Kim, LaYoung Park, and ShinHo Lee Department of Food Science & Technology, Catholic University of Daegu ABSTRACT Lactic acid bacteria showing alginatedegrading and cellulolytic activity were isolated and identified as a starter for seaweed fermentation. A total of 331 strains of lactic acid bacteria isolated from various Korean traditional foods, such as, Jeotgal, and Makgeolli, were examined alginatedegrading and cellulolytic activity by the plate assay method. Six strains showed strong alginatedegrading and cellulolytic activity among the isolated 331 strains. Among these six strains, four strains (strain No. 12, 1, 192, and 19) showed probiotic properties (antimicrobial activity, tolerance to simulated gastric juice, artificial bile acid, and NaCl). No. 192 strain (Grampositive cocci, catalase negative, and homofermentative) showed the best probiotic properties among selected strains and was identified as Enterococcus faecium by 1S rrna sequencing. Strain No. 192 (E. faecium) showed the best growth and antioxidative activity during seaweed (sea mustard and sea tangle) fermentation for 2 h at 3 C among the four selected strains. Key words: seaweed, alginate lyase, cellulase, lactic acid bacteria, fermentation characteristics 서 해조류는양이온과결합력이높은카르복실기와황산기가결합된다당류를많이함유하고있어유해중금속을배출하는효과가있는것으로보고되고있다 (1). 또한, 정장작용과변비를개선하는효과 (2), 항산화효과 (3) 및당내성증진효과 () 등의생리활성이있다고알려져있다. 녹조류와홍조류보다높은생리활성을나타내고있는갈조류 () 에는 alginic acid, fucoidan 및 laminaran 등의다당류가함유되어있어혈중콜레스테롤저하효과 (), 항암효과 (), 항혈액응고효과 () 및혈압강하효과 (9) 등이있는것으로보고되었으며, 특히갈조류의주요다당류성분인 alginic acid는장내유해미생물을억제시키고 Bifidobacterium과 Lactobacillus의증식을촉진한다 (10). 이러한기능성을함유한갈조류즉미역과다시마는대부분건조등단순가공형태로유통되어그활용성이매우낮은실정이므로, 발효기법을이용한기능성소재화를통해식품에응용할수있다면다양한형태의기능성제품이개발될수있을것이다. 해조류의가공에서가장문제가되는단단한조체와세포벽충진물질 Received 30 May 201; Accepted 2 August 201 Corresponding author: ShinHo Lee, Department of Food Science & Technology, Catholic University of Daegu, Gyeongsan, Gyeongbuk 330, Korea leesh@cu.ac.kr, Phone: 론 인세포간유용성분을추출하기어려운가공문제 (11) 를안고있다. 최근건강지향적소비성향으로기능성식품시장에서 probiotic 식품이주목받고있고전세계적으로기능성식품시장의 0~0% 를차지하고있으며, 그종류도매우다양하게출시되고있다 (12). Probiotics는숙주의건강에이로운영향을미치는살아있는미생물로주로인간의장건강에유익한영향을미치며, 소화관의안정성유지, 설사예방이나증상의완화, 콜레스테롤수치의감소, 고혈압완화, 면역체계의개선등의효과가알려져있다 (131). 흔히사용되는 probiotics는 Lactobacillus, Bifidobacterium 등이고 Lactococcus, Streptococcus, Enterococcus 속의유산균이나몇종의 yeast도활용되고있다 (13,1). 대부분산업적으로이용되고있는 probiotics는인간의장관이나유제품등에서분리한동물유래유산균이었으나, 최근 Pediococcus, Leuconostoc 속등식물유래유산균이 probiotic 기능이있다고밝혀지고있다 (1). 본연구는위에서언급한다양한기능성을갖춘미역과다시마를이용한 probiotic 식품을개발하고자우리나라전통식품에서 probiotic 유산균을분리하여미역과다시마에서발효가능성을검토하였다. 재료및방법균주의분리

