한수지 48(5), 731-738, 2015 Original Article Korean J Fish Aquat Sci 48(5),731-738,2015 조피볼락 (Sebastes schlegeli) 선충 (Nematode: Philometridae) 에대한분자생물학적동정및 PCR 검출법개발 서한길 서정수 류민경 이은혜 정승희 한현자 * 국립수산과학원병리연구과 Molecular Identification and Development of a PCR Assay for the Detection of a Philometrid Nematode in Rockfish Sebastes schlegeli Han-Gill Seo, Jung Soo Seo, Min Kyung Ryu, Eun Hye Lee, Sung Hee Jung and Hyun-Ja Han* Pathology Research Division, National Fisheries Research and Development Institute, Busan 46083, Korea Nematode infection in the epithelial tissue of cultured rockfish Sebastes schlegeli was first reported in 2012. Since then, nematode infections have caused serious economic losses in rockfish aquaculture on the west coast of Korea. Taxonomic and life cycle information for this parasite are currently unknown. In this study, 18S rrna and cytochrome c oxidase subunit I (COI) genes were used for molecular identification and polymerase chain reaction (PCR) to detect the invisible stages of this parasite. Nucleotide sequences of the 18S rrna of the rockfish nematode showed 98% identity with that of Philometra morii. Therefore, this rockfish nematode was classified to the Philometridae family. However, we could not identify it to genus level using 18S rrna. Its COI nucleotide sequences shared 85% and 82% identities with those of Bursaphelenchus sinensis and Philometra overstreeti, respectively. In addition, two gene-specific primer sets were designed based on the 18S rrna gene to detect the intermediate host and nematode larvae. These primers were specific to this rockfish nematode without cross-reacting to other pathogens. The detection limit of the PCR assay using these primers was 1,000 copies of nematoda plasmid DNA. Therefore, the PCR assay described here is suitable for the detection of nematode DNA within rockfish. In addition, this PCR assay could be used to detect nematode larvae and the intermediate host. Key words: Philometrid nematode, Rockfish, 18S rrna gene, Cytochrome c oxidase subunit I gene, PCR 서론 (Sebastes schlegeli), 2014 24,598 30% (KOSIS, 2015). 2012, 2013 1 50%. 2014,, 2. (Seo et al., 2014). Nematode (phylum) Secernentea (class) Camallanida (order) Philometridae (family), 650. Philometridae Afrophilometra, Alinema, Buckleyella, Caranginema, Clavinema, Dentiphilometra, Margolisianum, Nilonema, Philometra, Philometroides, Philonema, Phlyctainophora, Rumai Spirophilometra (genus) http://dx.doi.org/10.5657/kfas.2015.0731 Korean J Fish Aquat Sci 48(5) 731-738, October 2015 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 17 August 2015; Revised 25 September 2015; Accepted 7 October 2015 *Corresponding author: Tel: +82. 51. 720. 2483 Fax: +82. 51. 720. 2498 E-mail address: hjhan77@korea.kr Copyright 2015 The Korean Society of Fisheries and Aquatic Science 731 pissn:0374-8111, eissn:2287-8815
732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al. (2014).. Stephanie et al. (2011) South Carolina philometrids Polymerase Chain Reaction (PCR). Kang et al. (2008) Polymerase Chain Reaction-Restriction Fragment Length Polmorphism (PCR-RFLP).,. PCR,. ribosomal RNA (rrna), mitochondrial DNA (mtdna) microsatellite DNA. ribosomal DNA rrna code 18S, 5.8S 28S internal external transcribed spacers (ITS and ETS). 18S rrna (Nyaku et al., 2013). mtdna, cytochrome c oxidase subunit I (COI) (Edmands et al., 1996). Cytochrome,,. Cytochrome, a, b, c d 4, cytochrome c. Cytochrome c oxidase cytochrome c COI. Herbert (2003) DNA barcoding COI, COI (Han et al., 2014). 18S rrna COI primer,. 18S rrna primer, PCR. 재료및방법 선충시료채취및 DNA 추출 2014 1, 100% ET-OH DNA. 50 mg E-tube PBS, (8,000 rpm, 10 min). DNA High pure template preparation kit(roche, Germany),. 분자생물학적동정 18S rrna COI. PCR Emerald Taq (Takara, Japan), primer sequence PCR Table 1. PCR product 1.5% agarose gel (Bioneer, Korea) band, PCR sequencing. BioEdit Ver. 7.2.3, MEGA Ver. 6, National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST). BioEdit Ver. 7.2.3 program MEGA Ver. 6 program (NJ; neighbor-joining analysis, 1000 rounds of bootstrap)
