Korean Society for Biotechnology and Bioengineering Journal 32(4): 311-318 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.311 ISSN 1225-7117 / eissn 2288-8268 Research Paper HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 이승제 1, 임은경 1, 김가연 1, 전미지 1, 김상용 2, 김영민 1, 유제근 1 * Study of Anti-atopic Dermatitis Effects of Juice of Raphanus sativus var in HaCaT Cell Line Seung-Je Lee 1, Eun-Gyeong Lim 1, Ga-Yeon Kim 1, Mi-Ji Jeon 1, Sang-Yong Kim 2, Young-Min Kim 1, and Je- Geun Yoo 1 * Received: 9 October 2017 / Revised: 15 December 2017 / Accepted: 18 December 2017 2017 The Korean Society for Biotechnology and Bioengineering 1 한남대학교생명나노과학대학생명시스템과학과 1 Department of Biological Sciences and Biotechnology, College of Life Science and Nano Technology, Hannam University, Daejeon 34054, Korea Tel: +82-42-629-8929, Fax: +82-42-629-8873 E-mail: jgyoo@hnu.kr 2 신안산대학교식품생명과학과 2 Department of Food Science & Bio Technology, Shinansan University, Ansan 15435, Korea Abstract: Raphanus sativus var is widely known as herbs for reducing skin heat and for deciphering internal organs. Also, Raphanus sativus var has various medical effects. But, the effects of atopic treatment of Raphanus sativus var were not investigated. Therefore, we assessed the anti-atopic dermatitis and anti-inflammatory effects of juice of Raphanus sativus var in HaCaT cells. MTT assay showed that the juice of Raphanus sativus var was not cytotoxic effect on the HaCaT cells. The HaCaT cell migration was demonstrated by cells migration assay. TNF-α and IFN-γ induces production of inflammatory cytokines such as CCL17, CCL 27, IL-1β, IL-6 and IL-8 expression. Juice of Raphanus sativus var could inhibit TNFα and IFN-γ induced mrna expression levels of CCL17, CCL 27, IL-1β, IL-6 and IL-8 gene. Furthermore, we determined the effects of skin turnover through organotypic cell culture and H&E stain. Our study showed that the treatment of HaCaT cells with the juice of Raphanus sativus var in the observed that its skin recovered to normal condition. These results suggested that the possibility Juice of Raphanus sativus var for prevention and treatment of skin inflammatory diseases such as atopic dermatitis. Keywords: HaCaT cells, Raphanus sativus var, atopic dermatitis, anti-inflammatory 1. INTRODUCTION 아토피피부염 (atopic dermatitis, AD) 이란알레르기성질환중대표적인난치성질환으로서 [1] 보편적으로가려움, 피부건조, 염증을동반한다 [2]. 최근에는피부장벽의손상이아토피피부염악화의중요한원인으로대두되고있다 [3]. 이러한피부장벽은과도한세안, 목욕등의생활습관과건조한대기, 오염물질등의환경적인원인과더불어피부각질형성세포의지질합성능력저하등과같은내인성질환등으로인하여쉽게손상되어아토피피부염을유발한다 [4]. 보편적으로아토피피부염의임상적특징으로는심한가려움증으로인한피부의손상과혈청내 IgE 의증가와염증부위의호산구 (eosinophil) 의침윤등이있다 [5]. 아토피피부염에는 Th1 세포와 Th2 세포에서분비되는 cytokines 과 T 림프구 (T lymphocyte) 와항원에특이적인 IgE 를발현하는수지상세포 (dendritic cell) 가관여한다 [6,7]. 특히아토피피부염환자의혈청에서 CCL17, CCL22 및 CCL27 등의케모카인이높은
