DBPIA-NURIMEDIA
|
|
- 진모 목
- 6 years ago
- Views:
Transcription
1 Korean Society for Biotechnology and Bioengineering Journal 32(4): (2017) ISSN / eissn Research Paper HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 이승제 1, 임은경 1, 김가연 1, 전미지 1, 김상용 2, 김영민 1, 유제근 1 * Study of Anti-atopic Dermatitis Effects of Juice of Raphanus sativus var in HaCaT Cell Line Seung-Je Lee 1, Eun-Gyeong Lim 1, Ga-Yeon Kim 1, Mi-Ji Jeon 1, Sang-Yong Kim 2, Young-Min Kim 1, and Je- Geun Yoo 1 * Received: 9 October 2017 / Revised: 15 December 2017 / Accepted: 18 December The Korean Society for Biotechnology and Bioengineering 1 한남대학교생명나노과학대학생명시스템과학과 1 Department of Biological Sciences and Biotechnology, College of Life Science and Nano Technology, Hannam University, Daejeon 34054, Korea Tel: , Fax: jgyoo@hnu.kr 2 신안산대학교식품생명과학과 2 Department of Food Science & Bio Technology, Shinansan University, Ansan 15435, Korea Abstract: Raphanus sativus var is widely known as herbs for reducing skin heat and for deciphering internal organs. Also, Raphanus sativus var has various medical effects. But, the effects of atopic treatment of Raphanus sativus var were not investigated. Therefore, we assessed the anti-atopic dermatitis and anti-inflammatory effects of juice of Raphanus sativus var in HaCaT cells. MTT assay showed that the juice of Raphanus sativus var was not cytotoxic effect on the HaCaT cells. The HaCaT cell migration was demonstrated by cells migration assay. TNF-α and IFN-γ induces production of inflammatory cytokines such as CCL17, CCL 27, IL-1β, IL-6 and IL-8 expression. Juice of Raphanus sativus var could inhibit TNFα and IFN-γ induced mrna expression levels of CCL17, CCL 27, IL-1β, IL-6 and IL-8 gene. Furthermore, we determined the effects of skin turnover through organotypic cell culture and H&E stain. Our study showed that the treatment of HaCaT cells with the juice of Raphanus sativus var in the observed that its skin recovered to normal condition. These results suggested that the possibility Juice of Raphanus sativus var for prevention and treatment of skin inflammatory diseases such as atopic dermatitis. Keywords: HaCaT cells, Raphanus sativus var, atopic dermatitis, anti-inflammatory 1. INTRODUCTION 아토피피부염 (atopic dermatitis, AD) 이란알레르기성질환중대표적인난치성질환으로서 [1] 보편적으로가려움, 피부건조, 염증을동반한다 [2]. 