Microsoft Word - 07-최성화.doc
|
|
- 희 돈
- 6 years ago
- Views:
Transcription
1 Journal of Bacteriology and Virology Vol. 43, No. 2 p Original Article Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan ('10~'11) Seoung-Hwa Choi 1*, Jae-Eun Jeong 1, Na-Na Yun 1, Nam-Ho Kim 1, Yon-Koung Park 1 and Eun-Young Jung 2 1 Busan Metropolitan City Institute of Health & Environment, Busan; 2 Water Quality Institute, Water Works HQ of Busan Metropolitan City, Kyoungnam, Korea We analyzed the occurrence of enteric viruses and bacteria at 22 places of drinkable groundwater (civil defense emergency water-supply facility), 8 places of the groundwater used for drinking water in group food services, and 10 places of spring-water. When the 40 concentrated samples were analyzed using nested RT-PCR and real-time RT PCR methods, norovirus and other enteric viruses were not detected in all samples tested. The detection percentages for total coliforms, Escherichia coli, Yersinia enterocolitica of fecal indicator were 57.5%, 22.5% and 7.5%, respectively. Colipages were not detected. These results suggest that high levels of fecal indicator bacteria in groundwater and spring-water are not directly related to occurrence of enteric viruses. Key Words: Enteric viruses, Bacteria, Norovirus, Groundwater, Spring-water 서론사람의분변에는 140종이상의장관계바이러스가존재하고있으며 (1), 그중다수가다양한수계환경에노출되어사람의위장관계에감염하여질병을일으킬수있는것으로알려져있다 (2). 이러한바이러스는대부분오염된물, 음식, 토양등을통해분변-구강경로로전파가가능하며 (3), 특히지하수내에서는바이러스의생화학적분해가극소화될수있으며매우작은크기의바이러스는토양을통과하여대수층까지침투할수있는것으로알려져있다 (4). 미국에서 1997년에서 1998년동안발생한바이러스성병원체와관련된수인성질병의 80% 가오염된샘물로인한것이었으나 (5), 1971년부터 2002 년사이에발생한수인성질병의 1/3이오염된지하수에서기인하는것으로보고되어있다 (6). 현재부산지역에는음용수로사용가능한민방위비상급수시설 500여개소가운용중에있으며, 이중 360여개소가주거지역에위치하고있다. 수돗물을대신하는음용수로서지하수에대한관심이커진가운데, 주변에서가장손쉽게이용할수있는지하수가바로민방위비상급수시설이다. 민방위비상급수시설이란원래전쟁, 풍수해, 수원지파괴등으로상수도공급이중단될시최소한의음용수및생활용수를안정적으로공급하기위해서관리하고있는지하수시설이지만, 구 군에서는민방위지침에따라연 4회정기적인수질검사관리를하면서평상시에도시민들이이용할수있도록개방하고있다. 또한, 보다더깨끗하고좋은물을찾아사찰, 등산로, 체육시설등에위치한약수터를이용하는인구또한증가하고있다. 이런약수터의행정적명칭은먹는물공동시설이라고하며, 부산지역에 190여개소가지정되어있고, 먹는물공동시설관리규정에따라연 6회수질검사관리 Received: Feburay 19, 2013/ Revised: May 3, 2013/ Accepted: May 9, 2013 * Corresponding author: Seoung-Hwa Choi. Busan Metropolitan City Institute of Health & Environment, 120, Hambakbong-ro 140 beon-gil, Buk-gu, Busan, , Korea. Phone: , Fax: , csw95@korea.kr CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( 131