2 12 김진학 박나영 이신호 균주의분리원은대구경북지역각기다른가정에서수집한김치, 대구근교대형마트에서구입한시판젓갈, 대구지역의시판막걸리를사용하였으며, 각샘플을직접또는적정희석하여 0.02% sodium azide가포함된 MRS Agar (Difco Co., Detroit, MI, USA) 에도말하고, 3 C에서 2시간배양후나타난특징적인 colony를취하여순수분리하였다. 순수분리한균주는 MRS 사면배지에접종하여 2시간배양한후 C에보관하면서사용하였다. Cellulose 와 alginate 분해균주선발순수분리한유산균을 2시간배양한후분리유산균의 cellulose 분해능은 CMC 배지 (CMC 10 g/l, peptone g/l, agar 1 g/l), alginate 분해능은 alginate 배지 (CMC 10 g/l, peptone g/l, agar 1 g/l) 에점적하여 3 C에서 2~3일간배양하였다 (1,1). 배양된균주는 0.1% Congo red 염색을통한 plate assay를거쳐 cellulase와 alginate lyase 활성균주를선발하였다. 선발균주의성장검사 ( 측정 ) Plate assay를통하여분해환이큰균주를선별하고 modifyedmrs broth[cmc or alginate 10 g, peptone 10 g, beef extract 10 g, yeast extract 10 g, Tween 0 1 g, K 2HP 2 g, MgSO H 2O 0.2 g, MnSO H 2O 0.0 g, CH 3COONa g, (NH ) 3C H O 2 g/l] 에접종한후 2 시간동안배양하여 00 nm에서흡광도를측정하여성장을비교하였다. 항균활성측정선발된균주에대한항균활성은 Listeria monocytogenes ATCC 1911, Staphylococcus aureus ATCC 293, Bacillus cereus ATCC 11, Pseudomonas fluorescens ATCC 211, Salmonella enteritidis KCTC 1200, Vibrio parahaemolyticus ATCC 102에대해 paper disc method로생육억제환생성여부를비교하여측정하였다. 인공위액및인공담즙액에대한내성인공위액내성은 Kobayashi 등 (19) 의방법에따라 1 N HCl을사용하여 ph 2.로조정한 nutrient broth(difco Co.) 에 pepsin 1% 를첨가하여조제한인공위액에선발균주을접종하여 3 C에서 3시간배양한다음, 0.1% peptone 수로적정희석하여 MRS agar(difco Co.) 에접종하고 3 C에서 2시간배양한후나타난 colony 수를계측하여생균수를측정하였다. 분리균주의인공담즙액내성은 Lee와 No(20) 의방법으로 MRS broth(difco Co.) 에 pancreatin (Kanto Chemical, Tokyo, Japan) 1% 를첨가하여멸균시킨다음멸균된 10% Oxgall(Difco Co.) 용액 1% 를첨가한배지를사용하였으며, 인공위액에서 3시간배양한후원심 분리하여상등액을제거한균체를접종하고 3 C에서 2 시간배양한다음생균수를측정하였다. NaCl 내성 NaCl 내성은 0.2% potassium phosphate(duksan Pure Chemicals Co., Ansan, Korea) 용액에 NaCl을 0, 2,,, 1, 32%(w/v) 의농도로첨가한후멸균하여 MRS broth (Difco Co.) 에서 2시간배양한공시균주를접종하고 3 C 에서 시간배양한다음상기와같은방법으로생균수를측정하였다. 균주의동정최종선별된균주를 Gram 염색, spore 염색, catalase test, API 0 CHL kit(biomérieux Co., Marcy L'Etoile, France) 을이용하여간이동정하였다. 효소활성과항균활성이뛰어난균주를동정하기위해 Zhang 등 (21) 의 2F ('AGAGTTTGATCCTGGCTCAG3') 와 129R('GG TTACCTTGTTACGACTT3') primer를이용하여 RNA 를증폭한후 1S rrna 염기서열분석을수행하여 (Solgent Co., Daejeon, Korea) 확인하였다. 미역및다시마를이용한유산발효건조미역 (sea mustard) 및다시마 (sea tangle) 분말 (0 mesh) 을 1% 가되도록증류수에넣은다음 121 C에서 1 분간멸균하여식힌후 alginate와 cellulose 분해능이있고 probiotics의기능을나타내는 균주를각각 0.2% 농도로접종한후 3 C에서 2시간배양하면서발효특성및항산화활성을비교측정하였다. ph 및생균수측정발효중일정시간별로시료를취하여 ph와생균수를측정하였다. ph는 ph meter(orion 10A, Orion Research Inc., Boston, MA, USA) 를이용하여측정하였고, 생균수는발효중일정시간별로시료를무균적으로취한후 0.1% peptone 수로적정희석하여 MRS agar에접종하고 3 C 에서 2시간배양한후나타나는 colony 수로나타내었다. 환원당함량측정환원당함량은 dinitrosalicylic acid(dns) 에의한비색법 (22) 으로측정하였다. 각각의추출물 1 ml에 DNS 시약 3 ml를가하여잘교반한후끓는물에서 분간반응시키고냉각시켜발색된용액을 0 nm에서흡광도를측정하여 glucose를표준물질로한표준곡선에의하여산출하였다. 총폴리페놀함량측정총폴리페놀함량은 FolinDenis 법 (23) 에따라측정하였다. 즉시료 1 ml에 0.2 N FolinCiocalteu's phenol reagent(sigmaaldrich Co., St. Louis, MO, USA) 1 ml를