최근에는피부장벽의손상이아토피피부염악화의중요한원인으로대두되고있다 [3]. 이러한피부장벽은과도한세안, 목욕등의생활습관과건조한대기, 오염물질등의환경적인원인과더불어피부각질형성세포의지질합성능력저하등과같은내인성질환등으로인하여쉽게손상되어아토피피부염을유발한다 [4]. 보편적으로아토피피부염의임상적특징으로는심한가려움증으로인한피부의손상과혈청내 IgE 의증가와염증부위의호산구 (eosinophil) 의침윤등이있다 [5]. 아토피피부염에는 Th1 세포와 Th2 세포에서분비되는 cytokines 과 T 림프구 (T lymphocyte) 와항원에특이적인 IgE 를발현하는수지상세포 (dendritic cell) 가관여한다 [6,7]. 특히아토피피부염환자의혈청에서 CCL17, CCL22 및 CCL27 등의케모카인이높은
2 312 Korean Society for Biotechnology and Bioengineering Journal 32(4): (2017) 량으로나타났기때문에아토피피부염과밀접한관련이있는것으로알려졌다 [5]. 염증표지인자로서 TNF-α, IFN-γ 와같은사이토카인, 호르몬등이제시되었다 [8]. 발병환자의삶의질을떨어뜨리고근본적인치료법이없는아토피피부염의경우증상을완화시키기위하여부작용이없고장기간사용할수있는치료제를만들기위해천연자원을탐색하고개발하는것이시급하다 [9]. 나복근은예로부터피부의열을내리고, 오장육부를해독하는약재로널리알려져있다. 나복근 (Raphanus sativus var) 은십자화과 (Cruciferae) 에속하며, 원산지는지중해연안에서중국을통해우리나라에전해졌으며, 부식물로써뿌리에는독특한매운맛을나타내는성분과전분분해효소인 glycosidase 와아스코르브산및 amylase 등을함유하고있다. 또한, 나복근은항산화, 자유라디컬소거, 항염증등의다양한효능들이있는것으로보고되었다 [10,11]. 따라서본연구에서는나복근즙 (JRS) 의세포이동촉진효과와항염증효과를확인함으로써아토피증상완화및항염증효과를확인하고자하였다. 2. MATERIALS AND METHOD 실험에사용된 3-(4,5-dimethyl-2 thiazolyl)-2,5-diphnyl-2htetrazolium bromide (MTT) 는 Sigma-Aldrich Co. (St. Louis, MO, USA) 에서구입하였으며에탄올, 클로로폼, 이소프로판올등의시약은시판특급시약을사용하였다. ATO AI (Water Aqua Mist) 는 ATO AI (Geumjeong-gu, Busan, Korea) 에서구입하였다. 시료의흡광도는 ELISA microplate reader (Model 680, Bio-Rad Laboratories, Inc., Tokyo, Japan) 를사용하여측정하였다 나복근즙제조본실험에서사용된나복근은전북장수군농장에서구입하여물로세척후절단하였다. 절단한나복근은믹서기를이용하여분쇄후면포를사용하여잔여물을걸러준후걸러진나복근즙을동결건조기를이용하여분말형태로만들어냉장보관한후 PBS 에녹여실험에사용하였다 세포배양 HaCaT 세포는 Dr. Fusenig (German Cancer Research Center, DKFZ, Heidelberg, Germany) 로부터분양받았으며, Fibroblast 세포는 American Type Culture Collection (ATCC, Rockville, MD, USA) 에서분양받아사용하였다. 세포는 10% FBS (both from HyClone, Waltham, MA, USA) 와 1% antibiotics (100 mg/l streptomycin, 100 U/mL penicillin) 가포함된 DMEM media (Hyclone, Laboratris Inc., Logan, UT, USA) 를사용하여 5% CO 2, 37 o C 조건에서배양하였다. 