Detection of VRE using Melting Curve Analysis 139 재료및방법 Table 1. Multiplex real-time PCR primers for the detection of vancomycin-resistant enterococci

Size: px

Start display at page:

Download "Detection of VRE using Melting Curve Analysis 139 재료및방법 Table 1. Multiplex real-time PCR primers for the detection of vancomycin-resistant enterococci"

동주 경
5 years ago
Views:

1 Korean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Detection of Vancomycin-resistant Enterococci using Multiplex Real-time PCR Assay and Melting Curve Analysis Choong-Hwan Cha, M.D., Hae Kyong An, M.T., and Jeong Uk Kim, M.D. Department of Laboratory Medicine, Gangneung Asan Hospital, University of Ulsan College of Medicine, Gangneung, Korea Background : We developed and evaluated the utility of a multiplex real-time PCR assay that uses melting curve analysis and allows simultaneous identification of vancomycin-resistant genotypes and clinically relevant enterococci. Methods : The specificity of the assay was tested using 4 reference strains of vancomycin-resistant enterococci (VRE) and 2 reference strains of vancomycin-susceptible enterococci. Ninety-three clinical isolates of enterococci with different glycopeptide-resistant phenotypes were genotyped and identified using a multiplex real-time PCR assay and melting curve analysis. Results : Representative melting curves were obtained for Enterococcus faecium, Enterococcus faecalis, vana-containing E. faecium, vanb-containing E. faecalis, Enterococcus gallinarum, and Enterococcus casseliflavus. Phenotypic and genotypic analysis of the isolates revealed same results for 82 enterococcal isolates, while in 4 isolates, the glycopeptide-resistant phenotypes were inconsistent with the glycopeptide-resistant genotypes and in the 4 other isolates, species could not be accurately identified. Three isolates with mixed strains, which were detected by the PCR assay, could not be correctly identified using phenotypic methods. Conclusions : VRE genotyping and identification of clinically relevant enterococci were rapidly and correctly performed using multiplex real-time PCR assay and melting curve analysis. (Korean J Lab Med 2010;30:138-46) Key Words : Multiplex real-time PCR, Melting curve analysis, Vancomycin-resistant enterococci 서 반코마이신내성장구균 (vancomycin-resistant enterococci, VRE) 은 1987년유럽에서처음출현한이래세계적으로원내감염의중요한병원균이되었다 [1, 2]. 국내에서 1992년처음보고되었고 1990년대중반부터균주분리가급격히증가하였다 [3, 4]. 현재중환자실에서분리되는 Enterococcus faecium의 30-45% 에서반코마이신에내성을보인다 [5]. VRE에대한적절한감염관리가필요한상황이다. 신속하고정확한검출은 VRE의감염관리에매우중요하다. Received : October 17, 2009 Manuscript No : KJLM Revision received : February 21, 2010 Accepted : March 10, 2010 Corresponding author : Jeong Uk Kim, M.D. Department of Laboratory Medicine, Gangneung Asan Hospital, University of Ulsan College of Medicine, 415 Bangdong-ri, Sacheon-myeon, Gangneung , Korea Tel : , Fax : jukim@gnah.co.kr 론 VRE 선별고형배지에접종하거나선별액체배지에증균후고형배지에접종하는통상의검출방법은결과보고까지 2-5일이걸린다. VanB형과 VanC형 VRE는검출이어려운경우도있다 [6]. 이에중합효소연쇄반응법 (PCR) 과실시간-중합효소연쇄반응법 (real-time PCR) 등 glycopeptides 내성유전자검사법이 VRE 감시배양에사용되었다 [7-13]. 실시간-중합효소연쇄반응법은중합효소연쇄반응법보다 VRE를더빠르게검출하고업무량도적다 [12]. 반응시간이짧고실시간으로반응산물이모니터링되어전기영동이필요하지않기때문이다. 하지만염기서열에특이한소식자를사용하는경우시약비용이증가하는단점이있다. 본연구에서저자들은염기서열에특이한소식자를사용하지않고융해곡선 (melting curve) 분석을이용하여 VRE를검출하는다중실시간-중합효소연쇄반응법 (multiplex real-time PCR) 을개발하여유용성을평가하였다. 138

