식물병연구 Note Open Access Res. Plant Dis. 20(4) : 307-313(2014) http://dx.doi.org/10.5423/rpd.2014.20.4.307 Brugmansia mosaic virus Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp. in Korea 1 1 1 1 1 1 1 3 4 5,6 5,6 1,2 * 1, 2, 3, 4, 5 (UST), 6 Chung Youl Park 1, Bong-Sub Kim 1, Moon Nam 1, Min-A Lee 1, Da-Som Baek 1, Yang Su Bae 1, Eun-Hye Park 1, Jeong-Sun Kim 3, Jong-Yoon Choi 4, Seungmo Lim 5,6, Jae Sun Moon 5,6 and Su-Heon Lee 1,2 * *Corresponding author Tel : +82-53-950-5763 Fax: +82-53-950-6758 E-mail: suheon@knu.ac.kr 1 School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Korea 2 Institute of Plant Medicine, Kyungpook National University, Daegu 702-701, Korea 3 Agricultural Microbiology Division, National Academy of Agricultural Science, Rural Development Administration, Wanju 565-851, Korea 4 Apple Research Station, National Institute of Horticultural & Herbal Science, Gunwi 716-812, Korea 5 Biosystems and Bioengineering Program, University of Science and Technology (UST), Daejeon 305-350, Korea 6 Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806, Korea Received October 28, 2014 Revised November 25, 2014 Accepted December 3, 2014 In May 2013, an angel s trumpet leaves showing mosaic and malformation symptoms were collected from Suwon city, Gyeonggi-do. An analysis of the collected sample by transmission electron microscopy observation showed filamentous rod particles of 720-800 nm in length. On the basis of the these observations, we performed PCR against three reported Potyviruses (Brugmansia mosaic virus, Colombian datura virus and Brugmansia suaveolens mottle virus), and the sample was positive for BruMV. Pathogenicity and host range test of BruMV was determined by mechanical inoculation. Solanaceae (tobacco, tomato and eggplant) and Amaranthaceae (ground cherry) appeared typical virus symptoms. To determine coat protein of this virus, we designed specific primer pairs, and performed PCR amplification, cloning, and sequencing. Phylogenetic analysis showed that BruMV-SW was most closely related to BruMV isolate SK. Comparison of the BruMV-SW coat protein nucleotide sequences showed 92% to 99% identities to the other BruMV isolates. Keywords : Angel s trumpet, Bioassay, Brugmansia, Potyvirus Research in Plant Disease The Korean Society of Plant Pathology pissn 1598-2262, eissn 2233-9191 This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
308 (Brugmansia spp.) (Angel s trumpet), (Chellemi, 2011; Lucinda, 2010).,,,, 7 (Brugmansia arborea, Brugmansia aurea, Brugmansia insignis, Brugmansia sanguinea, Brugmansia suaveolens, Brugmansia versicolor, Brugmansia vulcanicola) (Bailey Bailey, 1976; Chellemi, 2011).,, 200 (Vernon, 2013)., (atropine), (scopolamine), (alkaloid),, (Bristol, 1969; Evans Lampard, 1972)., (Parkinson s disease), (Caridac problems) (Lorenzi Souza, 2001). (species) 5, Brugmansia mild mottle virus(brmmv, Tobamovirus) (Ilmberger, 2007), Colombian datura virus(cdv, Potyvirus) (Salamon Palkovics, 2005), Brugmansia suaveolens mottle virus(bsmov, Potyvirus)(Lucinda, 2008), Brugmansia mosaic virus(brumv, Potyvirus)(Damsteegt, 2013), Tomato spotted wilt virus(tswv, Tospovirus)(Nikolić, 2013), BruMV(Fumei, 2013) TSWV(Choi, 2014) 2. BruMV, (Fumei, 2013). BruMV 2013,., BruMV. 2013 5 (Fig. 1), BruMV, BruMV-SW,. 전자현미경검경. (direct negative staining) (Horne Wildy, 1963). (potassium phosphate buffer, ph 7.0). (Formvar film) grid(200 mesh) 1 30, 2.5% phosphotungstic acid(pta, ph 7.2) 1 l 2 Fig. 1. Symptoms caused by Brugmansia mosaic virus isolate SW (BruMV-SW) in the greenhouse. A: Brugmansia sp. plant showed mosaic, malformation (turtle-shape), B: Enlarge of A, C: Enlarge of B.