2 132 S-H Choi, et al. 가이루어지고있다. 이렇듯많은부산시민들이마실물로즐겨찾는지하수 ( 민방위비상급수 ) 및약수터수 ( 먹는물공동시설 ) 가먹는물수질기준에의해서지속적으로수질이관리되고는있지만, 수질기준항목에없는노로바이러스등장관계바이러스의오염에대해서는한번도검증된바가없다. 특히약수터수의경우에는주변환경에의해서쉽게수질이오염될우려가있지만아직어느지역에서도약수터수중장관계바이러스에대한조사가이루어진바가없다. 따라서, 이번연구에서는부산지역민방위비상급수시설및약수터수중정기적검사기록상분변오염이의심되는지점을선정하여수질세균및노로바이러스를포함한장관계바이러스의오염여부를조사하였으며, 더불어대장균파지그리고유기물이화학적지표에대해서도함께분석하였다. 또한, 식중독예방관리의목적으로부산지역에서지하수를단체급식에사용하는시설도포함하여이번연구를수행하였다. 아울러, 미생물학적으로보다안전한지하수및약수터수를유지하기위한관리방안을고찰해보고자하였다. 재료및방법시료채취노로바이러스및기타장관계바이러스의검출여부를확인하기위해부산지역민방위비상급수시설중음용수로사용되는지하수 22건및지하수를사용하는단체급식시설시료 8건 ( 노인복지시설 4, 어린이보육시설 3, 기타 1) 그리고약수터수 10건등총 40 곳의시료를채취하였다. 민방위비상급수시설및약수터는비교적이용인구가많고, 주변환경에의해서오염이우려되는지점을우선선정하였다. 민방위비상급수시설 22개지점중 16곳은주로주거지역 ( 학교 8, 아파트단지내 4, 공공건물 4) 에위치하였고, 4곳은녹지지역 ( 주거시설 4) 나머지 2곳은상업지역 ( 공공건물 2) 이었다. 약수터의경우모두지표수를원수로하고, 일일이용객이많은편이면서, 비교적다량의현장여과샘플링이가능한곳을우선선정하여채취하였다. 시료의채취는 2010년 7월부터 2011년 7월까지실시하였으며, 지하수에대해서는관정에서직접올라오는원수 를대상으로하되, 원수채수가불가한경우일부는탱크수를채취하였다. 약수터수의경우지표수를원수로하는시설에대해서만집수정꼭지수를채취하였다. 현장시료채취에필요한실험재료는국립환경과학원지하수중노로바이러스분석지침및 Information Collection Rule (ICR) (7) 에제시된재료및시료채취용기구를사용하였고, 상기분석방법에준하여시료채취를실시하였다. 본연구에서는 positive charge Nanoceram filter (Argonid, USA) 를이용한여과법을사용하였다. 채취기구와연결되는부분을화염멸균한뒤필터하우징을제외한시료여과장치를연결하고수압이 30 PSI가넘지않도록하여약 10 l 정도의물을흘려보낸후시료채취기록부에시료번호, 지점명, 수온, 탁도, ph, 잔류염소를측정하여기록하였다. 그다음, 필터하우징을연결하고 30 PSI 이하의압력으로 500 l 이상시료를통과시킨후, 필터하우징을시료여과장치로부터분리하여멸균된호일로기구의양쪽끝부분을감아주고냉장상태로실험실로운반하였다. 더불어미생물검사및이화학검사를위한시료 1 l를멸균채수병에담아냉장상태로실험실로운반하였다. 미생물학적검사일반세균 (total colony counts), 총대장균군 (Total coliforms), 대장균 (Escherichia coli) 그리고여시니아균 (Yersinia enterocolitica) 검사는먹는물공정시험방법 ( 환경부, 2007) 에따라실시하였으며, 일반세균은중온일반세균-평판집락시험법, 총대장균군및대장균시험은막여과법으로검사하였다. 이화학적검사수소이온농도 (ph), 잔류염소, 수온, 탁도, 암모니아성질소, 질산성질소항목은먹는물공정시험방법에따라수행하였고, 분석방법과분석에사용한장비는 Table 1과같다. 바이러스의탈리및농축시료채취뒤 72시간이내에필터에부착된바이러스를탈리하였다. Nanoceram 필터가들어있는필터하우징의유입구와배출구를튜브로연결하고유입구는공기압력원에, 배출구는멸균된유리비커에각각연결하였다. 압력용기에 600 ml의 1.5% beef extract (Difco, France)
3 Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan ('10~'11) 133 완충액 (ph 9.5) 을넣고, 뚜껑을닫은후압력조절밸브를닫았다. 필터하우징의감압단추를누른상태로압력용기의압력조절밸브를서서히열어 beef extract 완충액이필터하우징내에완전히차도록한다음감압단추를통해용액이흘러나오기시작하면, 감압단추에서손을떼고압력조절밸브를닫은후 5분간방치하여필터에흡착된바이러스를탈리시켰다. 비커에수집된 beef extract 완충액을압력용기로다시옮겨담고위과정을 2회반복하여총 3회의탈리과정을반복수행하였다. 비커에수집된최종바이러스탈리용액은 1 M HCl (Sigma, Germany) 로 ph를 7.0~7.5 사이로조절하였다. 탈리액이담긴비커에교반막대를넣고교반기로천천히섞으면서 1 M HCl로서서히 ph를 3.5±0.1로맞춘다음 30분이상천천히섞은후침천물이생기면 beef extract 탈리액을 2,500 Items ph Residual Chlorine, Turbidity Ammonia nitrogen (NH 3 -N) Nitrate nitrogen (NO 3 -N) Table 1. Analysis items and instruments Instruments ph Meter (HACH, USA) Multiparameter (Hanna Instruments, Woonsoket, USA) UV-Vis Spectrophotometer (Varian, Cary3, USA) Ion Chromatograph (IC-3000, Dionex, USA) g, 4 에서 15분간원심분리하였다. 원심분리후, 상등액을버리고바닥의침전물을 0.15 M 인산1수소나트륨용액 20 ml (ph 9.0~9.5) 로녹여완전히재부유시키고, 이를다시 4,000~10,000 g, 4 에서 10분간원심분리한후침전물은버리고상등액을모아 ph를 7.0~7.5로조절하였다. 