3 전통식품유래유산균의해조류발효및 Probiotic 특성 13 가하여실온에서 3분간반응시킨후,.% Na 2CO 3(Duksan Pure Chemicals Co.) 1 ml를가한다음암소에서 1시간동안방치한후 nm에서흡광도를측정하여 gallic acid (SigmaAldrich Co.) 를표준물질로한표준곡선에의하여산출하였다. ABTS 라디칼소거활성 ABTS[2,2'azinobis(3ethylbenzothiazoline sulfonic acid) diammonium salt; A991, SigmaAldrich Co.] 라디칼소거능은 ABTS radical cation decolorization assay(2) 를이용하여측정하였다.. mm의 ABTS와 2. mm potassium persulfate(duksan Pure Chemicals Co.) 를혼합하여실온 암소에서 2시간동안방치하여라디칼을형성시킨후실험직전에 ABTS 용액을 32 nm에서흡광도가 0.00±0.030이되도록 phosphatebuffered saline(ph.) 으로희석하여사용하였다. 발효액 0 μl에 ABTS 용액 90 μl를첨가하여암소에서 10분간반응시킨후 32 nm에서흡광도를측정하여계산식 ABTS radical scavenging activity (%)=100[(OD of sample/ OD of control) 100] 에의하여산출하였다. 통계처리모든실험은 3회반복으로시행하였으며, 유의성검증은 SPSS(Statistical Package for Social Sciences, SPSS Inc., Chicago, IL, USA) software package(version 19.0) 를이용, P<0.0 수준으로 Duncan's multiple range test에의하여검증하였다. 결과및고찰 Alginate 및 cellulose 분해균주의선발갈조류세포벽구성다당류인알긴산은 Dmannuronic acid와 Lguluronic acid가여러가지비율로 β1, 결합한 polyuronide(2) 로다양한생리활성을나타낸다. 김치, 젓갈, 막걸리등한국전통식품으로부터분리한유산균 331 균주중 alginate lyase와 cellulase 활성을동시에나타내는균주는 31개균주였으며, 이중비교적활성이우수한 균주에대해 modifiedmrs 배지를이용하여성장을확인한 Table 1. Growth of isolated lactic acid bacteria in alginate and CMC medium after 2 h at 3 C Strains No. 11 No. 12 No. 1 No. 192 No. 19 No. 22 Cell growth (OD at 00 nm) Alginate medium CMC medium 1.0±0.00 d 0.91±0.003 c 0.±0.029 b 1.10±0.02 e 1.0±0.001 d 0.2±0.00 a 1.21±0.00 d 1.021±0.010 b 1.0±0.030 b 1.0±0.00 e 1.1±0.01 c 0.92±0.00 a ae Means within each column with no common superscripts are significantly different (P<0.0). 결과 (No. 11, 12, 1, 192, 19) 균주모두성장이양호하였으며, No. 192 균주가 alginatemrs 배지에서 1.10 (OD 00), CMCMRS 배지에서 1.0(OD 00) 로가장우수하였다 (Table 1). 선발된 균주는해조구성다당인 cellulose 와 alginate를이용하여성장할수있으므로미역과다시마를이용한발효에스타터로사용가능할것으로판단되며, probiotic 기능을검토하고자항균활성및생리적특성을측정하였다. 항균활성분리유산균의 probiotic 특성유무를관찰하기위하여 No. 11, 12, 1, 192, 19, 22 균주의그람양성균인 L. monocytogenes, S. aureus, B. cereus와그람음성균인 P. fluorescens, E. coli O1:H, S. enteritidis, V. parahaemolyticus에대한항균활성을측정한결과는 Table 2 에서보는바와같다. No. 11과 No. 22 균주는공시병원성균에대한성장억제활성을나타내지않았으나, No. 12, 1, 192, 19은일부그람양성병원성균과그람음성병원성균에대해뚜렷한항균활성을나타내었다. No. 192는선발공시균주중가장넓은항균 spectrum을나타내었다. 인공위액및인공담즙액에대한내성구강을통하여섭취되는균은강산성의위산과담즙산에서살아남아위액과담즙을분비하는췌장및십이지장을통과하여최종목적부위인장에도달하여야정장의효과를발휘하게된다 (2,2). Alginate와 cellulose 분해능이있 Table 2. Antimicrobial activity of selected lactic acid bacteria against various pathogens Pathogens Listeria monocytogenes Gram () Staphylococcus aureus Bacillus cereus Pseudomonas fluorescens Escherichia coli Gram () Salmonella enteritidis Vibrio parahaemolyticus : positive, : negative. No. 11 No. 12 No. 1 No. 192 No. 19 No. 22