312 Korean Society for Biotechnology and Bioengineering Journal 32(4): 311-318 (2017) 량으로나타났기때문에아토피피부염과밀접한관련이있는것으로알려졌다 [5]. 염증표지인자로서 TNF-α, IFN-γ 와같은사이토카인, 호르몬등이제시되었다 [8]. 발병환자의삶의질을떨어뜨리고근본적인치료법이없는아토피피부염의경우증상을완화시키기위하여부작용이없고장기간사용할수있는치료제를만들기위해천연자원을탐색하고개발하는것이시급하다 [9]. 나복근은예로부터피부의열을내리고, 오장육부를해독하는약재로널리알려져있다. 나복근 (Raphanus sativus var) 은십자화과 (Cruciferae) 에속하며, 원산지는지중해연안에서중국을통해우리나라에전해졌으며, 부식물로써뿌리에는독특한매운맛을나타내는성분과전분분해효소인 glycosidase 와아스코르브산및 amylase 등을함유하고있다. 또한, 나복근은항산화, 자유라디컬소거, 항염증등의다양한효능들이있는것으로보고되었다 [10,11]. 따라서본연구에서는나복근즙 (JRS) 의세포이동촉진효과와항염증효과를확인함으로써아토피증상완화및항염증효과를확인하고자하였다. 2. MATERIALS AND METHOD 실험에사용된 3-(4,5-dimethyl-2 thiazolyl)-2,5-diphnyl-2htetrazolium bromide (MTT) 는 Sigma-Aldrich Co. (St. Louis, MO, USA) 에서구입하였으며에탄올, 클로로폼, 이소프로판올등의시약은시판특급시약을사용하였다. ATO AI (Water Aqua Mist) 는 ATO AI (Geumjeong-gu, Busan, Korea) 에서구입하였다. 시료의흡광도는 ELISA microplate reader (Model 680, Bio-Rad Laboratories, Inc., Tokyo, Japan) 를사용하여측정하였다. 2.1. 나복근즙제조본실험에서사용된나복근은전북장수군농장에서구입하여물로세척후절단하였다. 절단한나복근은믹서기를이용하여분쇄후면포를사용하여잔여물을걸러준후걸러진나복근즙을동결건조기를이용하여분말형태로만들어냉장보관한후 PBS 에녹여실험에사용하였다. 2.2. 세포배양 HaCaT 세포는 Dr. Fusenig (German Cancer Research Center, DKFZ, Heidelberg, Germany) 로부터분양받았으며, Fibroblast 세포는 American Type Culture Collection (ATCC, Rockville, MD, USA) 에서분양받아사용하였다. 세포는 10% FBS (both from HyClone, Waltham, MA, USA) 와 1% antibiotics (100 mg/l streptomycin, 100 U/mL penicillin) 가포함된 DMEM media (Hyclone, Laboratris Inc., Logan, UT, USA) 를사용하여 5% CO 2, 37 o C 조건에서배양하였다. 매 48 h 마다 Trypsin- EDTA (Hyclcone, Laboratories Inc., Logan, UT, USA) 를이용하여세포를부유상태로만든후세포를 1 10 6 cells/ml 로분 주하여계대배양하였다. 2.3. MTT assay 세포생존율은 MTT assay 법을통하여측정하였다. HaCaT 세포와 fibroblast 세포를 12 well plate에각각 1 10 5 cells/ml 로분주하고 24 h 동안배양후나복근즙을처리하여 24 h 동안 5% CO 2, 37 o C 조건에서배양하였다. 염증반응유도군은 TNF-α 및 IFN-γ를 1 h 전처리하였다. 배양이끝난후 5 mg/ ml 3-(4,5-dimethyl-2 thiazolyl)-2,5-diphnyl-2h-tetra-zolium bromide (MTT, Sigma-Aldrich Co.) solution을각 well 당 40 μl씩첨가하여 40 min 동안 CO 2 incubator에서반응시켰다. media를제거하고 PBS로 washing 후 PBS를제거하였다. 각 well 당 DMSO 150 μl을첨가하여생성된 formazan을녹인다음 96 well plate에 100 μl씩옮긴후 ELISA microplate reader (Bio-Red Laboratories Inc., Tokyo, Japan) 로 595 nm에서흡광도를측정하였다. 측정은모두세번시행하였으며, 평균값과오차값은 Microsoft Excel program을사용하여분석하였다. 2.4. Cell migration assay HaCaT 세포를 12 well plate에 1 10 6 cells/ml로분주하고 24 h 동안배양하여세포가 12 well plate에 90% 이상배양되었을때, media를제거하고멸균된 tip으로 12 well plate 바닥을 Scratch 한후, 1회 PBS washing 후 PBS를완전히제거하였다. 