미생물의오염을방지하기위해상등액을멸균용필터로여과하였다. 바이러스핵산의추출 RNA를추출하기위해 QIAamp viral RNA Mini Kit (QIAgen, Germany) 를사용하였다. 제조자의매뉴얼에따라 RNA를추출하였으며분석전까지 -70 냉장고에보관하였다. 노로바이러스유전자검출국립환경과학원의지하수중노로바이러스분석지침 (2007) 에따라 semi-nested Reverse Transciption (RT)-PCR을수행하였으며사용된 primer는 Table 2에기술하였다 (8, 9). RNA template 2 μl에 2X RT-PCR Master mix 12.5 μl, 노로바이러스 RNA polymerase와 capsid 유전자에상응하는 sense primer와 antisense primer를각각 2 μl (10 pmol), DW 6 μl를넣어총 25 μl 반응액을준비하였다. Thermal cycler (BIO-RAD, USA) 를이용하여 47 에서 40분간 reverse transcription (RT) 을수행하고, PCR 반응은 94 15분동 Table 2. Primers used for the detection of enteric viruses using conventional RT-PCR Genogroup Primer Primer Sequence (5'-3') a b Product size Polarity (bp) Norovirus GI Norovirus GII Pan- Enterovirus Astrovirus GI-F1M CTGCCCGAATTYGTAAATGATGAT F GI-R1M CCAACCCARCCATTRTACATYTG R GI-F2 ATGATGATGGCGTCTAAGGACGC SF GII-F1M GGGAGGGCGATCGCAATCT F GII-R1M CCRCCIGCATRICCRTTRTACAT R GII-F3 TGTGAATGAAGATGGCGTCGART SF EV1 CAAGCACTTCTGTTTCCCGG F EV2 ATTGTCACCATAAGCAGCCA R EV3 CTTGCGCGTTACGAC SR Mon269 CAACTCAGGAAACAGGGTGT F Mon270 TCAGATGCATTGTCATTGGT R a Y=C/T, R=A/G, I=C/G/A/T b F, forward primer; R, reverse primer; SF, seminested forward primer; SR, seminested reverse primer Reference 314 Kim et al. (8) 313 Kim et al. (8) Lee & Jeong (2) Noel JS et al. (9)
4 134 S-H Choi, et al. Table 3. Kind of bacteria and antibiotic used for coliphage test Coliphage Host bacteria Antibiotic solution Somatic coliphage (X174) E.coli F amp Ampicilin/streptomycin sulfate (1.5 mg/ml) Male-specific coliphage (MS2) E.coli C Nalidixic acid (10 mg/ ml) 안 denaturation 반응시킨뒤 94 30초, 54 30초, 72 45초로 35 cycle을반복한후 72 에서 7분간 extension으로하였다. Nested PCR은 RT-PCR 산물 2 μl에 10X PCR reaction buffer, 2.5 mm dntp, 20 pmol primer, 1 U Taq polymerase (Bioneer, Korea) 를넣어서 50 μl 반응액을준비한후, 94 에서 3분간 denaturation, 94 30초, 56 30초, 72 45초로 25 cycle, 72 에서 7분간 extension으로하였다. PCR 생성물은 prestaining (SYBR safe, Invitrogen, USA) 된 1.5% agarose gel에서전기영동을수행하여 ( 노로바이러스 GI은 313 bp, GII는 314 bp band를확인하였다. 본실험의양성대조군으로사용된바이러스는노로바이러스양성환자의설사변에서노로바이러스 (GI, GII) 로동정된바이러스를사용하였다. 노로바이러스 real-time RT- PCT을위한 Taqman probe는 GI은 Texas Red, GII 는 FAM 을사용하였고, real-time RT-PCR 반응액은 AccuPower Norovirus Quantitative PCR kit (Bioneer, Korea) 의 master mix 에 RNA template 5 μl을넣어총 50 μl이되도록하였다. 유전자증폭을위해 Excylcler RM 96 (Bioneer, Korea) 를이용하여 50 에서 30분간 RT-PCR 을수행하여 94 15분동안 denaturation 반응시킨뒤 94 15초 annealing 및 extension 반응은 55 1분간수행하였다. 장관계바이러스의유전자검출엔테로바이러스및아스트로바이러스핵산의증폭을위해 RNA template 2 μl에각각의바이러스특이적 primer set가 10 pmol 씩첨가된 18 μl PCR 반응혼합액 (Bioneer, Korea) 과섞어주었다. 