4 1 김진학 박나영 이신호 Table 3. Survival of selected lactic acid bacteria in artificial gastric juice and bile acid at 3 C Ⅰ Ⅱ Incubation time (h) (log No. CFU/mL) No. 12 No. 1 No. 192 No. 19.±0.02 ba.0±0.0 bb.±0.0 bb.0±0.09 bb.±0.02 aa.2±0.02 ab.±0.01 ac.3±0.00 ab.±0.02 da.±0.01 ca.±0.02 ba.29±0.03 ac.2±0.02 db.10±0.02 cb.±0.01 bb.03±0.0 ab.±0.01 cd.±0.01 bd.±0.02 bd.1±0.0 ad.3±0.00 dc.2±0.01 cc.1±0.02 bc.±0.1 aa Ⅰ: Survival cell in artificial gastric juice after 3 h at 3 C. Ⅱ: Survival cell in artificial bile acid for 2 h at 3 C treated with artificial gastric juice for 3 h at 3 C. Means with different superscripts within each column (ad) and row (AD) indicate significant differences (P<0.0). 고성장이우수하며, 그람양성균과그람음성균에대한항균활성을나타낸 No. 12, 1, 192, 19 균주에대해인공위액과인공담즙산염내성을측정한결과 (Table 3) 선발균주모두인공위액에서 3시간경과후.~. log CFU/mL 범위를나타내었으며, 인공담즙에서 2시간경과후.~.1 log CFU/mL를나타내어생존율이높았으며, 특히 No. 192 균주는인공위액에서 3시간경과후. log CFU/ ml, 인공담즙액에서 2시간경과후.1 log CFU/mL를각각나타내어미역및다시마발효용스타터로사용가능할것으로판단되었다. NaCl 내성과다한소금 (NaCl) 섭취는고혈압을일으키는중요한위험인자로지적되고있으며 (2), 고염섭취에노출된현대인의식생활환경에서생균제로서의기능을발휘하기위해서는고농도의염에대한내성이있어야한다. No. 12, 1, 192, 19 균주에대해 NaCl 내성을측정한결과 (Table ) No. 192 균주는 32% NaCl을포함한용액에서도배양 시 간후.0 log CFU/mL의우수한생존율을나타내어고염섭취에노출된현대인들의장내환경에서도생존이가능할것으로판단되었다. 균주의동정 1S rrna 염기서열분석을통한미생물동정결과 (Table ) No. 12, 192는 Gram positive, cocci, catalase negative 였으며, 각각 Pediococcus pentosaceus(no. 12), Enterococcus faecium(no. 192) 으로동정되었다. No. 1와 19은 Gram positive, rod, catalase negative로 Lactobacillus plantarum으로동정되었다. 선발유산균의미역과다시마기질에서의발효특성선발유산균을해조류발효시스타터로사용하기위해서는해조류가첨가된조성물에서성장할수있어야한다. 미역분말과증류수혼합물 (SME), 다시마분말과증류수혼합물 (STE) 을이용하여선발유산균 균주를각각 0.2% 접종하여 3 C에서 2시간배양하면서 ph(fig. 1) 와유산균수 Table. Survival of selected lactic acid bacteria in MRS broth containing different concentrations of NaCl after incubation for h at 3 C (log No. CFU/mL) Incubation NaCl (%) time (h) No. 12 No. 1 No. 192 No ±0.01.0±0.10.±0.10.± ±0.0 dc.21±0.03 ed.±0.0 dc.0±0.03 cc.9±0.0 bc.2±0.01 ac.00±0.0 fa.±0.0 ea.±0.0 da.±0.0 ca.±0.01 ba.02±0.0 aa.9±0.0 dd.±0.03 cc.±0.01 bc.9±0.1 abd.9±0.0 ad.0±0.1 ad.9±0.03 eb.±0.09 eb.01±0.0 db.±0.0 cb.39±0.10 bb.3±0.03 ab Means with different superscripts within each column (af) and row (AD) indicate significant differences (P<0.0). Table. Identification of selected lactic acid bacteria by 1S rrna gene sequencing Source Gram staining Shape Catalase test Identification (similarity, %) No. 12 No. 1 No. 192 No. 19 Cocci Rod Cocci Rod Pediococcus pentosaceus (99%) Lactobacillus plantarum (100%) Enterococcus faecium (100%) Lactobacillus plantarum (100%)

