45 3, 155 165 (2018) Korean J. Poult. Sci. Vol.45, No.3, 155 165 (2018) https://doi.org/10.5536/kjps.2018.45.3.155 155 1 2 3 4 Study on the Characteristics of Feather Developing Pattern and Morphology in Early- and Late-Feathering Korean Native Chickens Min Hee Bang 1, Eun Jung Cho 2, Chang Yeon Cho 3 and Sea Hwan Sohn 4 1 Student, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea 2 Researcher, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea 3 Researcher, Animal Genetic Resources Research Center, National Institute of Animal Science, RDA, Namwon 55717, Republic of Korea 4 Professor, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea ABSTRACT Chicken feathers could be classified into early-feathering (EF) and late-feathering (LF) depending on the development and patterns of the wing and tail feathers. Currently, feather-sexing is a widely used chick sexing method in the industry. This study was carried out to suggest the method of classifying of EF and LF chicks to establish auto-sexing Korean native chicken (KNC) strains. The development and morphology of wing feathers and tail feathers in 856 KNCs from hatching to 55-days old were analyzed to classify EF and LF chicks. We also performed PCR analysis using K-specific gene primers to confirm the agreement between the phenotypes and genotypes of EF and LF chickens. In the results, the EF chicks had long primaries and coverts, and there was a significant difference in length between primaries and coverts. The LF chicks had shorter primaries and coverts than the EF chicks, and showed little difference in the length between primaries and coverts. LF chicks could be classified into four groups: LF-Less, LF-Scant, LF-Equal and LF-Reverse according to their wing feather patterns. EF chicks had 1.5 times longer primaries than LF chicks until they were 15-days old, but the lengths were almost the same at 50-days old. The tail feathers of the EF chicks were apparent at 5-days old, but those of the LF chicks were short and indefinite at that time. When EF and LF chicks were classified by the length of primaries being more or less than 9 mm, the classification accuracies for EF and LF chicks were 96.2% and 85.4%, respectively, compared to the PCR results. In conclusion, juvenile EF and LF KNC showed distinct differences in feather development and morphology, and could be easily distinguished at one day-old. (Key words: Korean native chicken, early-feathering chick, late-feathering chick, feather classification, feather-sexing).., (Masui et al., 1925; Martin, 1934), (Mueller and Moultrie, 1952; Plumart and Mueller, 1954; Siegel et al., 1957; Somes, 1969; Warren, 1976; Mc- Gibbon, 1977; SAFRS, 2011). (Saitoh and Mizuno, 1992; Klein To whom correspondence should be addressed : shsohn@gntech.ac.kr
156 : and Ellendorff, 2000; Sohn et al., 2012), (Weissmann et al., 2013) (Fluorescence and Raman spectroscopy) (Galli et al., 2018),.,. K Avian ev-21 gene PRLR SPEC2 Z (Humphries et al., 1984; Bacon et al., 1988; Lakshmanan et al., 1992; Iraqi et al., 1995; Bitgood, 1999 Elferink et al., 2008; Zhao et al., 2016),, (Z K W), (Z k Z k ) (Z k W), (Z K Z k ).,,.,, (Saeki and Katsuragi, 1961; Goodman and Muir, 1965; Lowe and Garwood, 1981; Harris et al., 1984; Fotsa et al., 2001; Khosravinia, 2009; Sohn et al., 2013).,, (Siegel et al., 1957; SAFRS, 2011; Sohn et al., 2012). Siegel et al.(1957) Rhode Island 12, 3 5,., Aviagen 1/2 3/4,, (Aviagen Brand, 2018). Sohn et al.(2012),.,.,.,. 11 856, 744, 112. 12, 3 3 (74 cm 60 cm 35 cm/cage), 1 12 15.,, (IACUC ; 2018-3). 2 (primaries) (coverts).
Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 157 5, 7, 10, 15, 55 5. 15,. 7, genomic DNA polymerase chain reaction(pcr). primer ev21 JFIL-1 5 GGGGTCAGCATGTTTAAAGG 3 (forward) 5 TTGA- GTCCCTAACGATTGCG 3 (reverse) (Iraqi and Smith, 1994). primer PCR TaKaRa Taq TM kit(takara, Kyoto, Japan), PCR 10 buffer 2.5 μl, dntp 2 μl, Taq polymerase 2 μl (0.5 unit/μl), primer 4 μl(5 pmol/μl), genomic DNA 3 μl (100 ng/μl) ddh 2 O 11.5 μl 25 μl. PCR 95 5, 95 1, 56 1, 72 2 3 30 72 15. PCR 200 ng/μl band (Fig. 1). SAS (SAS Institute Inc., Cary, NC, USA) t-test. Gallus gallus endogenous virus-21 JFIL-1 DNA PCR., Table 1 856 746, 110 99.8%. 100% Table 1. The conformity between morphological feathering classification and PCR analysis for the identification of earlyand late-feathering chicks Feathering types Phenotypic analysis PCR analysis Conformity (%) Early feathering 744 746 99.7 Late feathering 112 110 98.2 Total 856 856 99.8(854/856) Fig. 1. The results from polymerase chain reaction using the K-specific primer in chickens. M is the 100bp size marker. Lanes of 1, 3, 5, 7, 9, 11, 13, and 15 are late-feathering chicks. Lanes of 2, 4, 6, 8, 10, 12, and 14 are early-feathering chicks.