반응조건은 42 45분간 reverse transcription을수행하였고 PCR 반응은 94 5분간 denaturation 94 30초, 55 30초, 72 40초간 40 cycle, 72 5분간 extension으로수행하였다. 유전자증폭을위해 Thermal cycler (BIO-RAD, USA) 를이용하였다. 본실험의양성대조군으로사용된바이러스는환자의설사변에서동정된엔테로바이러스와아스트로바이러스를사용하였다. Enzyme immunoassay (EIA) 로타바이러스및장아데노바이러스의검출을위해서는시료최종농축액을이용해 Adenovirus and Rotavirus kit (BioFocus, Korea) 를이용하여 antigen capture EIA법으로, 제조자의매뉴얼에따라수행하였다. 대장균파지분석숙주박테리아를준비하기위하여항생물질이첨가된 Trypic Soy Broth (TSB) 에각각의박테리아를접종하고대수증식기가될때까지 37 에서배양하였다. 대장균파지종류에따른박테리아와항생물질의종류는 Table 3과같다. 항생제가들어있는멸균된 2 TSA (0.8%) 배지에최종농축시료 5 ml과 4 M MgCl 6 6H 2 O를 ml 첨가한후 37 에서 5분간반응시키고숙주박테리아 500 μl를넣어잘섞은후평판배양하였다. 37 에서 24시간배양한후플라크수를세었다. 결과채취지점의특성부산지역에서미생물의부적합율이비교적높은민방위비상급수시설중음용수로사용되는지하수 22건및지하수를사용하여단체급식을하는시설시료 8건그리고약수터수 10건, 총 40건의시료를채취하였고, 채취지점의특성은 Table 4에나타내었다. 시료채취량은국립환경과학원지하수중노로바이러스분석지침에따라 500 l 이상을원칙으로하였으나, 현장채수여건과탁도등에따라채수량에다소차이가있었다. 수소이온농도는약수터수가지하수에비해약간낮았으며, 평균 6.9와 7.2를나타내었다. 탁도의경우평균적으로약수터수가조금높았으나평균적으로 1 NTU 미만으로양호한상태를나타내었다. 수온의경우, 8.0 에서 26.0 범위로측정되었다. 채취지점의개발시기는대
5 Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan ('10~'11) 135 Table 4. Characteristics of sampling sites Sample type Item (unit) Min Max Mean S.D. a Groundwater (n=30) Spring-water (n=10) Sampled volume of water (liter) Turbidity (NTU) Temperature ( ) ph Depth to aquifer (meter) Elapsed time after developing (month) Daily capacity (ton) Sampled volume of water (liter) Turbidity (NTU) Temperature ( ) ph Daily capacity (ton) Elapsed time after developing (month) Daily visitors (people) a S.D.: standard deviation, b NTU: nephalometric turbidity unit 부분 15년이상된곳이었으며, 지하수관정의깊이는대부분 100미터이상이었다. 지하수및약수터수중노로바이러스와기타장관계바이러스의검사노로바이러스의검출을위해최종적으로얻어진 40개의지하수및약수터수의농축시료들을 nested RT-PCR 및 real-time RT-PCR법을이용하여분석한결과, 40개시료전부에서노로바이러스는검출되지않았다. 노로바이러스분석과더불어 40개시료에대해엔테로바이러스, 로타바이러스, 장아데노바이러스, 아스트로바이러스에대한분석을함께수행한결과, 전지점에서바이러스의존재를확인할수없었다 (Table 5). 또한, 별도로설사환자에서획득한노로바이러스및기타장관계바이러스양성분변부유액을이용하여바이러스검출시험을수행한결과, 노로바이러스가검출됨을확인할수있었고노로바이러스와동일한시험법으로기타장관계바이러스의검출이가능함을확인하였다. 수질오염지표항목의분석먹는물중지표세균인자인일반세균 (standard plate count bacteria) 과총대장균군 (total coliforms) 및대장균그 리고여시니아균을검사한결과, 총 40개의시료중 22개의시료 (55.0%) 가일반세균기준 100 CFU/ml 을초과하였으며, 23개시료 (57.5%) 에서총대장균군이확인되었다. 그중 9개시료 (22.5%) 에서대장균이검출되었다. 따라서, 40개지점중 32개지점 (80.0%) 이세균지표항목에서먹는물수질기준을만족하지못하였다 (Table 5). 또한, 평균적으로지하수보다약수터수에서지표세균의분포도가높았고, 직접적인분변오염지표인대장균이특히약수터에많이검출되어사람및동물의분변오염에상당히취약함을확인할수있었다 (Table 6). 집단급식시설시료 8건중 1건 (12.5%) 만이일반세균및총대장균군이검출되었고나머지 7건은모두먹는물수질기준을만족하는것으로확인되었다. 또한, 여시니아균검사결과는지하수에서는 30개소모두불검출이었으나약수터수 10개소에대해서는총 3개소 (30%) 에서여시니아균이검출되었다. 또한, 암모니아성질소는전지점에서검출되지않았으나, 지하수 4개소 (13.3%) 에서질산성질소항목이수질기준치를초과하였다. 탁도의경우지하수에서는 3개소 (10.0%), 약수터수중에서는 5개소 (50.0%) 에서수질기준치를초과하는수준을나타내었다 (Table 6).