5 전통식품유래유산균의해조류발효및 Probiotic 특성 1 SME STE ph. ph. Fig. 1. Changes in ph of sea mustard and sea tangle during fermentation for 2 h at 3 C with different isolated starters. SME: sea mustard, STE: sea tangle. Viable cell count (log CFU/mL) SME Viable cell count (log CFU/mL) STE Fig. 2. Changes in viable cell count of sea mustard and sea tangle during fermentation for 2 h at 3 C with different isolated starters. SME: sea mustard, STE: sea tangle. Reducing sugar (mg/ml) SME Reducing sugar (mg/ml) STE Fig. 3. Changes in reducing sugar of sea mustard and sea tangle during fermentation for 2 h at 3 C with different isolated starters. SME: sea mustard, STE: sea tangle. 의변화 (Fig. 2), 환원당 (Fig. 3) 을비교검토하였다. 모든공시균주는미역과다시마에서배양시간이경과할수록 ph 는서서히감소하였으며, 미역의경우 No. 192 균주로발효한실험구에서 2시간이후 ph. 범위를나타내었다. 발효균주와해조류에종류에따라 ph 감소정도는달랐으나모두미역과다시마조성물에서 ph가감소하는것으로보아유산균의성장에기인한것으로판단되었다. 미역과다시마기질로한배양액에서선발유산균의성장은미역에서발효전 log CFU/mL에서배양이진행됨에 따라증가하였다가서서히감소하는경향을나타내었다. 미역을기질로한배양액 (SME) 에서는배양 2시간동안 No. 192(E. faecium) 를제외한공시균주는배양초기의 ~ log CFU/mL의범위를나타내었으나, No. 192 균주는배양초기부터서서히성장하여배양 시간째에 log CFU/mL 를나타내어스타터로활용이가능할것으로판단되었다. 다시마를기질로한배양액 (STE) 에서 No. 12(P. pentosaceus) 는배양초기부터서서히감소하여배양 0시간이후 log CFU/mL 이하를나타내어다시마를기질로한배

6 1 김진학 박나영 이신호 Table. Changes in total polyphenol contents and ABTS radical scavenging activity of sea mustard and sea tangle during fermentation for 2 h at 3 C with different isolated starters Seaweed Sea mustard Sea tangle Total polyphenol (μg/ml) ABTS activity (%) BF AF BF AF 12.1± ± ± ± ±0. 1.3±0. 1.3±0. 1.3±0. 1.1±0.09 b 1.1±0. a 20.±0. d 1.±0.9 c 22.9±0.1 a 23.±0.2 b 2.±0.39 c 2.3±0.29 c 2.2± ± ± ±1.3.22±1.2.22±1.2.22±1.2.22±1.2 BF: before fermentation, AF: after fermentation. ad Means within each column with no common superscripts are significantly different (P<0.0) ±0.3 a 31.20±0.3 a 3.9±1.21 c 3.0±0.3 b 1.23±0.3 a.0±0.22 bc.±0.0 c.39±0.1 b 양액에서는성장이불가능한것으로판단되었다. 반면 No. 1(L. plantarum), 192(E. faecium), 19(L. plantarum) 균주는서서히성장하여배양 2시간이후 log CFU/mL 이상의생균수를나타내어다시마를기질로한배양액에서스타터로사용이가능할것으로판단되었다. 또한, 발효과정중환원당함량을측정한결과미역과다시마는초기약 0.12 mg/ml에서발효기간경과에따른모든실험구에서환원당함량이증가하여선발균주들은미역과다시마의탄소원을이용하여성장하는것으로판단되었다. Gupta 등 (29) 은갈조류발효 2시간이후 L. plantarum의생균수가감소하며, 이는초기당류의양이유산균의성장에중요하기때문이라고보고하였다. 본연구에서도이와유사하게미역과다시마단독배양액에서유산균의왕성한성장은관찰되지않았으나, 발효 3일동안초기균수이상의성장및생존을나타내어분리균주는미역과다시마를이용한유산발효물제조에스타터로사용이가능할것으로판단되었다. 총폴리페놀함량및 ABTS 라디칼소거능의변화 Table 은선발유산균을이용한미역과다시마발효후총폴리페놀함량과항산화활성을비교한결과이다. 총폴리페놀함량은모든공시균주를접종한기질에서발효전보다발효후에증가하였다. SME의경우초기 12.1 μg/ml에서발효후 1.1~20. μg/ml로증가하였다. No. 192는 20. μg/ml를나타내어발효후약.30 μg/ml 증가하였다. STE에서도발효과정중초기 1.3 μg/ml에서 22.9 ~2. μg/ml로증가하였으며, No. 192 균주를이용한경우가장많이증가하여발효후 2. μg/ml로약. μg/ml 증가하였다. ABTS 라디칼소거능은모든공시균주로발효한후 SME와 STE에서모두증가하였다. SME의경우초기 2.2% 에서 31.20~3.9% 의범위로증가하였고, STE의경우초기.22% 에서 1.23~.% 로증가하였다. Kim 등 (30) 은해조류추출물의총페놀함량과 free radical 소거능이정의상관관계를보인다고보고하여본실험결과와비슷하였다. 이상의결과로미루어보아분리유산균 (L. plantarum 및 E. faecium) 은병원성균에대한항균력, 위액과담즙에대한내성등의특성뿐만아니라특히미역과다시마를발효시킬수있는특성을보유하고있어이를이용한기능성식품및유산균제제의소재로활용이가능할것으로판단된다. 