조피볼락선충의분자생물학적동정 733 Table 1. Primer information and PCR condition for this study Purpose Target gene Primer Nucleotide sequence (5 to3 ) PCR Condition (annealing temp. o C, / PCR cycles) PCR size (bp) References Molecular identification Specific detection 18S rrna Cytochrome oxidase subunit I 18S rrna nema35f TATAATGGTGAAACCGCGAACGGC 61/ 30 1,694 Qiazon (2009) nema18gm GGAAACCTTGTTACGACTTTTGCC NemCOI 5P NemCOI 3P RN-18S 1F RN-18S 1R RN-18S 2F RN-18S 2R CATTTRTTTTGRTTTTTTGG ACYACATRATAAGTATCRTG TAGTCGGCGAATAATGAACCTT GTTACCTTTGCCTTTCGACAAC GCAATTATTTCCCTTGAACGAG AAGGCGGTTTCTACCCTCTATC 55/ 45 424 55/ 30 Stephanie et al. (2011) 183 This study 206 This study (phylogenetic tree). 18S rrna (1,695 bp) GenBank Philometridae 8 18S rrna (Philometra morii, Philometra sp., Philometroides sanguineus, Philometroides seriolae, Clavinema parasiluri, Dentiphilometra monopteri, Nilonema senticosum, Rumai rumai, Philonema oncorhynchi) Anisakidae 4 18S rrna (Anisakis sp., A. pegreffi, A. simplex) (Fig. 2A). COI (389 bp) Philometra overstreeti, Philometroides paralichthydis, A. pegreffii, A. simplex (Fig. 2B). 조피볼락선충검출 PCR 법개발 18S rrna Philometridae 18S rrna 2 primer set PCR. PCR Table 1, PCR annealing. primer DNA PCR.,, Edwardsiella tarda Streptococcus iniae. CHSE-214. 100% ET-OH, DNA PCR. 1.5% NaCl Brain Heart Infusion (BHI, Gibco, USA) broth 25 12 DNA PCR. PCR product 1.5% agarose gel (Bioneer, Korea) band. PCR primer. PCR product 1.5% agarose gel, PCR product purification kit (Roche, Germany) Gel Purification. PCR product pgem T- Easy vector (Promega, USA) cloning, Plasmid Mini Extraction kit (Bioneer, Korea) plasmid DNA. plasmid copy Nuclease-free water (Bioneer, Korea) 1 10 10 copy 1 10 0 copy 10 template PCR. PCR product 1.5% agarose gel band. 결과및고찰 18S rrna COI universal primer PCR. 18S rrna Quiazon (2009) PCR, PCR PCR (Table 1). genomic DNA template 18S rrna 1,695 bp (GenBank accession no. LC071530), NCBI BLAST Philometra morii 18S rrna gene (JF803933) 98% (Fig. 1). 18S rrna
734 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 Fig. 1. Partial 18S rrna gene sequences (position 1,173 through 1,695) of philometrid nematode from rockfish Sebastes schlegeli of Korea, indicating position of primer (boxes) used for detection PCR. nematode Philometridae (family), Philometrodae Philometra, Philometroides, Clavinema (genus) (Fig. 2A). Nyaku et al. (2013) 18S rrna (order). 18S rrna (family), (species) (genus). COI (PCR product size 389bp; GenBank accession no. LC073304) NCBI BLAST Bursaphelenchus sinensis cytochrome c oxidase subunit I (mtcoi) gene (GenBank accession no. AB232163) 84%, Philometra overstreeti COI (GenBank accession no. HM035020.1) 82%
조피볼락선충의분자생물학적동정 735. COI phylogentic tree (Fig. 2B), Philometra, Philometroides (genus), COI (Stephanie et al., 2011), GenBank Philometra overstreeti Philometroides (A) (B) Fig. 2. Neighbor-joining analysis of philometrid nematode from rockfish Sebastes schlegeli (A) 18S rrna and (B) cytochrome c oxidase subunit I sequences from GenBank.