6 136 S-H Choi, et al. Virus and Indicator Table 5. Detection of viral pathogens and fecal indicators Groundwater (n=30) No. positive a (%) Spring-water (n=10) Overall (n=40) Viral pathogen Norovirus 0 (0.0) 0 (0.0) 0 (0.0) Pan-enterovirus 0 (0.0) 0 (0.0) 0 (0.0) Rotavirus 0 (0.0) 0 (0.0) 0 (0.0) Adenovirus 0 (0.0) 0 (0.0) 0 (0.0) Astrovirus 0 (0.0) 0 (0.0) 0 (0.0) Fecal indicator TCC bacteria 14 (46.7) 8 (80.0) 22 (55.0) Total coliforms 14 (46.7) 9 (90.0) 23 (57.5) E. coli 2 (6.7) 7 (70.0) 9 (22.5) Yersinia enterocolitica 0 (0.0) 3 (30.0) 3 (7.5) Somatic coliphage 0 (0.0) 0 (0.0) 0 (0.0) Male-specific coliphage 0 (0.0) 0 (0.0) 0 (0.0) Nitrate nitrogen (NO 3 -N) 4 (13.3) 0 (0.0) 4 (10.0) Ammonia nitrogen (NH 3 -N) 0 (0.0) 0 (0.0) 0 (0.0) Turbidity 3 (10.0) 5 (50.0) 8 (20.0) a Positive; TCC (total colony counts) bacteria 100 CFU/ml, total coliforms and E. coli 1 CFU/100 ml, Somatic coliphage and malespecific coliphage 1 PFU/ml, NO 3 -N 10 mg/ml, NH 3 -N 0.5 mg/l, Turbidity 1 NTU Table 6. Distribution of indicator bacteria of groundwater and spring water Grounwater (n=40) Spring-water (n=10) Item (unit) Min Max Mean S.D. Min Max Mean S.D. TCC bacteria (CFU/ml) Total coliforms (CFU/100 ml) E. coli (CFU/100 ml) 대장균파지의확인본연구에서 40개시료최종여과, 탈리농축액으로 somatic 대장균파지와 male-specific 대장균파지에대해분석한결과대장균파지가관찰되지않았다. 고찰 2010년에서 2011년까지부산지역에서음용수로사용하는지하수 30건, 등산로나사찰등에위치한약수터수 10건총 40건의시료를대상으로노로바이러스및기타장관계바이러스의오염여부를조사하였다. 더불어수질 장관계바이러스의오염여부를조사하였다. 더불어수질지표세균및대장균파지그리고유기물오염지표항목에대해서도분석을수행하였다. 그결과, 전지점에서장관계바이러스는검출되지않았다. 2009~2010년부산, 울산및경남지역의지하수중노로바이러스오염실태조사결과지역별검출률이경남 32%, 부산 15% 그리고울산 7% 로보고하였고 (10), 또한 2008년전국에서 300개의지하수에서노로바이러스검출실태를조사한결과 600개의시료중에서 117건 (19.5%) 에서노로바이러스가검출되었으며, 서울 (64.3%), 경상남도 (46.2%), 울산 (37.5%), 경기도 (32.9%), 경상북도 (31.1%), 전라북도 (27.5%), 제주도 (25.0%), 부산 (23.3%) 등
7 Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan ('10~'11) 137 의순으로검출률을보였다 (11). 상기발표된결과들은전국지하수수질측정망을통해수질오염도가높은음용지하수외에도비음용지하수를포함하여환경부용역과제로조사된내용이었으며, 주된검출지역은농업활동이주를이루는농촌지역및주거지역과농촌의특성이혼합된중소도시에서의검출률이 92% 로대부분을차지하였고, 그외전형적인주거밀집형의대도시의경우 5% 이내의검출률을나타내었다. 그러나, 음용수로사용하는서울지역공공지하수 48건중 2건 (4.2%) 에서노로바이러스가검출되었다는보고 (12) 와대구와광주지역에서는노로바이러스가전혀검출되지않은것으로확인된것은 (11) 비교적주변환경등에의해지하수오염요인이적은대도시의지하수의경우에는노로바이러스등장관계바이러스의오염현황이매우낮음을확인할수있었다. 분변오염지표세균검사결과, 총대장균군은 57.5%, 대장균은 22.5%, 여시니아균은 7.5% 의검출률을나타내었고바이러스성지표로사용되는대장균파지는검출되지않았다. 또한, 단백질같은질소화합물이분해되는과정에서생기는암모니아성질소및질산성질소항목에대해분석한결과질소화합물에의한비교적최근오염을암시하는암모니아성질소는전지점에서검출되지않았으나, 비교적과거오염을의미하는질산성질소가지하수 4개소 (10.0%) 에서수질기준치를초과하였다. 탁도의경우총 8개소 (20.0%) 에서수질기준치 1 NTU를초과하였다. 탁도는대부분콜로이드입자와대단히미세한입자에의하여생겨나는데, 일반적으로지표수에서는탁도가높을수록바이러스의입자들이이런입자들간의부착으로인해바이러스의검출률이높아지고 (13, 14), 대장균파지는사람의바이러스와유사한특성을가지고있어종종장관계바이러스의분변오염근원을좀더구체적으로판단하는데사용되었다 (1, 15). 이번연구에서는대상시설이모두음용용도로사용되는시설이었고평균탁도는 1 NTU 이하수준을나타내어바이러스의부착가능성이적었으며대장균파지도모든시료에서확인되지않아장관계바이러스의오염가능성은적었던것으로판단하였다. 연구대상총 40건의시료중미생물항목에서먹는물수질기준을만족하지못하는비율이 32건 (80.0%) 으로매우높고, 탁도및유기물등에의한오염원이있는지하수및약수터수가다수있었지만, 장관계바이러스의오염여부와는직접적으로연관성 이없음을확인할수있었다. 이번연구에서대상으로한지하수는부산지역에서공공시설이면서음용수로이용하는민방위비상급수이고, 주로도심지역의주거단지에위치한시설들이어서, 최근까지는노로바이러스및기타장관계바이러스의오염에대해서는비교적안전함을확인할수있었다. 