Kor. J. Microbiol. Biotechnol. Vol. 35, No. 4, 292 297(2007) 고광도와질소결핍이 Haematococcus pluvialis 의색소생합성에미치는영향 윤지현 곽인규 진언선 * 한양대학교생명과학과 Influence of High Light and Nitrate Deprivation on the Carotenoid Biosynthesis in Haematococcus pluvialis. Yun, Ji-hyun, In-kyu Kwak, and EonSeon Jin*. Department of Life Science, Hanyang University of Korea The unicellular green alga, Haematococcus pluvialis used as a biological production system for astaxanthin. It accumulates large amounts of the red ketocarotenoid astaxanthin when exposed to various environmental stress such as active oxygen species and high light intensities. To induce astaxanthin biosynthesis of H. pluvialis, cells were incubated in either nitrate free at 25 o C under continuous high light intensity (1,000 µmol photons m -2 s -1 ) for 2 days or high light stress only. Expressions of astaxanthin biosynthetic genes such as carotenoid hydroxylase, IPP isomerase and β-carotene ketolase were monitored under different culture conditions by using real time RT-PCR. All the subjected genes increased their expression under highlight and N- deprivation condition where a large amount of astaxanthin was accumulated. Key words: Haematococcus pluvialis, carotenoids, astaxanthin 서 단세포녹조류인, Haematococcus pluvialis 는활성산소에의한산화적스트레스, 고광도고염도, 고온등의배양조건에서 ketocarotenoid astaxanthin (3,3'-dihydroxy-β, β-carotene-4,4'-dione) 을다량으로축적한다 [9]. 일반적으로 carotenoid 는광수확색소로서중요한역할을하며, 과도한빛에의한광합성기관의광산화적손상에대한보호에도중요한역할을한다 [2]. 일반적으로 astaxanthin 이축적되는것은이생물체와이와연관된다른생물체들이환경적스트레스에대응하는생존전략기작이라고생각되고있다 [3]. 현재 H. pluvialis 내의다수의 carotenoid 생합성유전자들이분리되었고, 일부유전자들의특성이밝혀졌다 [4, 10, 11, 16, 17]. 하지만, 스트레스에대응하는 H. pluvialis 의분자적인방어기작은아직완전히보고되지않았다. Astaxanthin 은 red-orange 색소로자연계의여러생물체내에서강력한생물학적항산화제역할을한다. Astaxanthin 은인간의건강과영양에대해다양한잠재력과실용성을지니고있다. 이색소는항산화능력으로인해점점상업적관심이증가하고있으며, 이는제약과화장품산업에중요한요인으로작용한다 [9, 14]. 최근연구에서 astaxanthin 의항산화능력, 항염증성기능, 암과당뇨병에관한영향, 면역계와눈의건강등다른측면에서매우중요한활성을나타낸다고보고되고있다 [5,9,16]. 그리고미세녹조류인 H. 론 pluvialis는자연계에풍부하게존재하며, 항고혈압성능력과신경보호에대한잠재력등을포함하는인간건강증진에이용할수있다. Astaxanthin은 free astaxanthin, astaxanthin monoester, astaxanthin diester 세가지의형태로존재한다고알려져있는데 astaxanthin 의구조가 Fig. 1에나타나있으며, astaxanthin monoester는 3번탄소에지방산이결합되어있는형태이고 diester는각각고리구조의 3번탄소에지방산이결합되어있는형태이다. Fig. 2에서는 astaxanthin 생합성경로와관련효소들을보여주고있다. 이들생합성효소중에특히 β-carotene ketolase (BKT), isopentenyl pyrophosphate isomerase(ipp isomerase), carotenoid hydroxylase유전자들에대한발현양상을본연구에서집중적살펴보게되었다. BKT는 β-carotene을 canthaxanthin으로전환시키며, zeaxanthin을 astaxanthin으로전환시키는역할을한다. 그러므로이효소는 H. pluvialis의 astaxanthin 생합성에중요한역할을한다. IPP isomerase는 isoprenoid 전구체의생합성과관련있으며고광도의빛에의해발현량이증가한다 [17]. IPP isomerase는 IPP는가역적인이성질체의합성을촉매하여 dimethylallyl pyrophosphate 을생산하며, dimethylallyl pyrophosphate은 carotenoid의생합성과다른많은 long-chain isoprenoids가반응을시작할 *Corresponding author Tel: 82-2-2220-2561, Fax: 82-2-2299-2561 E-mail: esjin@hanyang.ac.kr Fig. 1. Astaxanthin structure.