매 48 h 마다 Trypsin- EDTA (Hyclcone, Laboratories Inc., Logan, UT, USA) 를이용하여세포를부유상태로만든후세포를 cells/ml 로분 주하여계대배양하였다 MTT assay 세포생존율은 MTT assay 법을통하여측정하였다. HaCaT 세포와 fibroblast 세포를 12 well plate에각각 cells/ml 로분주하고 24 h 동안배양후나복근즙을처리하여 24 h 동안 5% CO 2, 37 o C 조건에서배양하였다. 염증반응유도군은 TNF-α 및 IFN-γ를 1 h 전처리하였다. 배양이끝난후 5 mg/ ml 3-(4,5-dimethyl-2 thiazolyl)-2,5-diphnyl-2h-tetra-zolium bromide (MTT, Sigma-Aldrich Co.) solution을각 well 당 40 μl씩첨가하여 40 min 동안 CO 2 incubator에서반응시켰다. media를제거하고 PBS로 washing 후 PBS를제거하였다. 각 well 당 DMSO 150 μl을첨가하여생성된 formazan을녹인다음 96 well plate에 100 μl씩옮긴후 ELISA microplate reader (Bio-Red Laboratories Inc., Tokyo, Japan) 로 595 nm에서흡광도를측정하였다. 측정은모두세번시행하였으며, 평균값과오차값은 Microsoft Excel program을사용하여분석하였다 Cell migration assay HaCaT 세포를 12 well plate에 cells/ml로분주하고 24 h 동안배양하여세포가 12 well plate에 90% 이상배양되었을때, media를제거하고멸균된 tip으로 12 well plate 바닥을 Scratch 한후, 1회 PBS washing 후 PBS를완전히제거하였다. 10% FBS와 1% antibiotics가포함된 DMEM media (Hyclone, Laboratris Inc., Logan, UT, USA) 를넣어준뒤, 염증반응유도군은 TNF-α 및 IFN-γ를 1 h 전처리하여아토피성피부염증환경을조성한뒤, 나복근즙을처리하고 24 h 동안 5% CO 2, 37 o C 조건에서배양한다음현미경상에서세포이동률을측정하였으며, Image J를사용하여분석하였다 Total RNA 추출및 cdna 합성 HaCaT 세포를 6 well plate에각각 cells/ml로분주하고 24 h 동안배양후나복근즙을처리하여 24 h 동안 5% CO 2, 37 o C 조건에서배양하였다. 염증반응유도군은 TNF-α 및 IFN-γ를 1 h 전처리하였다. 배양후 media를모두제거한뒤 PBS로 1회 washing 후 RiboEX Total RNA Isolation Solution (GeneAll Biotechnology, Seoul, Korea) 을가하여세포를용해한후클로로폼, 이소프로판올, 70% 에탄올을각각첨가하는과정을통하여 total RNA를추출하였다. cdna 합성은 DiaStar TM RT kit, Solg TM RNase Inhibitor (SolGent, Seoul, Korea) 를이용하여진행하였다. Total RNA 1 μl와 oligo(dt)20 primer 9 μl를혼합한뒤 65 o C에서 5 min 동안반응시킨후 ice에넣어반응을중단하였다. 상기과정을통하여 oligo(dt) primer가붙은 mrna에 8 mm DTT 1 μl, RTase (200 U/μL) 1 μl, 10 mm의 dntp가포함된 5X RT reaction buffer 4 μl, RNase Inhibitor (40 U/μL) 1 μl, DEPC-DW 3 μl를첨가한후 40 o C에서 1 h, 95 o C에서 5 min 동안반응시킴으로써 cdna를합성하였다.
3 HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 역전사중합효소연쇄반응 (Reverse Transcription Polymerase Chain Reaction, RT-PCR) PCR은 DNA polymerase와 buffer, dntp, tracking dye가포함된 2X Taq PCR Smart mix 1 (SolGent, Seoul, Korea) 를이용하여실시하였다. PCR 증폭은 pre-denaturation을 95 o C에서 10 min, denaturation은 95 o C에서 30 sec, annealing은 60 o C에서 30 sec, extension은 72 o C에서 30 sec의조건으로 35 cycles 반응시켰으며 72 o C에서 10 min 동안안정화시켰다. TARC(CCL 17), CTACK(CCL27), IL-1β, IL-6, IL-8, β-actin의 specific primer sequences는 Table 1과같다 피부턴오버개선검사 (Organotypic cell culture 및 H&E stain을통한유효성검사 ) SPL Inset TM Haging 6well plate (SPL Life Sciences) 에 Purecol Bovine Collagen type I을기반으로한 acellular layer를 inset에 1 ml씩분주하였다. 