309 제거하고 투과전자현미경(CARL ZEISS LE0912AB, Germany)으 로 관찰하였다. 기주범위 및 병원성 분석. 병원성 검정과 기주범위 결정을 위하여 감염된 브루그만시아 잎 조직에 100배(W/V)의 0.01 M 인 산칼륨완충액을 첨가하여 마쇄한 뒤 silicon carbide(400 mesh; Sigma-Aldrich, USA)를 사용하여 즙액접종하였다. 지표식물은 7과 33종을 사용하여 3반복 수행한 후, 8주간 접종엽과 상엽, 줄 기에서의 병징을 관찰하였다. 또한, 감염은 되었으나 병징 발현 이 되지 않는 식물체를 고려하여 생물검정에 이용한 모든 지표 식물에 대하여 RT-PCR 검정을 실시하였다. cdna 합성 및 PCR 진단. 채집된 시료의 종 동정을 위하여 병 징이 강하게 나타난 브루그만시아 잎으로부터 전체 RNA(Total RNA)를 추출하였다. 전체 RNA는 TRI Reagent(Molecular Research Center, USA)를 이용하여 공급사의 매뉴얼에 따라 50 μl를 추출하였다. 추출한 전체 RNA는 RN25(5 -NNN NNN NNN NNN NNN NNN NNN NNN N-3 ) 프라이머와 TOPscript Reverse Transcriptase(Enzynomics, Korea)를 사용하여 cdna를 합성한 뒤 PCR 증폭의 주형(Template)으로 사용하였다. PCR 증폭은 BsMoV, BruMV, CDV 3종에 대한 특이적 프라이머(Table 1) 를 이용하여 Lim 등(2014)의 방법을 이용하였다. 외피단백질 유전자 염기서열 분석. 외피단백질 영역을 증 폭하기 위하여 NCBI Genbank에 등록되어 있는 BruMV 2개의 분리주(Genbank accession no. NC020105, JX874139)의 공통 된 염기서열로부터 특이적 프라이머를(BruM-CP-F: 5 -CTG AGC TTG CAC TGA AGA-3 & BruMV-CP-R: 5 -GAT TTG GCA TCA GAA GGG-3 ) 설계하였다. 염기서열 결정은 설계된 프라이머를 이용하여 증폭된 PCR 산물 1,182 bp를 정제 후 이 등(2010)의 방법으로 클로닝을 수행한 뒤 솔젠트(SolGent, Korea)에 염기서 열 결정을 의뢰하였다. 결정된 염기서열은 DNAMAN 7.0(Lynnon Biosoft, Canada) 프로그램을 이용하여 유연관계 분석을 실시하 였다. 채집한 시료 1주를 전자현미경으로 검경한 결과, 720-800 nm 길이의 사상형 입자가 관찰되었다(Fig. 2). 이를 토대로 본 시료 에 감염된 바이러스는 Potyvirus 속의 종으로 사료되어 진단용 프라이머를 이용하여 3종의 기보고 바이러스에 대하여 PCR을 수행한 결과, BruMV로 진단되었다. BruMV에 감염된 브루그만시아 잎 조직을 마쇄하여 추출한 즙액을 접종원으로 사용하여 7과 33종 지표식물에 기계적 접 종하여 병원성과 기주범위를 확인하였다. 생물검정 결과 Petunia hybrida를 포함한 9종의 담배에서 국부감염 되었으며, 천일홍 (Gomphrena globosa)을 포함한 17종의 지표식물에서 전신감 염을 확인하였다. 비름과(Amaranthaceae) 속의 천일홍의 경우 무병징(symptomless)을 나타냈고, RT-PCR을 이용하여 진단한 결과 최종 감염을 확인하였다. 농업적으로 중요한 작물 중 하나 인 토마토(Lycopersicon esculentum)와 가지(Solanum melongena) Table 1. Primer names, oligonucleotide sequences and expected sizes of primer sets used in PCR reactions Primer name Primer sequences (5 3 ) BruMV-F GAGGTAATGGCAGAATTGC BruMV-R AATGCCATGTCATGGATGCTT CDV-F GGGAGAGCTCCTTACCTAGC CDV-R CCATGTATGTTTGGTGATGTACC BsMoV-F TGGAGTATGGACAATGATGGA BsMoV-R ATATCGTCAGGAGCGGTCTT Expected size (bp) Reference 1,679 Fumai et al. 2013 511 Chellemi et al. 2011 442 Lucinda et al. 2008 Fig. 2. Particles of Brugmansia mosaic virus (BruMV) isolate SW in Brugmansia sp. naturally infected. A, B, C; filamentous rod shape virions are present in direct negatively strained with phosphotungstic acid (PTA) from symptomatic leaf tissue and analyzed by an electron microscopy (EM). Scale bar represents 200 nm.