CAROTENOID BIOSYNTHESIS IN HAEMATOCOCCUS PLUVIALIS 293 재료및방법 Fig. 2. Biosynthethic pathway of astaxanthin in Haematococcus pluvialis. Isopentenyl pyrophosphate; IPP, Dimethylally pyrophosphate; DMAPP, Phytoene synthesae; PSY, Phytoene desaturase; PDS, ζ-carotene desaturase; ZDS, Lycopene β cyclase; LYC, β-carotene ketolase; BKT, Carotenoid hydroxylase; CHY. 수있도록유도한다. Phytoene desaturase(pds) 와 ζ-carotene desaturase(zds) 는구조적으로나기능적으로비슷한효소이다. 이효소들은 phytoene 을 ζ-carotene 을거쳐 lycopene 으로전환시키는역할을한다. 광합성기관의 carotenoid 와 secondary carotenoid 는 2 환식화합물이다. Lycopene 에서 α- carotener 과 β-carotene 으로생합성경로가나누어질때 carotenoid 생합성에있어서중요한경로가되고, lycopene 에서 β-carotene 로의경로는 lycopene β-cyclases (LYC) 가촉매한다 [8]. Carotenoid hydroxylase 는 canthaxanthin 의초기형성을촉매하고, 그후 canthaxanthin 초기형성은 astaxanthin 으로전환된다 (Fig. 2). 그동안 astaxanthin 합성유전자들의단편적이고개별적인연구들이보고되었으나 [6, 11, 17] 본연구에서는고광도스트레스와더불어질소결핍스트레스에노출된 H. pluvilais 의생합성관련유전자변화를총체적으로살펴보기위해 Northern 및 Real-time PCR 을수행하여이들의발현양상을살펴보았다. 또한배양조건의차이로인한색소의변화를알아보기위해 HPLC 분석도수행하였다. Cell의배양액조성과 carotenoid 생합성유도본연구에사용된 Haematococcus pluvialis는 Texas 대학의 Culture Collection (UTEX) 에서구입되어배양된것으로인하대해양생물공학실험실로부터분양받았으며, MV(Mes- Volvox)medium에서배양되었다. MV medium에서배양되는영양생장단계의세포 (green cell) 의배양조건은 ph 6.7의배지에, 25 o C의온도와 15 µmol photons m -2 s -1 의지속적인광도로 120 rpm에서진탕배양하였다. MV medium의조성은다음과같다. Ca(NO 3 ) 2 4H 2 O, 11.8 mg/l; Na 2 glycerophosphate 5H 2 O, 6 mg/l; MgSO 4 7H 2 O, 4 mg/l; KCl, 5 mg/ L; NH 4 Cl, 2.67 mg/l; biotin, 25 µg/l; vitamin B 12, 15 µg/ L; PIV total solution(na 2 EDTA, 0.0045 mg/l; FeCl 3 6H 2 O, 0.582 mg/l; MnCl 2 4H 2 O, 0.246 mg/l; ZnCl 2, 0.03 mg/ L; CoCl 2 6H 2 O, 0.012 mg/l; Na 2 MoO 4 2H 2 O, 0.024 mg/l; MES 1.95 g/l. Astaxanthin 생합성이유도된세포 (red cell) 배양하기위하여지수성장기에있는 (2.6 10 5 cell ml -1 ) cell 을 N free media인 Ca(NO 3 ) 2 4H 2 O와 NH 4 Cl 대신 CaCl 2 20 mg/l을첨가한 MV에접종하고 25 o C의온도조건과 1,000 µmol photons m -2 s -1 의광도를주어이틀동안배양하였다. 세포의수는 hemocytometer로측정하였다. 색소분석 Astaxanthin의색소분석은 HPLC(High Performance Liquid Chromatography) 를이용하였다. 샘플을 90% acetone으로 3 분간 homogenizer를이용하여색소를추출하고원심분리를 13,000 rpm로 2분간하여, 상층액만주사기필터 (0.2 µm nylon filter) 를이용해여과하였다. HPLC 분석을하기위해 20 µl의샘플을주입하였고분리시간은 25분동안진행되었다. HPLC는 Shimadzu 사의 LC-20A Prominence를이용하였다. Column은 Waters Spherisorb S5 ODS1 4.6 250 mm, 5 um Cartridge Column(Maple St. Milford, Massachusetts, USA) 을사용하였고 column 온도는 40 o C로하였다. 색소를분리하는용매로 0.1M Tris-HCl ph 8.0, acetonitrile, methanol, ethyl acetate가이용되었다. 기기가작동하는동안용매의농도는다음과같다 : 14% 0.1M Tris- HCl(pH 8.0), 84% acetonitrile, 2% methanol(0분 ~15분 ), 68% methanol and 32% ethyl acetate(15분 ~19분 ). 그후 6분의 post-run 동안은처음시작할때의용매농도와같다. Column 내의유속은분당 1.2 ml로지속되었다 [7]. 분리된 carotenoid와 astaxanthin ester form은 photodiode array detector(spd-m20a, Shimadzu) 를통해분석하였고인증된 standard로비교하였다. 피크를정량하기위해 ketocarotenoid 는 476 nm에서다른 carotenoid는 445 nm에서확인하였다. Astaxanthin standard는 Sigma-Aldrich에서구입하였고그밖에다른 standard는 DHI(Agern Allé, HØrsholm,