겔이굳은뒤 10% FBS (both from HyClone, Waltham, MA, USA) 와 1% antibiotics (100 mg/l streptomycin, 100 U/mL penicillin) 가포함된 DMEM media (Hyclone Laboratories Inc., Logan, UT, USA) 에서배양한 Human Fibroblast ( cells/ml) 에 Matrigel Basement Membrane Matrix (Corning, NewYork, USA) 을함께포함하여 inset에 3 ml을분주하여 37 o C, 5% CO 2 incubator에배양하였다. DMEM media와 Ham's F12 media (Hyclone Laboratories Inc., Logan, UT, USA) 를 3:1로섞은배지를넣어 gel matrix 를안정화시킨다음 P5-P6의 HaCaT 세포를 (German Cancer Research Center, DKFZ, Heidelberg, Germany, cells/ ml) basementcelllayer에 50 μl씩분주하여 37 o C, 5% CO 2 incubator에서 2주동안배양하여피부의표피층을제조하였다. 배양삽입체외부의배지에는 TNF-α 및 IFN-γ를처리하여아토피피부염환경을조성하고 saline, 나복근즙 40 ug/ml 및 ATO AI (Water Aqua Mist는베타글루칸과 EGF가첨가된피부보습, 피부세포의재생촉진, 손상된피부를회복하는데도움을주는화장품이다.) 10 μl/ml을 14일동안각각처리하였다. 그후, 파라핀블록제작방법을통해표본을제작한후, 헤마톡실린과에오신으로염색 (H&E staining) 하여표피층의단면을실험군별로비교관찰하였다 통계처리통계프로그램인 SPSS (Statistical Package for the Social Science) 프로그램을사용하였고, 실험설계에대한분산분석은독립표본 t-test 를통하여유의성을검정하였다. 각자료는 3 번이상의반복된실험을통하여얻어진결과로검정하였고 p<0.05 인경우통계적으로유의한것으로판정하였다. 3. RESULT AND DISCUSSION 3.1. 나복근즙에대한세포독성검사피부각질형성세포 (HaCaT) 는피부표피층을구성하며피부를보호하는각질을형성하고다양한자극에반응하여여러사이토카인 (cytokine) 을분비함으로써염증반응및면역반응에관여한다 [12-14]. 피부각질형성세포는외부로부터자극을받으면 tumor necrosis factor-α (TNF-α) 및 Interferon gamma (IFN-γ) 를분비하고다른사이토카인의분비를촉진하여염증이유도되는것으로알려져있다 [12]. 따라서본연구에서는나복근즙처리에따른염증반응을유도한피부각질형성세포 (HaCaT) 와섬유아세포 (Fibroblast) 의세포독성을확인하기위하여 MTT assay 를시행하였다. Fibroblast 세포에대한나복근즙의세포독성을측정한결과는 Fig. 1A 에나타내었다. TNF-α 및 IFN-γ 를 1 h 전처리한후나복근즙을농도별 (10, 25, 50, 100, 200 μg/ml) 로처리한후 24 h 동안반응시켰을때 fibroblast 세포의생존율이 95% 이상으로나타났고, 통계적으로유의하지않았다 (not significant). 또한, Fig. 1B 에나타난바와같이, 나복근즙을농도별 (10, 25, 50, 100, 200 μg/ml) 로처리한후 24 h 동안반응시켰을때 HaCaT 세포의생존율이 95% 이상으로나타났고, 통계적으로유의하지않은것을확인할수있었다. 