2 Detection of VRE using Melting Curve Analysis 139 재료및방법 Table 1. Multiplex real-time PCR primers for the detection of vancomycin-resistant enterococci 1. 대상균주 Amplified gene Primer sequences (5-3 ) Size of the PCR Product product (bp) Tm ( ) 본원진단검사의학과에의뢰된임상검체에서분리된 93주의장구균 (E. faecium 72주, Enterococcus faecalis 13주, Enterococcus avium 3주, Enterococcus durans 2주, Enterococcus gallinarum 2주, Enterococcus casseliflavus 1주 ) 을대상으로하였다. 표준균주로는 E. faecium ATCC (vana), E. faecalis ATCC (vanb), E. gallinarum ATCC (vanc1), E. casseliflavus ATCC (vanc2/ C3), E. faecalis ATCC 29212, E. faecium ATCC 19434를사용하였다. 2. 장구균의동정검사및항균제감수성검사대상균주는반코마이신 6 mg/ml를첨가하여자가제조한 Enterococcosel agar (EA) (Becton Dickinson, Sparks, MD, USA) 와반코마이신을첨가하지않은 EA에서선별되었다. 배양 1일과 2일째검은색으로변한집락을혈액한천배지에계대배양하여균동정과항균제감수성검사를시행하였다. 균동정은 MicroScan (Dade Behring, West Sacramento, CA, USA) 과 API 20 STREP (biomerieux, Hazelwood, MO, USA) 을사용하였으며, 반코마이신과타이코프라닌의최소억제농도 (minimum inhibitory concentration, MIC) 는 E-test (AB Biodisk, Solna, Sweden) 로측정하였다. 항균제별 MIC의해석은 CLSI의기준 [14] 을따랐다. 3. DNA 추출중탕가열 (boiling) 법으로 DNA를추출하였다. EA에서자란검은색집락적당량을면봉에묻혀증류수 0.5 ml가들어있는 1.5 ml microtube에풀고 10 분동안끓은물에중탕시켰다. 13,000 rpm으로 3분간원심분리한후상청액을사용하였다. 상청액의 DNA 농도는 ng/ml 가되도록멸균증류수로조절하였다. 4. 다중실시간-중합효소연쇄반응법네종류의 glycopeptide 내성유전자 (vana, vanb, vanc1, vanc2/c3) 와 E. faecalis와 E. faecium 균종에특이한 D- vana TATTGACTTCGTTCAGTACA ±0.3 TGTGGATATGTTTTTACAAG vanb CAGACCCTGTATCGCACCAT ±0.3 AACGGCGTATGGAAGCTATG vanc1 TGCTTGTGATGCGATTTCTC ±0.4 ATCGCTCCTTGATTGGTGAC vanc2/c3 GGGAAGATGGCAGTATCCAA ±0.3 GCAGCAGCCATTTGTTCATA ddl E. faecalis GTGGCTTAAGTCGCTGTGAT ±0.3 AGGCATGGTGTTCAATTCAT ddl E. faecium TTTACAAGCTGCTGGTGTGC ±0.3 AACCCATATTCGCAGGTTTG Abbreviations: Tm, melting temperature; ddl, gene encoding D-alanine- D-alanine ligase; E. faecalis, Enterococcus faecalis; E. faecium, Enterococcus faecium. alanine-d-alanine ligase 유전자 (ddl) 를검출부위로하는시발체를 Primer3 프로그램을이용하여설계하였다 [15]. 각시발체의염기서열, 반응산물의크기, 온도 (Tm) 는 Table 1과같다. Type-it HRM PCR 키트 (QIAGEN Inc., Germantown, MD, USA) 를사용하여실시간-중합효소연쇄반응을실시하였다. 5 ml의 2 HRM PCR Master Mix, 0.8 ml의시발체혼합액 (E. faecalis 시발체, 0.6 mm; E. faecium 시발체, 0.3 mm; vana 시발체, 0.8 mm; vanb 시발체, 0.2 mm; vanc1 시발체, 0.2 mm; vanc2/c3 시발체, 0.2 mm), 3.2 ml의증류수에 1 ml 의DNA를넣어반응액 10 ml를제조하여중합효소연쇄반응을실시하였다. 중합효소연쇄반응은 Rotor-gene 6000 (QIAGEN Inc., Germantown, MD, USA) 를이용하였다. 95 에서 5분반응후 95 에서 10초, 53 에서 30초, 63 에서 20초의반응을 40 회반복하였다. 마지막 PCR 반응이끝난후 65 에서 89 까지초당 0.2 의속도로온도를증가시키면서융해곡선을모니터링하였다. 결 저자들은융해곡선을분석하여네종류의 glycopeptide 내성유전자의검출과 E. faecalis와 E. faecium의동정이가능한다중실시간-중합효소연쇄반응법을개발하였다. ATCC 표준균주들의융해곡선은 Fig. 1과같다. 융해곡선분석이용이하도록반응산물간에 Tm 차이가나도록시발체를설계하였다. 가능한2 이상차이가나도록제작하였지만 vanb와 vanc1 반응 과