10% FBS와 1% antibiotics가포함된 DMEM media (Hyclone, Laboratris Inc., Logan, UT, USA) 를넣어준뒤, 염증반응유도군은 TNF-α 및 IFN-γ를 1 h 전처리하여아토피성피부염증환경을조성한뒤, 나복근즙을처리하고 24 h 동안 5% CO 2, 37 o C 조건에서배양한다음현미경상에서세포이동률을측정하였으며, Image J를사용하여분석하였다. 2.5. Total RNA 추출및 cdna 합성 HaCaT 세포를 6 well plate에각각 1 10 5 cells/ml로분주하고 24 h 동안배양후나복근즙을처리하여 24 h 동안 5% CO 2, 37 o C 조건에서배양하였다. 염증반응유도군은 TNF-α 및 IFN-γ를 1 h 전처리하였다. 배양후 media를모두제거한뒤 PBS로 1회 washing 후 RiboEX Total RNA Isolation Solution (GeneAll Biotechnology, Seoul, Korea) 을가하여세포를용해한후클로로폼, 이소프로판올, 70% 에탄올을각각첨가하는과정을통하여 total RNA를추출하였다. cdna 합성은 DiaStar TM RT kit, Solg TM RNase Inhibitor (SolGent, Seoul, Korea) 를이용하여진행하였다. Total RNA 1 μl와 oligo(dt)20 primer 9 μl를혼합한뒤 65 o C에서 5 min 동안반응시킨후 ice에넣어반응을중단하였다. 상기과정을통하여 oligo(dt) primer가붙은 mrna에 8 mm DTT 1 μl, RTase (200 U/μL) 1 μl, 10 mm의 dntp가포함된 5X RT reaction buffer 4 μl, RNase Inhibitor (40 U/μL) 1 μl, DEPC-DW 3 μl를첨가한후 40 o C에서 1 h, 95 o C에서 5 min 동안반응시킴으로써 cdna를합성하였다.
HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 313 2.6. 역전사중합효소연쇄반응 (Reverse Transcription Polymerase Chain Reaction, RT-PCR) PCR은 DNA polymerase와 buffer, dntp, tracking dye가포함된 2X Taq PCR Smart mix 1 (SolGent, Seoul, Korea) 를이용하여실시하였다. PCR 증폭은 pre-denaturation을 95 o C에서 10 min, denaturation은 95 o C에서 30 sec, annealing은 60 o C에서 30 sec, extension은 72 o C에서 30 sec의조건으로 35 cycles 반응시켰으며 72 o C에서 10 min 동안안정화시켰다. TARC(CCL 17), CTACK(CCL27), IL-1β, IL-6, IL-8, β-actin의 specific primer sequences는 Table 1과같다. 2.7. 피부턴오버개선검사 (Organotypic cell culture 및 H&E stain을통한유효성검사 ) SPL Inset TM Haging 6well plate (SPL Life Sciences) 에 Purecol Bovine Collagen type I을기반으로한 acellular layer를 inset에 1 ml씩분주하였다. 겔이굳은뒤 10% FBS (both from HyClone, Waltham, MA, USA) 와 1% antibiotics (100 mg/l streptomycin, 100 U/mL penicillin) 가포함된 DMEM media (Hyclone Laboratories Inc., Logan, UT, USA) 에서배양한 Human Fibroblast (1 10 5 cells/ml) 에 Matrigel Basement Membrane Matrix (Corning, NewYork, USA) 을함께포함하여 inset에 3 ml을분주하여 37 o C, 5% CO 2 incubator에배양하였다. DMEM media와 Ham's F12 media (Hyclone Laboratories Inc., Logan, UT, USA) 를 3:1로섞은배지를넣어 gel matrix 를안정화시킨다음 P5-P6의 HaCaT 세포를 (German Cancer Research Center, DKFZ, Heidelberg, Germany, 1 10 7 cells/ ml) basementcelllayer에 50 μl씩분주하여 37 o C, 5% CO 2 incubator에서 2주동안배양하여피부의표피층을제조하였다. 배양삽입체외부의배지에는 TNF-α 및 IFN-γ를처리하여아토피피부염환경을조성하고 saline, 나복근즙 40 ug/ml 및 ATO AI (Water Aqua Mist는베타글루칸과 EGF가첨가된피부보습, 피부세포의재생촉진, 손상된피부를회복하는데도움을주는화장품이다.) 10 μl/ml을 14일동안각각처리하였다. 그후, 파라핀블록제작방법을통해표본을제작한후, 헤마톡실린과에오신으로염색 (H&E staining) 하여표피층의단면을실험군별로비교관찰하였다. 2.8. 통계처리통계프로그램인 SPSS (Statistical Package for the Social Science) 프로그램을사용하였고, 실험설계에대한분산분석은독립표본 t-test 를통하여유의성을검정하였다. 