158 :. Fig. 2 1 (primaries; ) (primary covert; ) 2 (secondaries) (middle primary covert), 10.,. Fig. 3., 1/2 1/3. EF-1, EF-2,., LF-Less, LF-Scant, LF-Equal LF-Reverse 4. LF-Less,. LF-Scant 1 2 mm. LF-Equal, LF-Reverse. 112 LF-Equal 52%, LF-Less 35%, LF-Reverse 11%, LF-Scant 2%. Aviagen Brand(2018),, Sohn et al.(2012),. Somes(1969; 1970) McGibbon(1977). Fig. 4 1. 55. 1 45 Fig. 5, Fig. 6. EF-1 EF-2,., 1 13 mm, 9 mm, 7 1.7, 15 2, 55 2.6., Fig. 2. Chicken wing feather; a) Photograph of chicken wing feathers and number of primaries. b) Diagram of chicken wing feather structure based on the left figure.
Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 159 Fig. 3. The patterns of wing feather in early-feathering and late-feathering day-old chicks. EF-1 and EF-2 are early-feathering types, and LF-Less, LF-Scant, LF-Equal and LF-Reverse are late-feathering types. Fig. 4. The diagram of wing feather types of early-feathering and late-feathering chicks at day-old. The diagram was based on the length of second primary and it s covert. LF-Less showed that both of the primaries and coverts were shorter than the early-feathering chick s. LF-Scant had almost no coverts. LF-Equal had the same length of primaries and coverts. LF-Reverse showed the coverts were longer than the primaries.
160 : Fig. 5. The developmental patterns of wing feathers in early-feathering chicks (EF-1, EF-2) and late-feathering chicks (LF-Equal, LF-Reverse, LF-Less, LF-Scant)., 15,. LF-Less,. LF-Scant 10 15. LF-Equal 7 10. LF-Reverse
Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 161 Fig. 6. The length of primaries and coverts in early-feathering chicks (EF) and late-feathering chicks (LF-Less, LF-Scant, LF-Equal and LF-Reverse) from one-day-old to 55-day-old., 7, 10. Fig. 7 55.
162 : Fig. 7. Comparison of primary length between early-feathering and late-feathering chicks from one-day-old to 55-day-old. * P<0.05, ** P<0.01. 15 40. 1 1.5, 5 1.7, 7 10 1.6, 15 1.5, 15 50.,, 1 7, 10., 5.. 4, 1, 15. 1 8 mm 9 mm 9 mm, 9 mm, 96.2%, 85.4%. LF-Equal 9 mm.. 1 17,. Fig. 8. 3 5., 5, 17. Fig. 9 5 17
Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 163 Fig. 8. The development of tail feather of early-feathering chicks (EF) and late-feathering chicks (LF) from one-day-old to 15-day-old. Fig. 9. The comparison of developmental pattern of tail feathers between the early-feathering chicks and the late-feathering chicks.. 7,,., 17, 28 1. Siegel et al.(1957) 12, Sohn et al.(2012) 5., 5. 8~12,..,. 856 55
164 :. K- PCR.,,.,,. LF-Less, LF-Scant, LF-Equal LF-Reverse 4. 15 1.5 50., 5,. 9 mm 96.2%, 85.4%.. ( :,,,, ) ( : PJ011639 2018). Aviagen Brand 2018 Feather sexing day-old chicks in the hatchery. http://en.aviagen.com/assets/tech_center/bb_resources_tools/aa_how_tos/aa-how-to-11-feathersexd ayoldchicks-en-17.pdf Bacon LD, Smith E, Crittenden LB, Havenstein GB 1988 Association of the slow feathering (K) and an endogenous viral (ev21) gene on the Z chromosome of chickens. Poult Sci 67(2):191-197. Bitgood JJ 1999 Linkage relationships of the Z-linked silver, slow feathering, and pop-eye loci. Poult Sci 78(8):1100-1101. Elferink MG, Vallée AA, Jungerius AP, Crooijmans RP, Groenen MA 2008 Partial duplication of the PRLR and SPEF2 genes at the late feathering locus in chicken. BMC Genomics 9:391. Fotsa JC, Mérat P, Bordas A 2001 Effect of the slow (K) or rapid (k+) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn x brown egg type cross. Genet Sel Evol 33(6):659-670. Galli R, Preusse G, Schnabel C, Bartels T, Cramer K, Krautwald-Junghanns ME, Koch E, Steiner G 2018 Sexing of chicken eggs by fluorescence and Raman spectroscopy through the shell membrane. PLoS One 13(2): e0192554. Goodman BL, Muir FV 1965 The influence of comb and feathering phenotypes on body weight and dressing percentage in broilers. Poult Sci 44(3):644-648. Harris DL, Garwood VA, Lowe PC, Hester PY, Crittenden LB, Fadly AM 1984 Influence of sex-linked feathering phenotypes of parents and progeny upon lymphoid leukosis virus infection status and egg production. Poult