736 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 paralichthydis (species). COI, COI. PCR 18S rrna 2 primer set (Fig. 1). Primer, 18S rrna Philometrodae 18S rrna primer. DNA PCR 2 primer set, agarose gel 183 206 bp band. PCR BIO-RAD Peltier Thermal Cycler (PTC-0220) gradient PCR. annealing temp 42-62 2 primer 55 (data not shown). primer 5 (,, ) 2 (Edwardsiella tarda, Streptococcus iniae) PCR DNA (Fig. 3A, B). RN-18S 1 2 primer sets. (data not shown), Philometrid nematodes. primer plasmid DNA,. 18S rrna plasmid DNA 1 10 10 copy 1 10 3 copy band primer (Fig. 4A, 4B). Philometrid nematodes,. (copepodes) (Wang, 2002).., (Gonzalez et al., 2007). Seo et al. (2014) 2013 8, Fig. 3. PCR results obtained using (A) RN-18S1 primer and (B) RN-18S2 primer sets, with lanes M to 7 as follows: 100 bp DNA ladder, Nematode with rockfish Sebastes schlegeli, Scutica with flounder Paralichthys olivaceus, Kudoa with flounder, Anisakis with rockfish, Anisakis with flounder, Edwardsiella tarda and Streptococcus iniae.. 2013 10, 1,.. Seo et al. (2014),,
조피볼락선충의분자생물학적동정 737 Fig. 4. Analytical sensitivity of PCR for detection of philometrid nematode from rockfish Sebastes schlegeli. Plasmid DNA composing 18S rrna gene of philometrid nematode was serially diluted from 10 10 to 10 0 was used for PCR. Lanes 1 to 11: DNA ladder, 10 10, 10 9, 10 8, 10 7, 10 6, 10 5, 10 4, 10 3, 10 2, 10 1 and 10 0 copy of plasmid DNA/tube. A, RN-18S1; B, RN-18S2.. PCR. 18S rrna Philometridae Philometra,,., PCR,. 사사 2015 (R2015067). References Edmands S, Moberg PE and Burton RS. 1996. Allozyme and mitochondrial DNA evidence of population subdivision in the purple sea urchin Strongylocentrotus purpuratus. Mar Biol 126, 443-450. Edward JN. 1996. Diagnosis and Treatment, Fish Disease. Blackwell, Iowa State University Press, Iowa, U.S.A., 166-170. González-Solís D, Moravec F and Paredes VM. 2007. A new species of Dentiphilometra (Nematoda: Philometridae) from the musculature of the gray snapper Lutjanus griseus (osteichthyes) off the Caribbean coast of Mexico. J Parasitol 93, 1132-1135. http://dx.doi.org/10.1645/ge-1238r.1. Han SH, Lee YD, Baek HJ, Oh HS and Noh CH. 2014. Genetic structure and phylogenetic relationship of red spotted grouper (Epinephelus akaara) based on the haplotypes and polymorphisms of mitochondrial COI gene sequences. J Life Sci 24, 626-632. http://dx.doi.org/10.5352/jls.2014.24.6.626. Herbert PDN, Cywinska A, Ball SL and dewaard JR. 2003. Biological identifications through DNA barcodes. Proc Biol Sci 270, 313-321. http://dx.doi.org/10.1098/rspb.2002.2218 Kang JH, Lee MH, Lee KB and Choi CS. 2008. Comparison of macroscopic inspection and polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) for the detection of Anisakis simplex complex. J Fd Hyg Safety 23, 314-318. KOSIS. Korean Statistical Information Service. Retrived from http://kosis.kr/stathtml/stathtml.do?orgid=101&t blid=dt_1ez0008&vw_cd=mt_ztitle&list_ id=f38&seqno=&lang_mode=ko&language=kor&obj_ var_id=&itm_id=&conn_path=e1# on July 2015. Moravec F and Harrison FS. 1989. Paraphilometroides nemipteri gen. et sp. N. (nematoda:philometridae) from the marine fish nemipterus peronei (valenciennes) from Malaysia. Folia Parasitol 36, 345-350. Moravec F and Wang GT. 2002. Dentiphilometra monopteri n. gen., n. sp. (nematoda: philometridae) from the abdominal cavity of the ricefield eel monopterus albus in china. J Parasitol 88, 961-966. http://dx.doi.org/10.2307/3285538. Nyaku ST, Sripathi VR, Kantety RV, Gu YQ, Lawrence K and Sharma GC. 2013. Characterization of the two intra-individual sequence variants in the 18S rrna gene in the plant parasitic nematode, Rotylenchulus reniformis. PLoS ONE 8,e60891. http://dx.doi.org/10.1371/journal.pone.0060891. Quiazon KMA. 2009. Studies on philometrid and anisakid nematodes infecting marine fishes in Japanese waters. Ph.D. Thesis, The University of Tokyo, Tokyo, Japan. Seo HG, Seo JS, Ryu MK, Lee EH, Kwon SR, Kang JS, No YS, Choi HS, Jung SH and Han HJ. 2014. A nematoda infection in the Epithelial Tissue of Cultured Rockfish Sebastes schlegeli in Cheonsu Bay, Western Korea. Korean J Fish Aquat Sci 47, 603-610. http://dx.doi.org/10.5657/ KFAS.2014.0603 Stephanie P, Weatherly AM, Isaure DB, William AR and Allan ES. 2011. Use of molecular tools in identification of philometrid larvae in fishes: technical limitations parallel
738 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 our poor assessment of their biodiversity. Parasitol Res 109, 1725-1730. http://dgx.doi.org/10.1007/s00436-011-2481-6 Wang GT. 2002. Seasonal dynamics and distribution of Philometroides fulvidraconi (Philometridae) in the bullhead catfish, Pseudobagrus fulvidraco (Richardson). J Fish Dis 25, 621-625. http://dx.doi.org/10.1046/j.1365-2761.2002.00416.x Wijová M, Moravec F, Horák A and Lukeś J. 2006. Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rrna gene sequences. Int J Parasitol 36, 1067-1075. http://dx.doi.org/10.1016/j.ijpara.2006.04.005.