294 YUN et al. Table 1. Gene specific primers sets and PCR product characteristics. Primer Primer sequence (5'-3') Gene bank ID Actin forward GTGGACACCTCAGCGTTTAGC DV203941 Actin reverse ACCATCAACAAGTGCGACATT Carotenoid hydroxylase forward GCGCGGGCGATGAGCACAG AY187011 Carotenoid hydroxylase reverse GAGCATGGCGGGCAGTCCTTTGAT Phytoene desaturase forward GGACGGCGCCCCACCTGAG AY768691 Phytoene desaturase reverse GGCCGGCGCAAACACCA IPP isomerase forward CGGGCAGTCGCAGGATGAGC AY786411 IPP isomerase reverse ACGTTGGCCCGGATGAATAAGATG β-carotene ketolase forward CCAAATCAGGCTACCGACATCCAT D45881 β-carotene ketolase reverse GCCCCCAGCATTTGCATCACCACT Chlorophyll a,b binding protein forward TGAAGGACATGAAGACGAAAGAGC AY786531 Chlorophyll a,b binding protein reverse GCGCAGCACAGGGATGG Denmark) 에서구입하였다. RNA 추출과 Real-time PCR 두가지조건의세포 (green과 red cell) 에서 total RNA 를추출하기위해 TRIzol reagent(invitrogen, California, USA) 를이용하였다. Reverse transcription으로부터 first strand의 cdna를얻기위해 Invitrogen의 superscript III Reverse Transcriptase kit(california, USA) 를제조사의설명서에따라사용하였다. 각조건에서추출한 6 µg의 total RNA를이용하여 cdna로합성하였다. 이렇게얻어진 cdna로 real-time PCR을수행하였다. Real-time PCR은 Thermal Cycler Dice TM Real Time System TP 800(Takara, Naginatahokocho, Koyto, Japan) 로수행하였으며. 증폭을확인하기위해 SYBR Premix Ex Taq TM ((Takara, Naginatahoko-cho, Koyto, Japan) 을사용하였다. PCR 조건은 95 o C에서 10초동안 (pre-denaturation) 1cycle, 95 o C에서 5초 (denaturation), 56 o C에서 45초동안 (annealing) 40 cycle로실행하였다. Primer 정보는 Table 1에정리하였고대조구로 actin 유전자를사용하였다. 결과및고찰 Astaxanthin 생합성이유도된 H. pluvialis 배양조건영양생장중의세포인 green cell 은 ph 6.7 인 MES-Volvox 배지에서온도 25±1 o C, 15 µmol photons m -2 s -1 의꾸준한광도로 growth chamber 에서배양하였다. Green cell 에서 red cell 로되기위해질소가결핍된배지에서 1000 µmol photons m -2 s -1 의꾸준한광도로 48 시간동안스트레스를주어배양하였다. Fig. 3a 에서녹색이었던세포가질소결핍배지에서높은광도를주어배양하였더니 Fig. 3b 와같이 astaxanthin 을합성한상태인 red cell 로바뀌었다. 세포질에서 astaxanthin 이생합성되어뭉쳐있는것을볼수있다. Fig. 3. Light micrographs of H. pluvialis at different culture condition. (A) Green cells were in MES-volvox growth medium at 25 under a continuous light intensity of 15 µmol photons m -2 s -1. (B) Red cells were incubated under light intensity 1000 µmol photons m -2 s -1, nitrate free medium for 48 h. 