3 140 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim A 0.0 B C D E 0 F Fig. 1. Melting curve analysis of amplicons obtained from reference strains by using multiplex real-time PCR. Melting curves for Enterococcus faecium (A); Enterococcus faecalis (B); E. faecium/vana (C); E. faecalis/vanb (D); Enterococcus gallinarum/vanc1 (E); and Enterococcus casseliflavus/vanc2/c3 (F) are shown. 산물간에는 0.5 밖에차이가나지않았다. 시발체에따른반응정도차이는시발체의농도, 불림 (annealing) 및확대 (extension) 온도와유지시간을조절하여 6가지검출부위모두반응이잘일어날수있도록조건을최적화하였다. 임상검체에서분리된장구균 93주의항균제감수성결과에따라대상균주들의내성표현형은다음과같았다. E. faecium 65주, E. faecalis 5주, E. avium 2주, E. durans 1주및 E. gallinarum 1주는 VanA형 ( 반코마이신 MIC, 256 mg/ml; 타이코프라닌 MIC, mg/ml) 이었고 E. faecium 4 주는 VanB형 ( 반코마이신 MIC, mg/ml; 타이코프라닌 MIC, 8-12 mg/ml) 이었으며 E. gallinarum 1주와 E. casseliflavus 1주는 VanC형 ( 반코마이신 MIC, 6-12 mg/ml; 타이코프라닌 MIC, 2 mg/ml) 이었다. 그리고 E. faecium 3주, E. faecalis 8주, E. avium 1주및 E. durans 1주는감수성 ( 반코마이신 MIC, mg/ml; 타이코프라닌 MIC, mg/ml) 을보였다.

4 Detection of VRE using Melting Curve Analysis 141 Table 2. Genotype analysis of 93 enterococcal isolates with different glycopeptides-resistant phenotypes by using multiplex real-time PCR and melting curve analysis Species Resistant phenotype No. of strains Results obtained by multiple real-time PCR ddl E. faecium ddl E. faecalis vana vanb vanc1 vanc2/c3 E. faecium VanA VanB Susceptible E. faecalis VanA Susceptible E. gallinarum VanA VanC E. casseliflavus VanC E. avium VanA Susceptible E. durans VanA Susceptible Abbreviations: ddl, gene encoding D-alanine-D-alanine ligase; E. faecium, Enterococcus faecium; E. faecalis, Enterococcus faecalis; E. gallinarum, Enterococcus gallinarum; E. casseliflavus, Enterococcus casseliflavus; E. avium, Enterococcus avium; E. durans, Enterococcus durans A 0.25 B C Fig. 2. Melting curve analysis for the identification of mixed strains. (A) Melting curve for DNA extracted from black colonies growing on the Enterococcal agar plate. VanA, ddl Enterococcus faecalis, and ddl Enterococcus faecium peaks are shown. (B) Melting curve for DNA extracted from pure colonies of E. faecium with phenotype VanA growing on the blood agar plate. Peaks for E. faecium with VanA and ddl genes. (C) Melting curve for DNA extracted from pure colonies of E. faecalis with phenotype VanA growing on the blood agar plate. Peaks for E. faecalis with VanA and ddl genes. 균종별유전자형분석결과는다음과같았다 (Table 2). VanA 형 E. faecium 65주와 VanB형 E. faecium 4주는모두 vana 유전자형의 E. faecium으로분석하였다. Glycopeptides에감수성을보인 E. faecium 3주중 2주는 E. faecium으로동정되었으나한균주에서는 vanc2/c3 (E. casseliflavus/e. flavescens) 유전자가검출되어생화학적동정과불일치하였다. VanA형 E. faecalis 5주는모두 vana 유전자형의 E. faecalis 로분석하였고감수성을보인 E. faecalis 8주는 E. faecalis의 ddl 유전자만검출되어생화학적동정과일치하였다. VanA형 E. avium 1주는 vana 유전자만검출되었고 VanC형 E. casseliflavus 1주는 vanc2/c3 유전자가검출되어생화학적동정과일치하였다. VanA형 E. durans 1주는 vana 유전자형의 E. faecium으로동정되고감수성을보인 E. avium 1주와 E. durans 1주는모두 E. faecalis로동정되어생화학적동정결과