약수터수의경우, 지하수에비해강우, 주변동물및사람분변등의오염등에더욱취약하여장관계바이러스의오염을우려하였으나, 조사결과대상시료모두에서바이러스가존재하지않았다. 여시니아균은동물과사람에서주로설사를일으키고, 야생동물이여시니아균의보유고가될수있으므로애완견이나야생동물의분변에노출될가능성이큰약수터수에대해서먹는물수질기준이명시되어있다. 노로바이러스역시동물 ( 쥐, 소 ) 과사람분변모두가오염원이될수있으므로 (16), 노로바이러스를감시하는데간접적인지표가될수있을것으로판단하였으나, 이번연구대상시료에서여시니아균을포함해지표세균검출률이비교적매우높았음에도노로바이러스및기타장관계바이러스의검출이확인되지않은것은이런분변오염의세균성지표가지하수의장관계바이러스의존재와는통계적으로연관성이미약하다는이전의연구결과 (4, 17, 18) 들과상통하였다. 최근지하수에대해바이러스를포함한미생물조사와지하수성분조사를결부지어지하수오염조사연구가활발히이루어지고있지만 (10, 11, 19, 20), 아직은노로바이스등의검출여부와직접적으로연관지을수있는이화학적특성을찾기가어려웠다. 따라서, 방대한조사를통해지하수중의노로바이러스오염가능성의확인과제어와관련된새로운변인을찾아야하며각변인들을통계적으로계랑화하는작업이요구된다고하겠다. 하루에도수십, 수백톤의방대한양의물이끊임없이소비되고채워지는지하수의특성상, 이에대한생물학적안전성을확인하는일은일종의확률적사안이다. 장관계바이러스의오염이발견되지않았다고해서그이전과이후에도계속안전하리라는단정은불가하다. 따라서, 지속적으로장관계바이러스등미생물에안전한지하수를유지하기위해서는주기적수질데이터를통해지하수오염요인을신속히파악하고, 오염원유입이될수있는관정시설의개보수및주변오염원차단조치가무엇보다중요하다고하겠다. 또한, 필요한경우지하수저장탱크에소독구를설치하여주기적으로소독관리가
8 138 S-H Choi, et al. 이루어지도록해야한다. 약수터수의경우에는강우및인간과동물의활동에의해비교적쉽게미생물의오염이이루어질수있으므로, 약수터주변의청결관리와약수터위쪽의출입을자제하고애완동물등의분변관리가철저히이루어져야한다. 특히, 약수터인근에화장실이위치할경우정화조에서누수가없도록철저히관리를해야하며, 현재의약수터구조는주로옹달샘을막거나, 저수조를만들어파이프를연결하여사용하는방식이므로소독을실시하기어려운구조이나, 저수조를통해소독이일부가능한지점은소독을강화할필요가있고, 오염원으로인해수질이악화된경우그영향에서회복되는시기를감안하여시민들이마실수있도록게시판에공지하여안전하게약수를음용하도록조치해야한다. 이번연구는지하수및약수터수의정기적검사기록상수질지표세균및유기물오염인자를고려하여오염이우려될만한시설만을대상으로하여연구한결과이므로, 시료의수가일부불충분하긴하였으나부산지역공공지하수및약수터수에대해현재국내먹는물수질기준에는포함되어있지않은노로바이러스및기타장관계바이러스를포함하여미생물이화학적조사를처음으로실시한결과로써의의가있으며, 향후관련연구의기초자료로활용될수있을것으로판단한다. 참고문헌 1) Leclerc H, Edberg S, Pierzo V, Delattre JM. Bacteriophages as indicators of enteric viruses and public health risk in groundwaters. J Appl Microbiol 2000;88: ) Lee HK, Jeong YS. Comparison of total culturable virus assay and multiplex integrated cell culture-pcr for reliability of waterborne virus detection. Appl Environ Microbiol 2004;70: ) Moore BE. Survival of human immunodeficiency virus (HIV), HIV-infected lymphocytes, and poliovirus in water. Appl Environ Microbiol 1993;59: ) Abbaszadegan M, LeChevallier M, Gerba C. Occurrence of viruses in US groundwaters. J Am Water Work Assoc 2003; 95: ) Barwick RS, Levy DA, Craun GF, Beach MJ, Calderon RL. Surveillance for waterborne-disease outbreaks--united States, MMWR CDC Surveill Summ 2000;49: ) Reynolds KA, Mena KD, Gerba CP. Risk of waterborne illness via drinking water in the United States. Rev Environ Contam Toxicol 2008;192: ) Fout G, Schaefer F, Messer J, Dahling D, Stertler R. ICR microbial laboratory manual, Washington D.C.: US Environmental Protection Agency, ) Kim SH, Cheon DS, Kim JH, Lee DH, Jheong WH, Heo YJ, et al. Outbreaks of gastroenteritis that occurred during school excursions in Korea were associated with several waterborne strains of norovirus. J Clin Microbiol 2005;43: ) Noel JS, Lee TW, Kurtz JB, Glass RI, Monroe SS. Typing of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing. J Clin Microbiol 1995;33: ) Park BJ. Survey of Norovirus from groundwater of Busan, Ulsan, Gyeongnam: Pusan National University Thesis of Graduate School; ) Lee SG, Jheong WH, Suh CI, Kim SH, Lee JB, Jeong YS, et al. Nationwide groundwater surveillance of noroviruses