각조건에따른 H pluvialis의광합성색소변화각배양조건에따른광합성색소의변화를보기위해 HPLC를이용하여색소분석을하였다. Green cell에거의없던 peak들 (2, 9, 12) 이 red cell에서보여지고있다 (Fig. 4). 이들은 green cell에서 stress를받아유도된 astaxanthin 으로각각 astaxanthin, astaxanthin monoester, astaxanthin diester 로확인되었다. HPLC 결과로얻은각 carotenoid의정량을통해 total carotenoid에서 total astaxanthin과 lutein 그리고 β-carotene의비율을보았다. Total carotenoid를 100% 로기준하였을때, green cell에서 4.62% 이었던 total astaxanthin이 red cell에서 83.43% 로늘어난것을볼수있다. 반면, lutein은 42.83% 에서 7.53% 로, β-carotene은 13.32에서 2.64% 로 green cell 보다 red cell에서감소한것을볼수있다. 즉, total astaxanthin의비율이늘어난반면 lutein과 β-carotene의비율이줄어든것을볼수있다 (Fig. 5a). Total astaxanthin은 free astaxanthin, astaxanthin monoester, astaxanthin diester의 3가지그룹으로나뉜다 [15]. Total astaxanthin을 100% 로기준하였을때 monoester는 48.76% 에서 76.65% 로증가하였으며, free astaxanthin은
CAROTENOID BIOSYNTHESIS IN HAEMATOCOCCUS PLUVIALIS 295 Fig. 4. HPLC profiles of pigments in H. pluvialis. (A) Pigment profile of H. pluvialis before stress, (B) cells exposed to nitrogen deficiency and high light for 48 hrs. 1: neoxanthin 2: violaxanthin 3: astaxanthin free form 4: antheraxanthin 5: lutein 6: zeaxanthin 7: chlorophyll a 8: chlorophyll b 9: astaxanthin monoester 10: α-carotene 11: β-carotene 12: astaxanthin diester 세그룹의비율이각각약 5%, 70%, 25% 정도로존재하는것으로보고되고있으나 [12], 본실험에서는 Fig. 3b 처럼 astaxnathin 이축적중인 red cell 의경우각각의 astaxanthin ester 타입의조성이다르게나타나고있음을알수있다. 여러형태의 astaxanthin 의조성비는, 각 cell 을키우는배지의종류마다혹은환경조건에따라차이가나타나는것을알수있다. 고광도와질소결핍스트레스를받게되면 lycopene 에서 α-carotene 의경로가저해되어 lutein 합성이줄어들고 β- carotene 은하위경로인 astaxanthin 합성경로는가속화되어 β-carotene 의농도가줄어드는대신 astaxnthin 의합성이증가되고있다고유추할수있다. Fig. 5. Changes in carotenoid composition in green and red cell. Peak identification as given in Fig. 4. Changes in concentration of total astaxanthin, lutein, β-carotene (a) and astaxanthin (b). 17.9% 에서 11.9% 로, diester 그룹은 33% 에서 11.5% 로감소하는변화를보였다. Fig. 5b 는세가지 astaxanthin 형태의절대량을나타내고있다. Green cell 에서 free form 은 0.033 mg/l, astaxanthin monoester 에서는 0.099 mg/l, astaxanthin diester 에서 0.065 mg/l 의함량을보이고있으나, red cell 에서는각각 1.19 mg/l, 7.7 mg/l, 1.15 mg/l 로각각의농도가증가하였다. 완전하게 red cell 로전환되었을경우에 고광도와질소결핍스트레스에따른 astaxanthin 생합성관련유전자의발현 Real-time RT-PCR을통해 green cell와 red cell에서의 astaxanthin 생합성관련유전자의발현차이여부를보았다 (Fig. 7). Astaxanthin 생합성관련 gene인 isopentenyl pyrophosphate isomerase, β-carotene ketolase, carotenoid hydroxylase 유전자들의발현정도를정확하게정량하기위해 real-time RT-PCR을수행하였는데먼저각조건의 cell에서추출한 total RNA를 cdna로역전사하였다. 각유전자에대한고유의 primer를설정하여사용하였고 melting curve를분석하여단일밴드가나오는지확인하였다. Fig. 8 의 Real-time PCR 결과는 housekeeping gene인 actin과대조군인 green cell을기준으로하였을때의상대적정량을나타낸다. 기준점 1 보다클때는발현양의증가를, 낮을때는발현양의감소를의미한다. Carotenoid hydroxylase의경