따라서본실험을통하여나복근즙이피부각질형성세포및섬유아세포에세포독성이없는것을확인하였다 나복근즙에대한세포이동촉진효과피부각질형성세포 (HaCaT) 는염증및면역반응과세포증식및피부의항상성유지에관여하는다양한사이토카인 Table 1. Gene Primer sequencr (5'-3') Amplification size (bp) Annealingtemperature ( o C) TARC For: AGGTCTTGAAGCCTCCTCAC (CCL17) Rev: AGTTCAGACAAGGGGATGGG CTACK For: AAGGTAGGGGAGGAGGAGAG (CCL27) Rev: AGCTTGTCTGAGAGTGGCTT IL-1β For: GGAGAATGACCTGAGCACCT Rev: GGAGGTGGAGAGCTTTCAGT IL-6 For: AGTCCTGATCCAGTTCCTGC Rev: AAGCTGCGCAGAATGAGATG IL-8 For: TGAGCATCTACGGTTTGCTG Rev: TGCTTGTCTGGAACAACTGC β-actin For: GGACTTCGAGCAAGAGATGG Rev: AGCACTGTGTTGGCGTACAG
4 314 Korean Society for Biotechnology and Bioengineering Journal 32(4): (2017) Fig. 1. Cytotoxic Effects of Juice of Raphanus sativus var in HaCaT cells and fibroblast. Cell viability was measured by MTT assay. Cells were pre-treated with 10 ng/ml TNF-α and IFN-γ 1 h followed by treatment Juice of Raphanus sativus var 24 h. The statistical analysis of the data was carried out by use of a t-test. N.S is not significant (each experiment, n=3). (cytokine) 및성장인자를생산한다 [15]. 따라서본연구에서는나복근즙처리에따른염증반응을유도한 HaCaT Cell 의세포이동촉진효과에미치는영향을알아보기위해 Cell migration assay 를시행하였다. Fig. 2 에나타난바와같이아무것도처리하지않은군은 Wound area 가 77% 인반면 TNFα 및 IFN-γ (10 ng/ml) 로염증을유도한군의 Wound area 는 94% 로피부재생유도효과가감소한반면, ATO AI (1 μl/ ml) 를처리한군의 Wound area 는 69% 로대조군대비 112% 의세포이동촉진효과가관찰되었으며, 나복근즙 (50, 100 μg/ml) 을처리한군에서는각각 Wound area 가 51%, 25% 로대조군대비 151%, 304% 의세포이동촉진효과가관찰되었다. 따라서본실험을통하여나복근즙처리에따른염증반응을유도한 HaCaT Cell 의세포이동촉진효과가있다는것을확인하였다 나복근즙의염증관련유전자발현저해효과 HaCaT 세포가자극을받으면 IL-1β, IL-6, IL-8 및 COX-2 와같은다양한염증성사이토카인이분비되어염증반응이유도된다 [12]. TNF-α 는중요염증표지인자로알려져있으며, 세포가외부로부터자극을받으면분비되는것으로알려져있다 [8,12]. 선행연구에따르면 TNF-α 로염증을유도한 Ha- CaT cell 에봉독및모링가추출물을처리하였을때 IL-1β, IL- 6, IL-8 의 mrna 발현이농도의존적으로감소한다고보고되 었다 [12,16]. 따라서본연구에서는 HaCaT 세포에 TNF-α 및 IFN-γ로염증을유도하여아토피유사환경을조성한뒤, 나복근즙을처리하여나복근즙의항염증효과를확인하고자하였다. 그결과 Fig. 3과같이 TNF-α 및 IFN-γ (10 ng/ml) 의처리에따라 CCL17, CCL27, IL-1β, IL-6 및 IL-8 유전자의발현이아무것도처리하지않은군과비교하였을때, 2.65(***), 2.68(***), 1.21(*), 1.24(*), 1.21(*) 배수, 증가하였으며 ATO AI (1 μl/ml) 처리군에서각각 1.44(##), 1.31(**/###), 0.95 (##), 0.79(*/##), 0.35(***/###) 배수, 나복근즙 50 μg/ml 처리군에서각각 1.6(*), 1.34(**/###), 0.26(***/###), 0.12(***/ ###), 0(***/###) 배수, 나복근즙 100 μg/ml 처리군에서는 2.46(***), 1.18(###), 0.72(**/##), 0.36(***/###), 0(***/###) 배수로 TNF-α 및 IFN-γ 처리군보다발현량이유의하게감소하였으며, 특히나복근즙 50 μg/ml 처리군에서항염증효과가가장뛰어난것을확인하였다. 따라서본실험을통하여나복근즙의항염증효과를확인하였으며, 이와같은효과는 CCL17, CCL27, IL-1β, IL-6 및 IL-8과같은염증관련유전자의발현을억제함으로써나타난것임을확인하였다 나복근즙의피부턴오버개선효과표피는다수의상피조직으로이루어져있으며각질형성세포가주요구성성분이다. 표피의가장아래층인기저층에서세포분열이끊임없이일어나며분열된세포는유극층, 과립층,