각자료는 3 번이상의반복된실험을통하여얻어진결과로검정하였고 p<0.05 인경우통계적으로유의한것으로판정하였다. 3. RESULT AND DISCUSSION 3.1. 나복근즙에대한세포독성검사피부각질형성세포 (HaCaT) 는피부표피층을구성하며피부를보호하는각질을형성하고다양한자극에반응하여여러사이토카인 (cytokine) 을분비함으로써염증반응및면역반응에관여한다 [12-14]. 피부각질형성세포는외부로부터자극을받으면 tumor necrosis factor-α (TNF-α) 및 Interferon gamma (IFN-γ) 를분비하고다른사이토카인의분비를촉진하여염증이유도되는것으로알려져있다 [12]. 따라서본연구에서는나복근즙처리에따른염증반응을유도한피부각질형성세포 (HaCaT) 와섬유아세포 (Fibroblast) 의세포독성을확인하기위하여 MTT assay 를시행하였다. Fibroblast 세포에대한나복근즙의세포독성을측정한결과는 Fig. 1A 에나타내었다. TNF-α 및 IFN-γ 를 1 h 전처리한후나복근즙을농도별 (10, 25, 50, 100, 200 μg/ml) 로처리한후 24 h 동안반응시켰을때 fibroblast 세포의생존율이 95% 이상으로나타났고, 통계적으로유의하지않았다 (not significant). 또한, Fig. 1B 에나타난바와같이, 나복근즙을농도별 (10, 25, 50, 100, 200 μg/ml) 로처리한후 24 h 동안반응시켰을때 HaCaT 세포의생존율이 95% 이상으로나타났고, 통계적으로유의하지않은것을확인할수있었다. 따라서본실험을통하여나복근즙이피부각질형성세포및섬유아세포에세포독성이없는것을확인하였다. 3.2. 나복근즙에대한세포이동촉진효과피부각질형성세포 (HaCaT) 는염증및면역반응과세포증식및피부의항상성유지에관여하는다양한사이토카인 Table 1. Gene Primer sequencr (5'-3') Amplification size (bp) Annealingtemperature ( o C) TARC For: AGGTCTTGAAGCCTCCTCAC (CCL17) Rev: AGTTCAGACAAGGGGATGGG 187 60 CTACK For: AAGGTAGGGGAGGAGGAGAG (CCL27) Rev: AGCTTGTCTGAGAGTGGCTT 167 60 IL-1β For: GGAGAATGACCTGAGCACCT Rev: GGAGGTGGAGAGCTTTCAGT 185 60 IL-6 For: AGTCCTGATCCAGTTCCTGC Rev: AAGCTGCGCAGAATGAGATG 150 60 IL-8 For: TGAGCATCTACGGTTTGCTG Rev: TGCTTGTCTGGAACAACTGC 227 60 β-actin For: GGACTTCGAGCAAGAGATGG Rev: AGCACTGTGTTGGCGTACAG 234 60
314 Korean Society for Biotechnology and Bioengineering Journal 32(4): 311-318 (2017) Fig. 1. Cytotoxic Effects of Juice of Raphanus sativus var in HaCaT cells and fibroblast. Cell viability was measured by MTT assay. Cells were pre-treated with 10 ng/ml TNF-α and IFN-γ 1 h followed by treatment Juice of Raphanus sativus var 24 h. The statistical analysis of the data was carried out by use of a t-test. N.S is not significant (each experiment, n=3). (cytokine) 및성장인자를생산한다 [15]. 따라서본연구에서는나복근즙처리에따른염증반응을유도한 HaCaT Cell 의세포이동촉진효과에미치는영향을알아보기위해 Cell migration assay 를시행하였다. Fig. 2 에나타난바와같이아무것도처리하지않은군은 Wound area 가 77% 인반면 TNFα 및 IFN-γ (10 ng/ml) 로염증을유도한군의 Wound area 는 94% 로피부재생유도효과가감소한반면, ATO AI (1 μl/ ml) 를처리한군의 Wound area 는 69% 로대조군대비 112% 의세포이동촉진효과가관찰되었으며, 나복근즙 (50, 100 μg/ml) 을처리한군에서는각각 Wound area 가 51%, 25% 로대조군대비 151%, 304% 의세포이동촉진효과가관찰되었다. 따라서본실험을통하여나복근즙처리에따른염증반응을유도한 HaCaT Cell 의세포이동촉진효과가있다는것을확인하였다. 3.3. 나복근즙의염증관련유전자발현저해효과 HaCaT 세포가자극을받으면 IL-1β, IL-6, IL-8 및 COX-2 와같은다양한염증성사이토카인이분비되어염증반응이유도된다 [12]. TNF-α 는중요염증표지인자로알려져있으며, 세포가외부로부터자극을받으면분비되는것으로알려져있다 [8,12]. 선행연구에따르면 TNF-α 로염증을유도한 Ha- CaT cell 에봉독및모링가추출물을처리하였을때 IL-1β, IL- 6, IL-8 의 mrna 발현이농도의존적으로감소한다고보고되 었다 [12,16]. 