5 142 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim A B C Fig. 3. Melting curve analysis of amplicons obtained from 3 mixed strains of 2 or more enterococci by using multiplex real-time PCR. Melting curves for Enterococcus faecalis and Enterococcus faecium with vana gene (A); E. faecalis and E. faecium with vana gene and Enterococcus gallinarum with vanc1 gene (B); and Enterococcus casseliflavus/enterococcus flavescens with vanc2/c3 gene and E. gallinarum with vanc1 gene (C). 와일치하지않았다. 한편, 한검체에 2종이상의장구균이섞여있는경우도있었다. 장구균 93주중 VanA형 E. faecium 1주와 VanA형 E. faecalis 1주는한검체에서분리된균주로 EA 선택배지에서자란집락에서 vana E. faecium과 vana E. faecalis가검출되었고혈액한천배지에계대배양했을때두종류의순수집락으로구분되어분리되었다 (Fig. 2). 그러나 VanA형 E. avium 1주, VanA형 E. gallinarum 1주및 VanC형 E. gallinarum 1 주는 2종이상의균주가혼합된것처럼 VanA형 E. avium 1주는 vana 유전자와 E. faecium과 E. faecalis의 ddl 유전자가동시에검출되었으며 VanA형 E. gallinarum 1주는 vanc1 유전자및 vana 유전자와 E. faecium과 E. faecalis의 ddl 유전자가동시에검출되었고 VanC형 E. gallinarum 1주는 vanc1 유전자와 vanc2/c3 유전자가함께검출되었으나 EA 선택배지에자란집락을계대배양하였을때순수집락으로분리할수없었다 (Fig. 3). 고찰최근국내에실시간-중합효소연쇄반응장비를도입하는검 사실이증가하는추세이다. 실시간-중합효소연쇄반응장비는고가의기기이지만중합효소연쇄반응보다더민감하고특이적인검사법의개발이가능하다. 염기서열에특이한소식자를사용하고융해곡선분석으로특이도가높다 [16]. 융해곡선분석은 1997년처음소개되었다. 융해는두가닥 DNA가가온되면한가닥 DNA로분리되는현상을말한다. 두가닥 DNA에비특이적으로결합하는형광색소 (fluorescent dye) 인 SYBR Green 을사용하여융해과정이실시간으로측정된다. 반응산물의염기서열, 크기및 GC 비율에따라특징적인융해곡선을보여전기영동없이도융해곡선분석만으로반응산물을확인할수있었다 [17]. 널리사용되는 SYBR Green은고농도에서중합효소연쇄반응을저하시키고융해과정에서형광색소의재분포가일어나유전자형결정 (genotyping) 까지가능한고해상융해곡선 (high-resolution melting curve) 분석에는적합하지않았다. 최근개발된 SYTO 9, EvaGreen, LCGreen 등의형광색소는이러한단점이개선되어고해상융해곡선분석에사용되고있다 [16, 18]. 본연구에사용된 Type-it HRM PCR 키트의 master mix에는 EvaGreen이들어있다. 다중중합효소연쇄반응법은두쌍이상의시발체를사용하여두가지이상의검출부위를동시에검출할수있게고안된중합