미역및다시마발효기질에분리유산균의성장을증진할수있는탄소원, 질소원, 무기염류를보충한최적의발효조건에서는더욱왕성한성장과미역및다시마의분해가증가하여생리활성이증가할수있을것으로판단되므로생균제로서기능을가진이들유산균의대량생산을위한최적배지조성에관한연구가보다심도있게진행되어야할것이다. 요 해조류의발효가가능하고 probiotic 특성이우수한유산균을분리선발한후이들의미역과다시마발효능을검토하였다. 미역및다시마발효가가능한균주를김치젓갈, 된장으로부터 331 균주를순수분리하여해조류구성다당 (alginate, cellulose) 분해능, 균의생육, 항균활성등을비교검토한결과 균주 (stain No. 12, 1, 192, 19) 가우수하였다. 선발균주모두인공위액, 인공담즙액, NaCl에높은생존율을나타내었고이들 균주중 No. 192가가장우수하였으며 Enterococcus faecium으로동정되었다. 미역과다시마를이용하여선발유산균을배양한결과 No. 192 균주가발효특성이가장양호하였으며, No. 12, 1, 19 균주도양호하였다. 선발유산균을이용한미역과다시마에서성장이가능하였으며발효후미역과다시마발효물의항산화활성이증진되었다. 약 REFERENCES 1. Kim YY, Lee KW, Kim GB, Cho YJ Studies on physiochemical and biological properties of depolymerized alginate from sea tangle, Laminaria japonicus by heating hydrolysis; 3. Excretion effects of cholesterol, glucose and cad

7 전통식품유래유산균의해조류발효및 Probiotic 특성 1 mium (Cd) in rats. J Korean Fish Soc 33: Lee HA, Lee SS, Shin HK Effect of dietary fiber source on the composition of intestinal microflora in rats. Korean J Nutr 2: Huang HL, Wang BG Antioxidant capacity and lipophilic content of seaweeds collected from the Qingdao coastline. J Agric Food Chem 2: Cho YJ, Bang MA Effects of dietary seaweeds on blood glucose, lipid and glutathione enzymes in streptozotocininduced diabetic rats. J Korean Soc Food Sci Nutr 33: Jung BM, Ahn CB, Kang SJ, Park JH, Chung DH Effects of Hijikia fusiforme extracts on lipid metabolism and liver antioxidative enzyme activities in tritoninduced hyperlipidemic rats. J Korean Soc Food Sci Nutr 30: Cho KJ, Lee YS, Ryu BH Antitumor effect and immunology activity of seaweeds toward sarcoma10. Bull Korean Fish Soc 23: Yoon JA, Yu KW, Jun WJ, Cho HY, Son YS, Yang HC Screening of anticoagulant activity in the extracts of edible seaweeds and optimization of extraction condition. J Korean Soc Food Sci Nutr 29: Girard JP, Marion C, Liutkus M, Boucard M, Rechencq E, Vidal JP, Rossi JC. 19. Hypotensive constituents of marine algae; 1. Pharmacological studies of laminine. Planta Med : Cha SH, Ahn GN, Heo SJ, Kim KN, Lee KW, Song CB, Cho SK, Jeon YJ Screening of extract from marine green and brown algae in Jeju for potential marine angiotensinⅠ converting enzyme (ACE) inhibitory activity. J Korean Soc Food Sci Nutr 3: Kim YY, Cho YJ Studies on physicochemical and biological properties of depolymerized alginate from sea tangle, Laminaria japonicus by thermal decomposition;. Effects of depolymerized alginate on fecal microflora in rats. J Korean Fish Soc 3: Kim JH, Kim YH, Kim SK, Kim BW, Nam SW Properties and industrial applications of seaweed polysaccharidesdegrading enzymes from