in South Korea, Appl Environ Microbiol 2011;77: ) Park SH, Kim EJ, Yun TH, Lee JH, Kim CK, Seo YH, et al. Human Enteric Viruses in Groundwater. Food Environ Virol 2010;2: ) Lee GC, Jee YS, Lee CH, Lee ST. Influence of physicochemical environmental factors on the occurrence of waterborne viruses in Korean surface water. J Bacteriol Virol 2006; 36: ) Stetler RE, Ward RL, Waltrip SC. Enteric virus and indicator bacteria levels in a water treatment system modified to reduce trihalomethane production. Appl Environ Microbiol 1984;47: ) Borchardt MA, Bertz PD, Spencer SK, Battigelli DA. Incidence of enteric viruses in groundwater from household wells in Wisconsin. Appl Environ Microbiol 2003;69: ) Ando T, Noel JS, Fankhauser RL. Genetic classification of Norwalk-like viruses. J Infect Dis 2000;181: ) Marzouk Y, Goyal SM, Gerba CP. Prevalence of enteroviruses in ground water of Israel. Ground Water 1979;17: ) Goyal SM, Gerba CP, Bittonn G. Distribution of coliphages in the environment: General considerations of Phage Ecology. New York: Wiley-Interscience; p
9 Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan ('10~'11) ) Jung JH, Yoo CH. Koo ES, Kim HM, Na Y, Jheong WH, et al. Occurrence of norovirus and other enteric viruses in untreated groundwaters of Korea. J Water Health 2011;9: ) Lee H, Kim M, Lee J, Lim M, Kim M, Kim JM, et al. Investigation of norovirus occurrence in groundwater in metropolitan Seoul, Korea. Sci Total Environ 2011;409:
파지_지표성(보고서초안6-원장님보고후수정090122).hwp
11-1480523-000394-01 NIER NO. 2008-52-1002 A study on the bacteriophages as indicators of viruses in water environment : 물에서바이러스에대한대장균파지의지표성에관한연구 장관계바이러스는물환경에서저항성이상대적으로높고, 분석이어려울뿐만아니라비용도많이소요되므로직접적인모니터링에많은어려움이있음따라서장관계바이러스에비해분석이쉽고,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationfm
J Fd Hyg Safety Vol 5, No, pp 5~6 (00),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available online at http://wwwfoodhygieneorkr ù ÊÞ Ç ò Š *Â Â ã Â Ý Â öâ ýâ ÜÄÂã ÂÞ ŠÂùó Â Ü ÅöÂ Ü Â µ Â Â ý t t w, û w y yw Investigation
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information15호-출력
PUBLIC HEALTH WEEKLY REPORT, KCDC www.cdc.go.kr/phwr Laboratory prevalence of norovirus infections in Korea and sensitive monitoring system for norovirus related outbreak combined automated diagnostic
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information- 2 -
- 1 - - 2 - 전기자동차충전기기술기준 ( 안 ) - 3 - 1 3 1-1 3 1-2 (AC) 26 1-3 (DC) 31 2 37 3 40-4 - 1 14, 10,, 2 3. 1-1 1. (scope) 600 V (IEC 60038) 500 V. (EV : Electric Vehicle) (PHEV : Plug-in Hybrid EV).. 2. (normative
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information기후변화에따른담수호수생태계변화조사 및보전에관한연구 (Ⅲ) - 기후변화에따른유해남조류발생특성연구 - 물환경연구부유역생태연구팀 Ⅲ 2012
11-148523-132-1 기후변화에따른담수호수생태계변화조사 및보전에관한연구 (Ⅲ) - 기후변화에따른유해남조류발생특성연구 - 물환경연구부유역생태연구팀 Ⅲ 212 목차 Ⅰ Ⅱ Ⅲ ⅰ 목차 Ⅳ ⅰ 목차 iii 목차 ⅳ Abstract ⅴ Ⅰ. 서론 1 Ⅱ. 연구내용및방법 < 그림 1> 대청호유역추소리조사지점도 2 Ⅱ. 연구내용및방법 3 Ⅱ. 연구내용및방법
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More informationsrc.hwp