6 Detection of VRE using Melting Curve Analysis 143 효소연쇄반응법이다. 일회반응으로여러대상을검출할수있어검사시간과시약비용을줄일수있다. 실시간-중합효소연쇄반응장비에서도소식자의형광색상과반응산물의 Tm 차이를이용하여다중검사가가능하다 [19-21]. 융해곡선분석을이용하는다중실시간-중합효소연쇄반응법은다중중합효소연쇄반응법과달리반응산물의크기보다반응산물의 Tm에차이가나도록시발체를설계한다. 다중반응은 dntp, Taq polymerase 등반응시약들의농도가한정된조건하에놓이게되어시발체간에경합반응이일어난다. 상대적으로약한반응이일어나는시발체는단일반응때보다민감도가저하될가능성이있다. Satake 등 [9] 은다중중합효소연쇄반응으로 VRE 유전자를검출하는경우단일반응때보다검출률이저하되는것을보고하였다. 저자들은 EA 선택배지에자란집락에서 DNA를추출하도록고안하였기에주형 DNA의농도를민감도이상으로유지할수있어다중반응에서민감도가저하되는문제는유의하지않다고추정하였다. 본검사법은 DNA를추출할때증류수 50 ml 를사용하면 EA 선별배지에자란집락한개로내성유전자형결정과균동정이가능하였다. 과량의주형 DNA를사용하면융해곡선이오른쪽으로이동되며 Tm 차이가적은 vanb와 vanc1 반응산물간의구분이어렵게되었다. 그래서중합효소연쇄반응에사용되는주형DNA 농도를 ng으로조정하여반응산물이검출되지않거나 Tm값이증가되는현상이일어나지않도록하였다. 신속하고정확한 VRE의검출은적절한감염관리를시행하여전파를차단하는데매우중요하다 [13]. 더욱이 vana 유전자를가진반코마이신내성 Staphylococcus aureus의출현으로 VRE 감염관리의중요성이강조되고있다 [22]. 중합효소연쇄반응법으로 VRE 유전자를검출하는방법은가장특이도가높은검사법이고저도내성을갖는 VRE 검출에도유용하다 [6]. 실시간-중합효소연쇄반응기기의등장으로중합효소연쇄반응보다신속하게내성유전자의검출이가능하게되었다 [12]. 지금까지여러방식의내성유전자검출법이보고되었으나 [7-13], 융해곡선분석을이용한방법은없었다. 이에저자들은염기서열에특이한소식자를사용하지않고융해곡선분석을이용하여 van 유전자의검출과장구균의동정이동시에가능한다중실시간- 중합효소연쇄반응법을개발하게되었다. VRE는 7종류 (VanA, VanB, VanC, VanD, VanE, VanG, VanL) 의표현형이있으며해당유전자형에의해발현된다 [6, 23]. 주로 VanA, VanB, VanC형이임상검체에서검출되며균종으로는 E. faecium과 E. faecalis가대부분을차지하고있다 [4, 24-27]. vana와 vanb 유전자와달리 vanc 유전자는내인성의균종특이성이 있으며유전자형의결정만으로균동정이가능하다. vanc1은 E. gallinarum, vanc2는 E. casseliflavus, vanc3는 E. flavescens에특이적이지만 vanc2와 vanc3 유전자는염기서열이 98.3% 가동일하여중합효소연쇄반응으로구분하기어렵다 [28]. 저자들은임상검체에서주로검출되는 VanA, VanB, VanC 형의 VRE가갖고있는 vana, vanb, vanc1, vanc2/c3 유전자를검출하고 E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/e. flavescens의동정이가능하도록시발체를설계하였다. 유용성평가에사용된장구균 93주는 2000년 2월이후강릉아산병원진단검사의학과에서분리되어 -70 에보관된균주들과 2009년 5월과 6월두달동안반코마이신 6 mg/ml가첨가된 EA 선택배지에의뢰된대변및직장주변도말검체를배양하여분리한균주였다. 신속하게 VRE를검출하는방법으로대변이나직장주변도말검체에서직접 DNA를추출하거나 [9, 13, 29-31], 선택배지로장구균을선별하는방법들이연구되었다 [32-34]. 검체에서직접 DNA를추출하는방법은억제제로인하여 VRE 검출률이저하된다 [9, 13, 34]. 이에저자들은 6 mg/ml 가첨가된 EA 선택배지로장구균을선별하여중탕가열법으로 DNA를추출하는방법을사용하였다. 이방법으로중합효소연쇄반응의저하없이 EA 선별배지에검은색집락을형성한당일에내성유전자형결정과동정이가능하였다. 생화학적균동정과 MIC의측정은 EA 선별배지에자란검은집락을혈액한천배지에계대배양하여실시하였으므로실시간-중합효소연쇄반응법을이용한 VRE 검출보다 2일이상이더소요되었다. 감시배양에서는한검체에두종이상의장구균이섞여있는경우도있었다. EA 선택배지에검은집락을형성하는장구균들은집락의형태감별만으로 2종이상의장구균이섞여있는지알수가없었고순수집락을분리하는데 2차계대배양이필요하였다. 대상균주중 3주는 2차계대배양에서도순수집락으로분리할수없어 2차계대배양의집락으로균동정과 MIC를측정하여 VanA형 E. gallinarum, VanA형 E. avium, VanC형 E. gallinarum으로판정하였다. 본검사법으로는이런경우에도 EA 선택배지에집락을형성한당일에정확하게유전자형의결정과균동정을할수있었다. VanA형 E. gallinarum은 vana E. faecium, vana E. faecalis, E. gallinarum가혼합된경우였고, VanA형 E. avium은 vana E. faecium과 vana E. faecalis가혼합된경우였으며 VanC형 E. gallinarum은 E. casseliflavus/e. flavescens와 E. gallinarum이혼합된경우였다. 대상균주중 4주는생화학적동정결과와분자생물학적동정결과가불일치하였다. E. faecium 1주, E. avium 1주, E. dur-