296 YUN et al. 요 약 Fig. 6. HPLC chromatogram of pigments of H. pluvialis. Peak identification as given in Fig. 4. Fig. 7. Expression of astaxanthin biosynthesis genes calculated by quantitative Real-Time PCR. Each bar shows the relative expression using actin as the endogenous control. 1: actin 2: carotenoid hydroxylase 3: phytoene desaturase 4: isopentenyl pyrophosphate isomerase 5: β-carotene ketolase 6: chlorophyll a-b binding protein. 우 red cell 에서 green cell 보다약 20 배의높은발현율을보였고 phytoene desaturase 의경우는약 4 배, isopentenyl pyrophosphate isomerase 는 1.61 배, β-carotene ketolase 는 3.13 배의발현양의증가를보인반면, chlorophyll a-b binding protein(cab) 는 0.3 배로 red cell 보다 green cell 에서더높게발현되는양상을보였다. HPLC 를이용한색소분석에서광및질소결핍스트레스조건에서 total carotenoid 비율은 green cell 에서 red cell 이되면서증가하고, 반대로 total chlorophyll 은감소하는현상을보인다 (Fig. 6). 광스트레스에서는일반적으로엽록소의합성이감소되고더불어 Cab 유전자들의발현이줄어들기때문에 [7] 엽록소의농도가줄고더불어 Cab 유전자의발현이감소하고있다는것은세포가광스트레스를받고있다는강력한증거를제공한다. 이와같은조건에서 astaxanthin 합성경로에있는유전자들은생장하기좋은조건에서자란 green cell 일때보다고광도스트레스와질소결핍배지에서배양한 red cell 일때더높은발현을보이고있는것을확인함으로써 astaxanthin 생합성에관련한효소들의유전자가전사단계부터활성화되어 astaxanthin 생합성이촉진된다고사료되었다. H. pluviails는고광도와질소결핍배지조건에서 ketocarotenoid의일종인 astaxanthin을다량축적하는녹조류이다. 스트레스가없는조건에서키운 green cell과 astaxanthin이합성된 red cell을 HPLC를통해비교해본결과각색소의양이변화하는것을볼수있었다. 여러 ester 형태의 astaxanthin이생합성되고, zeaxanthin이늘어난반면, lutein과 β-carotene은감소하였다. 또한 total chlorophyll의양이줄어드는대신 total carotenoid의양이늘어남을보였다. H. pluvilalis에서찾아낸 astaxanthin 생합성경로에있는 carotenoid hydroxylase, phytoene desaturase, isopentenyl pyrophosphate isomerase, β-carotene ketolase 유전자는음성대조군인 chloroplast chlorophyll a-b binding protein와는달리 cell이성장하기좋은조건의상태보다 astaxanthin을생합성하기위해고광도의스트레스를받았을때더높은발현양상을보이는것을확인할수있었다. 감사의글 이연구는한국학술진흥재단의 2005 년도협동연구지원 ( 과제번호 : C0014) 에의하여이루어졌으며이에감사드립니다. REFERENCES 1. Arnon, D. I. 1949. Copper enzymes in isolated chloroplasts. Polyphenoxidasein Beta vulgaris. Plant Physiol. 24:1-15. 2. Bartley, G. E. and P. A. Scolink. 1995. Pigment for photoprotection, visual attraction, and human health. Plant Cell. 7: 1027-1038. 3. Boussiba, S. 2000. Carotenogenesis in the green alga Haematococcus pluvialis: Cellular physiology and stress response. Plant Physiol. 108: 111 117. 4. Grünewald, K., M. Eckert., J. Hirschberg. and C. Hagen. 2000. Phytoene desaturase is localized exclusively in the chloroplast and upregulated at the mrna level during accumulation of secondary carotenoids in Haematococcus pluvialis (Volvocales, chlorophyceae). Plant Physiol. 122: 1261 1268. 5. Guerin, M., M. E. Huntley., and M. Olaizola. 