5 HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 315 Fig. 2. The cell migration promoting effect of the Juice of Raphanus sativus var in HaCaT cells. Wound area was measured by Image J. Cells were pre-treated with 10 ng/ml TNF-α and IFN-γ 1 h followed by treatment with 50, 100 μg/ml Juice of Raphanus sativus var and 1 μl/ml ATO AI 24 h. The statistical analysis of the data was carried out by use of a t-test. *p<0.05, **p<0.01, ***p<0.001 compared to controls. ###p<0.001 was compared to 10 ng/ml TNF-α and IFN-γ treated group. N.S is not significant (each experiment, n=3). 각질층순서로상승하여피부에서탈리된다. 기저층에서부터세포가탈리되기까지의소요시간은약 28 일정도이며, 이주기를턴오버 (turn-over) 라고한다. 아토피피부염이유발된피부조직에서는각질층의두께가증가하며, 백혈구의침윤이일어난다 [17,18]. 동물실험을대체하기위하여본실험에서는 Organotypic cell culture 및 H&E stain 을통하여, 나복근즙처리에따른피부턴오버개선효과를확인하였다. Fig. 4 에나타난바와같이아무것도처리하지않은군은피부각질층이얇은것에비해 TNF-α 및 IFN-γ (10 ng/ml) 로염증을유도한군의피부각질층은두꺼워진것을확인하였으며, ATO AI (1 μl/ml) 와나복근즙 40 μg/ml 을처리한군에서아무것도처리하지않은군과유사하게피부각질층이얇아진것을확인할수있었다. 따라서본실험을통하여나복근 즙을통하여단순히염증을완화시키는것이아니라피부턴오버를개선함으로써아토피증상을완화시키는것을확인하였다. 4. CONCLUSION 본연구에서는나복근즙의아토피완화효과와피부재생촉진및피부턴오버를이용한기능성소재로서의이용가능성을알아보고자하였다. 그결과 TNF-α 및 IFN-γ 로염증환경이조성된 HaCaT 세포와섬유아세포 (Fibroblast) 에서세포독성이없는것을확인하였으며, 농도의존적으로 Wound area 가감소하는것으로보아세포증식능력이향상되는것
6 316 Korean Society for Biotechnology and Bioengineering Journal 32(4): (2017) Fig. 3. Effects of Juice of Juice of Raphanus sativus var on CCL17, CCL27, IL-1β, IL-6 and IL-8 mrna expression levels in HaCaT cells. Cells were pre-treated with 10 ng/ml TNF-α and IFN-γ for 1 h followed by treatment with 50, 100 μg/ml of Juice of Raphanus sativus var and 1 μl/ml ATO AI 24 h. The statistical analysis of the data was carried out by use of a t-test. *p<0.05, **p<0.01, ***p<0.001 compared to control. ##p<0.01, ###p<0.001 was compared to 10 ng/ml TNF-α and IFN-γ treated group. N.S is not significant (each experiment, n=3).