Sci 63(3):401-413. Humphries EH, Danhof ML, Hlozanek I 1984 Characterization of endogenous viral loci in five lines of white Leghorn chickens. Virology 135(1):125-138. Iraqi F, Robinson D, Smith EJ 1995 A restriction enzyme map of the sex-linked late-feathering locus of chickens. Poult Sci 74(9):1515-1519. Iraqi F, Smith EJ 1994 Determination of the zygosity of ev21-k in late-feathering male White Leghorns using the polymerase chain reaction. Poult Sci 73(7):939-946. Khosravinia H 2009 Effect of the slow (K) or rapid (k+) feathering gene on carcass related traits of broiler chickens selected for breast and thighs weight. Genetika 45(1):112-118. Klein S, Ellendorff F 2000 Localisation of Xho1 repetitive sequences on autosomes in addition to the W chromosome in chickens and its relevance for sex diagnosis. Anim Genet 31(2):104-109. Lakshmanan N, Ponce de Leon FA, Smyth JR, Smith EJ 1992 Chromosomal assignment of the evil locus in chickens using fluorescent in situ suppression hybridization (FISH). Page 10 In: 10th European Colloquium on Cytogenetics of Domestic Animals. Bosma AA ed. University Press,
Bang et al. : Characteristics of Feathering in Early- and Late-Feathering KNC 165 Utrecht, The Netherlands. Lowe PC, Garwood VA 1981 Independent effects of K and k+ alleles and maternal origin on mortality and performance of crossbred chickens. Poult Sci 60(6):1123-1126. Martin JH 1934 Review the 'sexing baby chicks by Masui and Hashimoto. Poult Sci 13(3):190. Masui K, Hashimoto J, Ono I 1925 The rudimental copulatory organ of the male domestic fowl with reference to the sexual differentiation of chickens. Jpn J Zootech Sci 1(3): 3-15. McGibbon WH 1977 A sex-linked mutation affecting rate of feathering in chickens. Poult Sci 56(3):872-875. Mueller CD, Moultrie F 1952 Classification of sex-linked early and late feathering in 10-week-old chickens. Poult Sci 31(1):171-172. Plumart PE, Mueller CD 1954 Effect of sex-linked early feathering on plumage from 6 to 12 weeks of age. Poult Sci 33(4):715-721. Saeki Y, Katsuragi T 1961 Effect of early and late feathering gene on growth on New Hampshire, Leghorns and their crossbreds. Poult Sci 40(6):1612-1616. SAFRS 2011 Chicken sexing, primary industries and fisheries. Queensland government, Web http://www.dpi.qld.gov. au/27_2712.htm Saitoh Y, Mizuno S 1992 Distribution of XhoI and EcoRI family repetitive DNA sequences into separate domains in the chicken W chromosome. Chromosoma 101(8):474-477. Siegel PB, Mueller CD, Craig JV 1957 Some phenotypic differences among homozygous, heterozygous, and hemizygous late feathering chicks. Poult Sci 36(2):232-239. Sohn SH, Cho EJ, Kang BS 2012 Sex identification of newly hatched chicks by fluorescence in situ hybridization using a W-specific DNA probe in feather follicle cells. J Poult Sci 49(4):231-236. Sohn SH, Kim NY, Park DB, Song HR, Cho EJ, Choi SB, Heo KN, Choi HC 2013 Influence of early- and latefeathering phenotype on productive performance in the feather-sexing strains of Korean native chicken. Korean J Poult Sci 40(3):263-270. Sohn SH, Park DB, Song HR, Cho EJ, Kang BS, Suh OS 2012 Genotype frequencies of the sex-linked feathering and their phenotypes in domestic chicken breeds for the establishment of auto-sexing strains. J Anim Sci Tech 54(4):1-10. Somes RG 1969 Delayed feathering, a third allele at the K locus of the domestic fowl. J Hered 60(5):281-286. Somes RG 1970 The influence of the rate of feathering allele Kn on various quantitative traits in chickens. Poult Sci 49(5):1251-1256. Warren DC 1976 Feather-sexing chicks. Poult Tribune 82(2):32-34. Weissmann A, Reitemeier S, Hahn A, Gottschalk J, Einspanier A 2013 Sexing domestic chicken before hatch: A new method for in ovo gender identification. Theriogenology 80(3):199-205. Zhao J, Yao J, Li F, Yang Z, Sun Z, Qu L, Wang K, Su Y, Zhang A, Montgomery SA, Geng T, Cui H 2016 Identification of candidate genes for chicken early- and late-feathering. Poult Sci 95(7):1498-1503. Received Jun. 14, 2018, Revised Aug. 5, 2018, Accepted Aug. 9, 2018