7 144 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim ans 2주는실시간-중합효소연쇄반응법으로각각 E. casseliflavus/e. flavescens, E. faecalis, vana형 E. faecium, E. faecalis로동정되었다. 상용화된생화학적동정키트만으로장구균을정확하게동정하는데한계가있는것같다. Angeletti 등 [35] 은임상검체에서분리한장구균 279주중에 26 주에서중합효소연쇄반응법과 16S 리보소옴 DNA의염기순서분석법을사용한분자생물학적동정결과와생화학적동정결과가불일치함을보고하였다. Leuconostoc spp, Aerococcus spp, Streptococcus bovis 등을장구균으로잘못동정하였거나장구균의종명에차이를보였다. 한편, glycopeptides 내성유전자형과표현형이일치하지않는 VRE 균주도검출되었다. VanB형 E. faecium 4주는 vana 유전자가검출되었다. 최근국내병원에서 vana 유전자를지닌 VanB형 E. faecium이높은비율로검출되고있는데임상적의미는아직명확하게밝혀지지않고있다 [36, 37]. 이런 VRE는생체내에서타이코프라닌에내성을보일가능성이있어병원검사실에서는내성유전자검사의실시가필요하다. 결론적으로저자들의융해곡선분석을이용한다중실시간-중합효소연쇄반응법은 EA 선택배지에서검은집락을형성한당일에유전자형의결정과균동정이가능할뿐만아니라여러 van 유전자를갖는경우나 2종이상의장구균이섞여있는경우에도정확하고신속하게검출할수있어 VRE 감시배양에유용할것이다. 요약배경 : 저자들은융해곡선 (melting curve) 분석을이용하여반코마이신내성장구균 (VRE) 의유전자형결정과임상에서흔히검출되는장구균의동정이동시에가능한다중실시간-중합효소연쇄반응법 (multiplex real-time PCR) 을개발하여그유용성을평가하였다. 방법 : 검사법의특이도는반코마이신내성장구균 4개표준균주와반코마이신에감수성이있는장구균 2개표준균주로평가하였고, 다양한항균제감수성양상을갖는임상검체에서분리된장구균 93 균주에대한내성유전자와균동정을실시하였다. 결과 : Enterococcus faecium, Enterococcus faecalis, vana형 E. faecium, vanb형 E. faecalis, Enterococcus gallinarum 및 Enterococcus casseliflavus의대표적인융해곡선을얻었다. 장구균 93주중 82 주는유전자형과표현형이모두일치하였다. 4주는 glycopeptides 내성양상이불일치하였고다른 4주는균동정에불일치를보였다. 그리고 3주에서는순수집락을분리할수없어 glycopeptides 내성양상과균동정 에불일치를보였다. 결론 : 융해곡선분석을이용한다중실시간-중합효소연쇄반응법으로 VRE 유전자검사와장구균동정검사를신속하고정확하게실시할수있었다. 참고문헌 1. Leclercq R, Derlot E, Duval J, Courvalin P. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med 1988;319: Willems RJ, Top J, van Santen M, Robinson DA, Coque TM, Baquero F, et al. Global spread of vancomycin-resistant Enterococcus faecium from distinct nosocomial genetic complex. Emerg Infect Dis 2005;11: Park JW, Kim YR, Shin WS, Kang MW, Han KJ, Shim SI. Susceptibility tests of vancomycin-resistant enterococci. Korean J Infect Dis 1992;24: ( 박지원, 김양리, 신완식, 강문원, 한경원, 심상인. Vancomycin 내성 enterococci에대한감수성검사. 감염 1992;24:133-7.) 4. Lee WG, Jung MK, Kwak YS. Vancomycin-resistant enterococci: incidence, antimicrobial susceptibility, and resistance genotypes. Korean J Clin Pathol 1998;18:51-6. ( 이위교, 정민권, 곽연식. Vancomycin 내성장구균의분리율, 항균제감수성및내성형에관한연구. 대한임상병리학회지 1998;18:51-6.) 5. Korean Society for Nosocomial Infection Control. Konis web-based reports & analysis program. icu.htm (Updated on Jun 2009). 6. Leven M. Molecular methods for the detection of antibacterial resistance genes. In: Lorian V, ed. Antibiotics in laboratory medicine. 5th ed. Philadelphia, PA: Lippincott Williams & Wilkins, 2005: Clark NC, Cooksey RC, Hill BC, Swenson JM, Tenover FC. Characterization of glycopeptide-resistant enterococci from U.S. hospitals. Antimicrob Agents Chemother 1993;37: Dutka-Malen S, Evers S, Courvalin P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol 1995;33: Satake S, Clark N, Rimland D, Nolte FS, Tenover FC. Detection of vancomycin-resistant enterococci in fecal samples by PCR. J Clin Microbiol 1997;35: Kariyama R, Mitsuhata R, Chow JW, Clewell DB, Kumon H. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant enterococci. J Clin Microbiol 2000;38:

8 Detection of VRE using Melting Curve Analysis Perez-Hernandez X, Mendez-Alvarez S, Claverie-Martin F. A PCR assay for rapid detection of vancomycin-resistant enterococci. Diagn Microbiol Infect Dis 2002;42: Palladino S, Kay ID, Costa AM, Lambert EJ, Flexman JP. Real-time PCR for the rapid detection of vana and vanb genes. Diagn Microbiol Infect Dis 2003;45: Palladino S, Kay ID, Flexman JP, Boehm I, Costa AM, Lambert EJ, et al. Rapid detection of vana and vanb genes directly from clinical specimens and enrichment broths by real-time multiplex PCR assay. J Clin Microbiol 2003;41: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: nineteenth informational supplement. Wayne, PA: Clinical and Laboratory Standards Institute, Rozen S and Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Misener S and Krawetz SA, eds. Bioinformatics methods and protocols. Totowa, NJ: Humana Press, 2000: Shipley GL. An introduction to real-time PCR. In: Dorak MT, ed. Real-time PCR. Abingdon, Oxfordshire: Taylor & Francis, 2006: Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem 1997;245: Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. Highresolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003;49: Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH. Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 1997;23: Markoulatos P, Siafakas N, Moncany M. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal 2002;16: Wittwer CT, Herrmann MG, Gundry CN, Elenitoba-Johnson KS. Real-time multiplex PCR assays. Methods 2001;25: Chang S, Sievert DM, Hageman JC, Boulton ML, Tenover FC, Downes FP, et al. Infection with vancomycin-resistant Staphylococcus aureus containing the vana resistance gene. N Engl J Med 2003;348: Boyd DA, Willey BM, Fawcett D, Gillani N, Mulvey MR. Molecular characterization of Enterococcus faecalis N with low-level vancomycin resistance harboring a novel D-Ala-D-Ser gene cluster, vanl. Antimicrob Agents Chemother 2008;52: Hong KS, Kang ES, Lee MA. Investigation of prevalence of vancomycin-resistant enterococci and genotypes of glycopeptide resistance using polymerase chain reaction. Korean J Clin Pathol 1998;18: ( 홍기숙, 강은숙, 이미애. Vancomycin 내성 Enterococci의빈도조사및중합효소연쇄반응을이용한유전자형의분석. 대한임상병리학회지 1998;18:372-8.) 25. Lee SY, Park JH, Park HS, Lee MA, Kang ES, Hong KS. Comparison of antimicrobial susceptibility testing methods to detect glycopeptide resistance in enterococci: E-test, Vitek, disk diffusion and agar dilution method. Korean J Clin Pathol 2000;20: ( 이수연, 박진희, 박향숙, 이미애, 강은숙, 홍기숙. Glycopeptide 내성장구균의항균제감수성검사법비교 : E-test, Vitek, 디스크확산법및한천희석법. 대한임상병리학회지 2000;20:301-7.) 26. Park JH, Lee SY, Lee MA, Chung WS. Investigation of risk factors for vancomycin-resistant enterococci (VRE) infection and colonization. Korean J Clin Pathol 2000;20: ( 박진희, 이수연, 이미애, 정화순. 반코마이신내성장구균장내군집및감염의위험인자분석. 대한임상병리학회지 2000;20: ) 27. Kwon OG, Uh Y, Jang IH, Lee MK, Yoon KJ, Kim HY. Trend of isolation and genotypes of vancomycin-resistant enterococci isolated from tertiary care hospital in Wonju area. Korean J Clin Pathol 2000; 20: ( 권오건, 어영, 장인호, 이미경, 윤갑준, 김효열. 원주지역 3차병원에서분리된 vancomycin 내성장구균의분리추이와내성유전자형. 대한임상병리학회지 2000;20: ) 28. Navarro F and Courvalin P. Analysis of genes encoding D-alanine- D-alanine ligase-related enzymes in Enterococcus casseliflavus and Enterococcus flavescens. Antimicrob Agents Chemother 1994;38: Paule SM, Trick WE, Tenover FC, Lankford M, Cunningham S, Stosor V, et al. Comparison of PCR assay to culture for surveillance detection of vancomycin-resistant enterococci. J Clin Microbiol 2003; 41: Sloan LM, Uhl JR, Vetter EA, Schleck CD, Harmsen WS, Manahan J, et al. Comparison of the Roche LightCycler vana/vanb detection assay and culture for detection of vancomycin-resistant enterococci from perianal swabs. J Clin Microbiol 2004;42: Stamper PD, Cai M, Lema C, Eskey K, Carroll KC. Comparison of the BD GeneOhm VanR assay to culture for identification of vancomycin-resistant enterococci in rectal and stool specimens. J Clin Microbiol 2007;45: Sahm DF, Free L, Smith C, Eveland M, Mundy LM. Rapid charac-