7 HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 317 Fig. 4. Photomicrographs of organotypic culture of Human Fibroblast and HaCaT cells. 10 ng/ml TNF-α and IFN-γ followed by treatment with 40 μg/ml Juice of Raphanus sativus var and 1 μl/ml ATO AI 14 days. Each sample was filled with paraffin at a size of 5 μm. The tissues stained hematoxylin and eosin. The ATO AI group had very thin stratum corneum. The Juice of Raphanus sativus var group also showed thinning of the stratum corneum. 을확인할수있었다. 또한, 염증성사이토카인의 mrna 발현을확인한결과 TNF-α 및 IFN-γ 로염증환경을유도한 Ha- CaT 세포에나복근즙을처리하였을때염증성사이토카인인 CCL17, CCL27, IL-1β, IL-6 및 IL-8 유전자의발현이유의적으로감소하는것을확인할수있었으며, Organotypic cell culture 및 H&E stain 에서나복근즙을처리한군에서아무것도처리하지않은군과유사하게피부각질층이얇아진것을확인할수있었다. 따라서피부턴오버를이용한아토피피부염증상완화와염증관련질환의치료를위한기능성천연소재로유용하게활용될수있을것으로사료된다. Acknowledgements 본연구는 2016 년도산학연협력기술개발사업 ( 연구마을조성사업 : 과제번호 2016N146)) 에의해수행되었음. REFERENCES 1. Jeong, D. H., K. B. W. R. Kim, M. J. Kim, B. K. Kang, S. W. Bark, W. M. Pak, B. R. Kim, H. M. Park, M. H. Im, and D. H. Ahn (2014) Anti-atopic activity of Sargassum micracanthum ethanol extracts. Microbiol. Biotechnol. Lett. 42: Kang, B. K., K. B. W. R. Kim, M. J. Kim, S. W. Bark, W. M. Pak, B. R. Kim, N. K. Ahn, Y. U. Choi, N. Y. Bae, J. H. Park, and D. H. Ahn (2015) Anti-atopic activity of tuna heart ethanol extract. J. Korean Soc. Food Sci. Nutr. 44: Jeong, D. H., K. B. W. R. Kim, S. A. Jung, H. J. Kim, B. K. Kang, S. W. Bark, T. W. Kim, and D. H. Ahn (2013) Effect of pine needle ethanol extracts on the inhibitory activity of atopic dermatitis. KSBB J. 28: Yoon, M. Y. (2008) Therapeutic effects of hydrolyzed preparation of Scutellanae radix extracts on atopic dermatitis of NC/Nga mice induced by D. pteronyssinus. Ph. D. Thesis, Woosuk University of Wanju County, North Jeolla, South Korea. 5. Jeong, S. I., B. M. Choi, Y. G. Yun, J. W. Lee, and S. I. Jang (2009) A noble therapeutic approach of atopic dermatitis by development of Th2 chemokine inhibitors from natural products: inhibitory effect of Sophora flavescens extract in atopic dermatitis model mice, NC/Nga. Herbal Formula Sci. 17: Kim, M. A., H. U. Son, D. Y. Nam, Y. S. Cha, Y. K. Shin, Y. H. Choi, and S. H. Lee (2012) Inhibitory effect of Angelica keiskei extract in an atopic dermatitis animal model. Korean J. Food Preserv. 19: Kim, H. A., M. Y. Yun, H. H. Song, K. J. Hyang, and H. S. Yoo (2010) Effects of lavender, lemon and eucalyptus essential oil on Th2 related factors of DNCB-induced atopy dermatitis in NC/Nga mice model. J. Pharmacopuncture 13: Song, H. R., Y. S. Woo, and W. M. Bahk (2013) Depression as an inflammatory disease. Korean J. Psychopharmacol. 24: Jeong, D. H., N. K. Ahn, Y. U. Choi, J. H. Park, N. Y. Bae, S. H. Park, M. J. Kim, K. B. W. R. Kim, and D. H. Ahn (2015) Inhibitory effect of sargassum fulvellum water extract on 2, 4-dinitrochlorobenzene-induced atopic dermatitis-like skin lesions in mice. Microbiol. Biotechnol. Lett. 43: Lugasi, A., E. Dworschak, A. Blazovics, and A. Kery (1998) Antioxidant and free radical scavenging properties of squeezed juice from black radish (Raphanus sativus L. var niger) root. Phytotherapy Res. 12: Salah-Abbes, J. B., S. Abbes, Z. Houas, M. A. Abdel-Wahhab, and R. Oueslati (2008) Zearalenone induces immunotoxicity in mice: possible protective effects of radish extract (Raphanus sativus). J. Pharmacy Pharmacol. 