따라서본연구에서는 HaCaT 세포에 TNF-α 및 IFN-γ로염증을유도하여아토피유사환경을조성한뒤, 나복근즙을처리하여나복근즙의항염증효과를확인하고자하였다. 그결과 Fig. 3과같이 TNF-α 및 IFN-γ (10 ng/ml) 의처리에따라 CCL17, CCL27, IL-1β, IL-6 및 IL-8 유전자의발현이아무것도처리하지않은군과비교하였을때, 2.65(***), 2.68(***), 1.21(*), 1.24(*), 1.21(*) 배수, 증가하였으며 ATO AI (1 μl/ml) 처리군에서각각 1.44(##), 1.31(**/###), 0.95 (##), 0.79(*/##), 0.35(***/###) 배수, 나복근즙 50 μg/ml 처리군에서각각 1.6(*), 1.34(**/###), 0.26(***/###), 0.12(***/ ###), 0(***/###) 배수, 나복근즙 100 μg/ml 처리군에서는 2.46(***), 1.18(###), 0.72(**/##), 0.36(***/###), 0(***/###) 배수로 TNF-α 및 IFN-γ 처리군보다발현량이유의하게감소하였으며, 특히나복근즙 50 μg/ml 처리군에서항염증효과가가장뛰어난것을확인하였다. 따라서본실험을통하여나복근즙의항염증효과를확인하였으며, 이와같은효과는 CCL17, CCL27, IL-1β, IL-6 및 IL-8과같은염증관련유전자의발현을억제함으로써나타난것임을확인하였다. 3.4. 나복근즙의피부턴오버개선효과표피는다수의상피조직으로이루어져있으며각질형성세포가주요구성성분이다. 표피의가장아래층인기저층에서세포분열이끊임없이일어나며분열된세포는유극층, 과립층,
HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 315 Fig. 2. The cell migration promoting effect of the Juice of Raphanus sativus var in HaCaT cells. Wound area was measured by Image J. Cells were pre-treated with 10 ng/ml TNF-α and IFN-γ 1 h followed by treatment with 50, 100 μg/ml Juice of Raphanus sativus var and 1 μl/ml ATO AI 24 h. The statistical analysis of the data was carried out by use of a t-test. *p<0.05, **p<0.01, ***p<0.001 compared to controls. ###p<0.001 was compared to 10 ng/ml TNF-α and IFN-γ treated group. N.S is not significant (each experiment, n=3). 각질층순서로상승하여피부에서탈리된다. 기저층에서부터세포가탈리되기까지의소요시간은약 28 일정도이며, 이주기를턴오버 (turn-over) 라고한다. 아토피피부염이유발된피부조직에서는각질층의두께가증가하며, 백혈구의침윤이일어난다 [17,18]. 동물실험을대체하기위하여본실험에서는 Organotypic cell culture 및 H&E stain 을통하여, 나복근즙처리에따른피부턴오버개선효과를확인하였다. Fig. 4 에나타난바와같이아무것도처리하지않은군은피부각질층이얇은것에비해 TNF-α 및 IFN-γ (10 ng/ml) 로염증을유도한군의피부각질층은두꺼워진것을확인하였으며, ATO AI (1 μl/ml) 와나복근즙 40 μg/ml 을처리한군에서아무것도처리하지않은군과유사하게피부각질층이얇아진것을확인할수있었다. 따라서본실험을통하여나복근 즙을통하여단순히염증을완화시키는것이아니라피부턴오버를개선함으로써아토피증상을완화시키는것을확인하였다. 4. CONCLUSION 본연구에서는나복근즙의아토피완화효과와피부재생촉진및피부턴오버를이용한기능성소재로서의이용가능성을알아보고자하였다. 그결과 TNF-α 및 IFN-γ 로염증환경이조성된 HaCaT 세포와섬유아세포 (Fibroblast) 에서세포독성이없는것을확인하였으며, 농도의존적으로 Wound area 가감소하는것으로보아세포증식능력이향상되는것
316 Korean Society for Biotechnology and Bioengineering Journal 32(4): 311-318 (2017) Fig. 3. Effects of Juice of Juice of Raphanus sativus var on CCL17, CCL27, IL-1β, IL-6 and IL-8 mrna expression levels in HaCaT cells. Cells were pre-treated with 10 ng/ml TNF-α and IFN-γ for 1 h followed by treatment with 50, 100 μg/ml of Juice of Raphanus sativus var and 1 μl/ml ATO AI 24 h. The statistical analysis of the data was carried out by use of a t-test. *p<0.05, **p<0.01, ***p<0.001 compared to control. ##p<0.01, ###p<0.001 was compared to 10 ng/ml TNF-α and IFN-γ treated group. N.S is not significant (each experiment, n=3).