노 로 바 이 러 스 2010. 12 차 례 제1장. 개요 2 1.1. 정의 3 1.2. 특성 6 1.3. 분석법 12 제2장. 위해 평가 17 2.1. 노출원 및 노출경로 18 2.2. 노출평가 20 제3장. 위해정보교류 30 3.1. 이슈화 사례 31 3.2. 소비자를 위한 리스크 커뮤니케이션 가이드 35 제4장. 위해 관리 45 4.1. 국내 관리 현황
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More informationMicrosoft Word - 08-박귀성.doc
Journal of Bacteriology and Virology 2011. Vol. 41, No. 4 p.287 293 http://dx.doi.org/10.4167/jbv.2011.41.4.287 Original Article Genetic Characterization of Norovirus GII.3 Circulating in Korea JongIm
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부
大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
More informationETC Electrolytic Technologies Corporation Electrolytic Technologies Corporation (ETC) (High Strength Sodium Hypochlorite). ETC.,. ETC,,. - (Cl2) (NaOH
Innovator in Water Disinfection Solution 고농도차염 (NaOCl) 발생시스템 Klorigen K-Series Klorigen M-Series Generate Sodium Hypochlorite On-site and On-demand ETC Electrolytic Technologies Corporation Electrolytic
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information특집-5
76 May June 2008 IT Standard & Test TTA Journal No.117 TTA Journal No.117 77 78 May June 2008 IT Standard & Test TTA Journal No.117 TTA Journal No.117 79 80 May June 2008 IT Standard & Test TTA Journal
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information레이아웃 1
Annual 2013 vol.15 th HOW ENGINEERING ANNIVERSARY Annual 하우인 2013 vol.15 하우엔지니어링과 자매사 우인엔지니어링은 경남, 부산지역 종합엔지니어링 업계의 선두주자로서 건설기술의 미래지평을 열어가고 있습니다. 행복한 삶의 공간 창출, 안전하고 튼튼한 도시기반시설의 건설을 위해 우수한 인력과 기술력을 바탕으로
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: : A Study on the Ac
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.269-293 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.269 : A Study on the Actual Condition of Character Education in Early Childhood
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI: * A Study on Good School
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.1 * A Study on Good School and School Evaluation Purpose: This study was to examine
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information<32303136B3E220BCF6C1B7B1B8BAB4C1F6C4A72D56312E687770>
2016년도 수족구병 관리 지침 목 차 PART Ⅰ. 총 론 1. 개 요 2 2. 수행 체계 3 3. 임상감시 5 4. 실험실 감시 9 5. 역학조사 11 6. 실험실 검사 의뢰 12 7. 환자관리 13 PART Ⅱ. 각 론 1. 개요 17 2. 병원체 18 3. 발생 현황 및 역학적 특징 19 4. 임상 양상 24 5. 진단 및 실험실 검사 27 6.
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information<B8F1C2F72E687770>
Transactions of the KSNVE, 23(12) : 1056~1065, 2013 23 12, pp. 1056~1065, 2013 http://dx.doi.org/10.5050/ksnve.2013.23.12.1056 ISSN 1598-2785(Print), ISSN 2287-5476(Online) A Study on the Improvement Plan
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More informationStudy on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More informationuntitled
ª Œª Œ 27ƒ 2B Á 2007 3œ pp. 193 ~ 199 ª ƒ w d w ƒ sƒ Methodology of Drought Assessment Using National Groundwater Monitoring Network Data «x Á½ Kwon, Hyung JoongÁKim, Seong Joon Abstract The objective
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information