9 146 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim terization schemes for surveillance isolates of vancomycin-resistant enterococci. J Clin Microbiol 1997;35: Petrich A, Luinstra K, Page B, Callery S, Stevens D, Gafni A, et al. Effect of routine use of a multiplex PCR for detection of vana- and vanb- mediated enterococcal resistance on accuracy, costs and earlier reporting. Diagn Microbiol Infect Dis 2001;41: Drews SJ, Johnson G, Gharabaghi F, Roscoe M, Matlow A, Tellier R, et al. A 24-hour screening protocol for identification of vancomycin-resistant Enterococcus faecium. J Clin Microbiol 2006;44: Angeletti S, Lorino G, Gherardi G, Battistoni F, De Cesaris M, Dicuonzo G. Routine molecular identification of enterococci by genespecific PCR and 16S ribosomal DNA sequencing. J Clin Microbiol 2001;39: Song JH, Ko KS, Oh WS, Park S, Heo ST, Kwon KT, et al. High frequency of vancomycin-resistant Enterococcus faecium isolates with VanB phenotype and vana genotype in Korean hospitals. Diagn Microbiol Infect Dis 2006;56: Park IJ, Lee WG, Shin JH, Lee KW, Woo GJ. VanB phenotype-vana genotype Enterococcus faecium with heterogeneous expression of teicoplanin resistance. J Clin Microbiol 2008;46:

632 Korean J Lab Med 2010;30:631-6 있어서는장내집락화의유무를조기에검출하여사람간의전파방지및격리를해야한다. 그러므로대변에서의 VRE 선별검사는 VRE의조기검출을위한여러가지선별배지를이용하는것과최근에신속증균 PCR법을사용하는방법등이소개되고있다 [1,

632 Korean J Lab Med 2010;30:631-6 있어서는장내집락화의유무를조기에검출하여사람간의전파방지및격리를해야한다. 그러므로대변에서의 VRE 선별검사는 VRE의조기검출을위한여러가지선별배지를이용하는것과최근에신속증균 PCR법을사용하는방법등이소개되고있다 [1, Korean J Lab Med 2010;30:631-6 DOI 10.3343/kjlm.2010.30.6.631 Original Article Clinical Microbiology Evaluation of the Usefulness of Selective Chromogenic Agar Medium (ChromID VRE) and Multiplex PCR Method