310 Fig. 3. Symptoms produced on test plants infected with Brugmansia mosaic virus isolate SW (BruMV-SW). A: Petunia hybrida - mosaic and necrotic spots, B: Nicotiana glutinosa - mosaic, C: N. rustica - severe mosaic; D: N. tabacum cv. Samsun - mosaic and necrotic ring spots; E: N. tabacum cv. Xanthi NC - mosaic and necrotic spots; F: N. tabacum cv. Xanthi - mosaic and necrotic spots; G: N. tabacum cv. Bright yellow - chlorosis spots, H: N. benthamiana - chlorosis and yellowing; I: N. occidentalis - necrosis; J: Lycopersicon esculentum - mosaic; K: Solanum melongena - necrotic spots, L: Physalis floridana - mosaic. (mosaic) (necrotic spot). Nicotiana benthamiana 14 (chlorosis), (yellowing). N. clevelandii N. occidentalis 7 (necrosis), N. glutinosa N. rustica (Fig. 3). (Solanaceae) (Capsicum annuum) (Datura stramonium)., (Chenopodiaceae) (Chenopodium amaranticolor) (C. quinoa), (Aizoaceae) (Tetragonia tetragonoides). (Cucurbitaceae) (Cucumis melo var. makuwa), (Citrullus vulgaris), (Cucumis sativus), (Lagenaria leucantha), (Cucurbita pepo), (Cucumis melo), (Brassicaceae) (Brassica juncea), (Leguminosae) (Phaseolus vulgaris), (Pisum sativum), (Vigna unguiculata), (Phaseolus angularis) 14. RT-PCR (Table 2). PCR,, 1,182 (nucleotide, nt). NCBI BLAST, NCBI (GenBank accession no. AB851482). NCBI GenBank Potyvirus 19, BruMV SK (Fig. 4). DNA- MAN Observed Divergency SK 99%
311 Table 2. Host range and symptoms of Brugmansia mosaic virus isolate SW Family Species Symptoms a RT-PCR detection b Solanaceae Capsicum annuum -/- - Datura stramonium -/- - Solanum melongena -/NS o Physalis floridana -/M o Lycopersicon esculentum -/M o Lycopersicon esculentum Mill -/M o Petunia hybrida LLc/M,NS o Nicotiana benthamiana -/Chl, Y o N. clevelandii -/M,N o N. debneyii LLn/M,NS o N. glutinosa LLn/M o N. occidentalis LLn/N o N. rustica -/M o N. tabacum cv. KY57 LLn/CS o N. tabacum cv. Bright yellow LLn/CS o N. tabacum cv. Samsun LLn/M,RSn o N. tabacum cv. Xanthi nc LLn/M,NS o N. tabacum var.turkish LLn/M o Amaranthaceae Gomphrena globosa -/S o Chenopodiaceae Chenopodium amaranticolor -/- - Chenopodium quinoa -/- - Cucurbitaceae Cucumis melon -/- - Citrullus vulgaris -/- - Lagenaria leucantha -/- - Cucumis sativus -/- - Cucurbita pepo -/- - Cucumis melo -/- - Aizoaceae Tetragonia tetragonoides -/- - Brassicaceae Brassica juncea -/- - Leguminosae Phaseolus vulgaris -/- - Vigna unguiculata -/- - Pisum sativum -/- - Phaseolus angularis -/- - a Inoculation leaf/upper leaf. Chl, Chlorosis; CS, Chlorotic spot; LLc, Chlorotic local lesion; LLn, Necrotic local lesion; M, Mosaic; N, Necrosis; NS, Necrotic spot; Necrotic ring spot, Rsn; S, Symptomless; Y, Yellowing. b ( ): Positive reaction, (-): negative reaction., D-437 92%. BruMV SW SK. BruMV 7 RT-PCR ( )., BruMV,,.,
312 Fig. 4. Phylogenetic tree calculated from the nucleotide (A) and amino acid (B) sequences of the coat protein of BruMV-SW and published species of the 19 Potyviruses. The abbreviations of virus names and GenBank accession number used in the phylogenetic tree analysis: Pepper mottle virus (PepMoV; EU586128), Brugmansia suaveolens mottle virus (BsMoV; NC0145361), Peru tomato virus (PTV; AJ516010), Potato virus V (PVV; NC004010), Wild potato mosaic virus (WPMV; NC004426), Pepper yellow mosaic virus (PepYMV; NC014327), Bidens mottle virus (BiMoV; EU250210), Verbena virus Y (VVY; NC010735), Pepper severe mosaic virus (PeSMV; NC008393), Potato virus Y (PVY; EF026075), Sunflower chlorotic mottle virus (SuCMoV; NC014038), Narcissus yellow stripe virus (NYSV; NC011541), Turnip mosaic virus (TuMV; NC002509), Lettuce mosaic virus (LMV; NC003605), Celery mosaic virus (CeMV; NC015393), Panax virus Y (PanVY; GQ916624), Leek yellow stripe virus (LYSV; NC004011), Brugmansia mosaic virus (BruMV; JX874139 (SK isolate), AB851482 (D-437 isolate)).,. 