the marine microorganisms. Korean J Microbiol Biotechnol 39: Mohammadi R, Sohrabvandi S, Mortazavian AM The starter culture characteristics of probiotic microorganisms in fermented milks. Eng Life Sci 12: Ouwehand AC, Salminen S, Isolauri E Probiotics: an overview of beneficial effects. Antonie Van Leeuwenhoek 2: Leahy SC, Higgins DG, Fitzgerald GF, van Sinderen D Getting better with bifidobacteria. J Appl Microbiol 9: de Vrese M, Schrezenmeir J Probiotics, prebiotics, and synbiotics. In Food Biotechnology. Stahl U, Donalies UEB, Nevoigt E, eds. SpringerVerlag, Berlin Heidelberg, Germany. Vol 111, p Jonganurakkun B, Wang Q, Xu SH, Tada Y, Minamida K, Yasokawa D, Sugi M, Hara H, Asano K Pediococcus pentosaceus NB1 for probiotic use. J Biosci Bioeng 10: Kim CH, Lee SH Isolation of Bacillus subtilis CK2 hydrolysing various organic materials. J Life Sci 21: Lee JH, Lee EY Isolation of alginatedegrading marine bacteria and characterization of alginase. J Life Sci 13: Kobayashi Y, Toyama K, Terashima T. 19. Tolerance of a multiple antibiotic resistant strain, Lactobacillus casei PSR 3002, to artificial digestive fluids. Nihon Saikingaku Zasshi 29: Lee SH, No MJ Viability in artificial gastric and bile juice and antimicrobial activity of some lactic acid bacteria isolated from. Korean J Appl Microbiol Biotechnol 2: Zhang Y, Xu J, Yuan Z, Xu H, Yu Q Artificial neural networkgenetic algorithm based optimization for the immobilization of cellulase on the smart polymer Eudragit L 100. Bioresour Technol 101: Miller GL Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31: Folin O, Denis W On phosphotungsticphosphomolybdic compounds as color reagents. J Biol Chem 12: Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, RiceEvans C Antioxidant activity applying an improved ABTS radial cation decolorization assay. Free Radic Biol Med 2: Fisher FG, Dorfel H. 19. The polyuronic acids of brown algae. Hoppe Seylers Z Physiol Chem 302: Saarela M, Mogensen G, Fondén R, Mättö J, Mattila Sandholm T Probiotic bacteria: safety, functional and technological properties. J Biotechnol : Gilliland SE Beneficial interrelationships between certain microorganisms and humans: Candidate microorganisms for use as dietary adjuncts. J Food Prot 2: MacGregor GA Saltmore adverse effects. Am J Hypertens 10: 3S1S. 29. Gupta S, AbuGhannam N, Scannell AGM Growth and kinetics of Lactobacillus plantarum in the fermentation of edible Irish brown seaweeds. Food Bioprod Process 9: Kim BM, Jun JY, Park YB, Jeong IH Antioxidative activity of methanolic extracts from seaweeds. J Korean Soc Food Sci Nutr 3:

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,