HaCaT 세포주에서나복근즙 (Juice of Raphanus sativus var) 에의한아토피완화효과에관한연구 317 Fig. 4. Photomicrographs of organotypic culture of Human Fibroblast and HaCaT cells. 10 ng/ml TNF-α and IFN-γ followed by treatment with 40 μg/ml Juice of Raphanus sativus var and 1 μl/ml ATO AI 14 days. Each sample was filled with paraffin at a size of 5 μm. The tissues stained hematoxylin and eosin. The ATO AI group had very thin stratum corneum. The Juice of Raphanus sativus var group also showed thinning of the stratum corneum. 을확인할수있었다. 또한, 염증성사이토카인의 mrna 발현을확인한결과 TNF-α 및 IFN-γ 로염증환경을유도한 Ha- CaT 세포에나복근즙을처리하였을때염증성사이토카인인 CCL17, CCL27, IL-1β, IL-6 및 IL-8 유전자의발현이유의적으로감소하는것을확인할수있었으며, Organotypic cell culture 및 H&E stain 에서나복근즙을처리한군에서아무것도처리하지않은군과유사하게피부각질층이얇아진것을확인할수있었다. 따라서피부턴오버를이용한아토피피부염증상완화와염증관련질환의치료를위한기능성천연소재로유용하게활용될수있을것으로사료된다. Acknowledgements 본연구는 2016 년도산학연협력기술개발사업 ( 연구마을조성사업 : 과제번호 2016N146)) 에의해수행되었음. REFERENCES 1. Jeong, D. H., K. B. W. R. Kim, M. J. Kim, B. K. Kang, S. W. Bark, W. M. Pak, B. R. Kim, H. M. Park, M. H. Im, and D. H. Ahn (2014) Anti-atopic activity of Sargassum micracanthum ethanol extracts. Microbiol. Biotechnol. Lett. 42: 82-88. 2. Kang, B. K., K. B. W. R. Kim, M. J. Kim, S. W. Bark, W. M. Pak, B. R. Kim, N. K. Ahn, Y. U. Choi, N. Y. Bae, J. H. Park, and D. H. Ahn (2015) Anti-atopic activity of tuna heart ethanol extract. J. Korean Soc. Food Sci. Nutr. 44: 1-6. 3. Jeong, D. H., K. B. W. R. Kim, S. A. Jung, H. J. Kim, B. K. Kang, S. W. Bark, T. W. Kim, and D. H. Ahn (2013) Effect of pine needle ethanol extracts on the inhibitory activity of atopic dermatitis. KSBB J. 28: 123-130. 4. Yoon, M. Y. (2008) Therapeutic effects of hydrolyzed preparation of Scutellanae radix extracts on atopic dermatitis of NC/Nga mice induced by D. pteronyssinus. Ph. D. Thesis, Woosuk University of Wanju County, North Jeolla, South Korea. 5. Jeong, S. I., B. M. Choi, Y. G. Yun, J. W. Lee, and S. I. Jang (2009) A noble therapeutic approach of atopic dermatitis by development of Th2 chemokine inhibitors from natural products: inhibitory effect of Sophora flavescens extract in atopic dermatitis model mice, NC/Nga. Herbal Formula Sci. 17: 141-151. 6. Kim, M. A., H. U. Son, D. Y. Nam, Y. S. Cha, Y. K. Shin, Y. H. Choi, and S. H. Lee (2012) Inhibitory effect of Angelica keiskei extract in an atopic dermatitis animal model. Korean J. Food Preserv. 19: 792-798. 7. Kim, H. A., M. Y. Yun, H. H. Song, K. J. Hyang, and H. S. Yoo (2010) Effects of lavender, lemon and eucalyptus essential oil on Th2 related factors of DNCB-induced atopy dermatitis in NC/Nga mice model. J. Pharmacopuncture 13: 53-61. 