60: Lim, E. G., G. T. Kim, B. M. Kim, E. J. Kim, S. Y. Kim, N. K. Han, J. S. Ha, and Y. M. Kim (2017) Study of anti-microbial activities and anti-inflammatory effects of chamomile (Matricaria chamomilla) extracts in HaCaT cells. KSBB J. 32: Lee, W. R., K. H. Kim, H. J. An, J. Y. Kim, S. M. Han, K. G. Lee, and K. K. Park (2014) The effects of bee venom on tumor necrosis factor (TNF)-α induced inflammatory human HaCaT keratinocytes. Korean J. Pharmacognosy 45: Beissert, S., I. Cavazzana, F. Mascia, P. Meroni, S. Pastore, G. Tessari, and G. Girolomoni (2006) Mechanisms of immune-mediated skin diseases: An overview. Clin. Exp. Rheumatol. 24: S Lee, W. R., K. H. Kim, H. J. An, J. Y. Kim, S. M. Han, K. G. Lee, and K. K. Park (2014) The effects of bee venom on tumor necrosis factor (TNF)-α induced inflammatory human HaCaT keratino-
8 318 Korean Society for Biotechnology and Bioengineering Journal 32(4): (2017) cytes. Korean J. Pharmacognosy 45: Lee, H. J. and Y. C. Chang (2012) Suppression of TNF-α induced inflammation by extract from different parts of moringa in HaCaT cells. J. Life Sci. 22: Cho, B. O., H. H. Yin, C. Z. Fang, J. Y. Shin, H. O. Ha, S. J. Kim, S. I. Jeong, and S. I. Jang (2015) Anti-atopic effect of hot water and supercritical carbon dioxide fluid extract of persimmon (Diospyros kaki) peels. Korean J. Food Sci. Technol. 47: Kim, M. J. and S. Y. Choung (2012) Mixture of polyphenols and anthocyanins from vaccinium uliginosum L. Alleviates DNCBinduced atopic dermatitis in NC/Nga Mice. Evidence-Based Complementary and Alternative Medicine 2012:
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(1): 9-15 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.1.9 ISSN 1225-7117 / eissn 2288-8268 Research Paper HaCaT 세포주에서캐모마일 (Matricaria chamomilla)
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 335-341 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.335 ISSN 1225-7117 / eissn 2288-8268 Research Paper 염증성사이토카인의발현억제를통한홍해삼추출물의항염증효과및아토피개선효과
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More information00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
More information..................
ptical & Mechanical Characteristics of Lining Papers Oby the Artificial Heat Ageing Treatment 1 1 This study was carried out to investigate the effect of artificial accelerated ageing treatment on the
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information<372E20B9DAC0B1C8F12DB0E62E687770>
7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationμ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information<30372EC0CCC0AFC1F82E687770>
산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과
한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information大学4年生の正社員内定要因に関する実証分析
190 2016 JEL Classification Number J24, I21, J20 Key Words JILPT 2011 1 190 Empirical Evidence on the Determinants of Success in Full-Time Job-Search for Japanese University Students By Hiroko ARAKI and
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information<31332EBEC6C6AEB8B6C4C9C6C3C0BB20C8B0BFEBC7D120C6D0C5B0C1F6B5F0C0DAC0CE20BFACB1B82E687770>
A Journal of Brand Design Association of Korea 통권 제 9호 2007 12 Vol. 5 No. 2 아트마케팅을 활용한 화장품 브랜드 디자인 연구 -화장품패키지디자인 중심으로- A Study on the Cosmetic Brand Package Design Applied Art-Marketing - Focusing on Cosmetic
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information