2013 5,. 720-800 nm. 3 (Brugmansia mosaic virus, Colombian datura virus, Brugmansia suaveolens mottle virus) RT-PCR, BruMV. BruMV. (,, ) ( ). BruMV, PCR,,., BruMV-SW BruMV SK. BruMV 92% 99%. Acknowledgements This research was supported by a grant from the Next-Generation Biogreen 21 Program (PJ009033), Rural Development Administration, Republic of Korea and by a grant from the Animal and Plant Quarantine Agency (QIA), Ministry of Agriculture, Republic of Korea (Project Code No. Z-1542051-2013-15-01). References Bailey, L. H. and Bailey, E. Z. 1976. Hortus Third. A concise dictionary of plants cultivated in the United States and Canada. Pub, Co., Inc., New York, 1290 pp. Bristol, M. L. 1969. Tree Datura drugs of the Colombian Sibunoy. Botanical Museum Leaflets, Harvard University. 22: 165-227. Chellemi, D. O., Webster, C. G., Baker, C. A., Annamalai, M., Achor, D. and Adkins, S. 2011. Widespread occurrence and low genetic diversity of Colombian datura virus in Brugmansia suggest an anthropogenic role in virus selection and spread. Plant Dis. 95: 755-761. Choi, S.-K., Cho, I.-S., Choi, G.-S. and Yoon, J.-Y. 2014. First report of Tomato spotted wilt virus in Brugmansia suaveolens in Korea. Plant Dis. 98: 1283.2. Evans, W. C. and Lampard, J. F. 1972. Alkaloids of Datura suaveolens. Phytochemistry 11: 3293-3298. Horne, R. W. and Wildy, P. 1963. Virus structure revealed by negative staining. Advan. Virus Res. 10: 101-170. Ilmberger, N., Willingmann, P., Adam, G. and Heinze, C. 2007. A Subgroup 1 Tobamovirus Isolated from Brugmansia sp. and its Detection by RT-PCR. J. Phytopathology 155: 326-332. Lee, J. H., Park, S. J., Nam, M., Kim, M. J., Lee, J. B., Sohn, H., Choi, H. S.,
313 Kim, J.-S., Lee, J.-S., Moon, J.-S. and Lee, S.-H. 2010. Identification of a New Potyvirus, Keunjorong mosaic virus in Cynanchum wilfordii and C. auricilatum. Res. Plant Dis. 16: 238-246. (In Korean) Lim, S., Zhao, F., Yoo, R. H., Igori, D., Lee, S. H., Lim, H. -S. and Moon, J. S. 2014. Characteristics of a Lettuce mosaic virus isolate infecting lettuce in Korea. Plant Pathology J. 30: 183-187. Lorenzi, H. and Souza, H. M. 2001. Plantas ornamentais do Brasil, 3rd ed. Nova Odessa, SP, Instituto Plantrum de Estudos da Flora Ltda. 1088 pp. Lucinda, N., Inoue, N.-A. K., Kitajima, E. W. and Nagata, T. 2010. Complete genome sequence of Brugmansia suaveolens mottle virus, a Potyvirus from an ornamental shrub. Arch Virol. 155: 1729-1732. Lucinda, N., Nagata, T., Inoue, -N. A. K., Salaroli, R. B. and Kitajima, E. W. 2008. Brugmansia suaveolens mottle virus, a novel potyvirus causing leaf mottling of Brugmansia suaveolens in Brazil. Arch Virol. 153: 1971-1976. Nikolić, D., Stanković, I., Vučurović, A., Ristić, D., Milojević, K., Bulajić, A. and Krstić, B. 2013. First Report of Tomato spotted wilt virus on Brugmansia sp. in Serbia. Plant Dis. 97: 850.1. Salamon, P. and Palkovics, L. 2005. Occurrence of Colombian datura virus in Brugmansia hybrids, Physalis peruviana L. and Solanum muricatum Ait. in Hungary. Acta Virol. 49: 117-122. Zhao, F., Lim, S., Yoo, R. H., Lim, H.-S., Kwon, S.-Y., Lee, S.-H. and Moon, J. S. 2013. Complete genome sequence of a South Korean isolate of Brugmansia mosaic virus. Arch Virol. 158: 2019-2022.