8. Song, H. R., Y. S. Woo, and W. M. Bahk (2013) Depression as an inflammatory disease. Korean J. Psychopharmacol. 24: 5-10. 9. Jeong, D. H., N. K. Ahn, Y. U. Choi, J. H. Park, N. Y. Bae, S. H. Park, M. J. Kim, K. B. W. R. Kim, and D. H. Ahn (2015) Inhibitory effect of sargassum fulvellum water extract on 2, 4-dinitrochlorobenzene-induced atopic dermatitis-like skin lesions in mice. Microbiol. Biotechnol. Lett. 43: 150-157. 10. Lugasi, A., E. Dworschak, A. Blazovics, and A. Kery (1998) Antioxidant and free radical scavenging properties of squeezed juice from black radish (Raphanus sativus L. var niger) root. Phytotherapy Res. 12: 502-506. 11. Salah-Abbes, J. B., S. Abbes, Z. Houas, M. A. Abdel-Wahhab, and R. Oueslati (2008) Zearalenone induces immunotoxicity in mice: possible protective effects of radish extract (Raphanus sativus). J. Pharmacy Pharmacol. 60: 761-770. 12. Lim, E. G., G. T. Kim, B. M. Kim, E. J. Kim, S. Y. Kim, N. K. Han, J. S. Ha, and Y. M. Kim (2017) Study of anti-microbial activities and anti-inflammatory effects of chamomile (Matricaria chamomilla) extracts in HaCaT cells. KSBB J. 32: 9-15. 13. Lee, W. R., K. H. Kim, H. J. An, J. Y. Kim, S. M. Han, K. G. Lee, and K. K. Park (2014) The effects of bee venom on tumor necrosis factor (TNF)-α induced inflammatory human HaCaT keratinocytes. Korean J. Pharmacognosy 45: 256-261. 14. Beissert, S., I. Cavazzana, F. Mascia, P. Meroni, S. Pastore, G. Tessari, and G. Girolomoni (2006) Mechanisms of immune-mediated skin diseases: An overview. Clin. Exp. Rheumatol. 24: S1. 15. Lee, W. R., K. H. Kim, H. J. An, J. Y. Kim, S. M. Han, K. G. Lee, and K. K. Park (2014) The effects of bee venom on tumor necrosis factor (TNF)-α induced inflammatory human HaCaT keratino-
318 Korean Society for Biotechnology and Bioengineering Journal 32(4): 311-318 (2017) cytes. Korean J. Pharmacognosy 45: 256-261. 16. Lee, H. J. and Y. C. Chang (2012) Suppression of TNF-α induced inflammation by extract from different parts of moringa in HaCaT cells. J. Life Sci. 22: 1254-1260. 17. Cho, B. O., H. H. Yin, C. Z. Fang, J. Y. Shin, H. O. Ha, S. J. Kim, S. I. Jeong, and S. I. Jang (2015) Anti-atopic effect of hot water and supercritical carbon dioxide fluid extract of persimmon (Diospyros kaki) peels. Korean J. Food Sci. Technol. 47: 394-400. 18. Kim, M. J. and S. Y. Choung (2012) Mixture of polyphenols and anthocyanins from vaccinium uliginosum L. Alleviates DNCBinduced atopic dermatitis in NC/Nga Mice. Evidence-Based Complementary and Alternative Medicine 2012: 461989.