2003. Haematococcus astaxanthin: applications for human health and nutrition. Trends Biotechnol. 21:210-216. 6. Huang, J. C., F. Chen. and G. Sandmann. 2006. Stressrelated differential expression of multiple β- carotene ketolase genes in the unicellular green alga Haematococcus pluvialis. Journal of Biotechnol. 122: 176-185 7. Jin, E. S., B. Feth. and A. Melis. 2003. A Mutant of the green alga Dunaliella salina constitutively accumulates zeaxanthin under all growth conditions. Biothecnol. Bioeng.
CAROTENOID BIOSYNTHESIS IN HAEMATOCOCCUS PLUVIALIS 297 81: 115-124. 8. Jin, E. S., C. G. Lee, and J. E. W. Polle. 2006. Secondary carotenoid accumulation in Haematococcus (chlorophyceae) biosynthesis, regulation and biotechnology. J. Microbiol. Biotechnol. 16: 821-831 9. Kobayashi, M., Y. Kurimura., T. Kakizono., N. Nishio. and Y. Tsuji. 1997. Morphological changes in the life cycle of the green alga Haematococcus pluvialis. J. Ferment. Bioeng. 84: 94-97. 10. Kobayashi, M. 2003. Astaxanthin biosynthesis enhanced by reactive oxygen species in the green alga Haematococcus pluvialis. Biotech. Biopro. Eng. 8: 322-330. 11. Linden, H. 1999. Carotenoid hydroxylase from Haematococcus pluvialis: cdna sequence, regulation and functional complementation. Biochim. Biophys. Acta. 1446: 203-212. 12. Lorenz, R. T. and G. R. Cysewski. 2000. Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 18: 160-167 13. Lotan, T. and J. Hirschberg. 1995. Cloning and expression in Escherichia coli of the gene encoding β-4-c-oxygenase, that converts β-carotene to the ketocarotenoid canthaxanthin in Haematococcus pluvialis. FEBS. Lett. 364: 125-128. 14. Melis, A., M. Spangfort. and B. Andersson. 1987. Lightabsorption and electrontransport balance between PSII and PSI in spinach chloroplasts. Photochem Photobiol. 45: 129-136. 15. Miao, F., D. Lu, M. Zeng, and Y. Li. 2006. Charaterization of astaxanthin esters in Haematococcus pluvialis by liquid chromatography-atmospheric pressure chemical ionization mass spectrometry. Anal. Biochem. 352:176-181 16. Olaizola, M. 2003. Commercial development of microalgal biotechnology: From the test tube to the marketplace. Biomol. Eng. 20: 459-466. 17. Steinbrenner, J. and H. Linden. 2002. Light induction of carotenoid biosynthesis genes in the green alga Haematococcus pluvialis: Regulation by photosynthetic redox control. Plant Mol. Bio. 52: 343-356. 18. Sun, Z., F. X. Cunningham. and E. Gantt. 1998. Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. Proc. Natl. Acad. Sci. USA 95: 11482-11488. (Received Oct. 4, 2007/Accepted Nov. 20, 2007)