Detection of VRE using Melting Curve Analysis 139 재료및방법 Table 1. Multiplex real-time PCR primers for the detection of vancomycin-resistant enterococci

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "Detection of VRE using Melting Curve Analysis 139 재료및방법 Table 1. Multiplex real-time PCR primers for the detection of vancomycin-resistant enterococci"

Transcription

1 Korean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Detection of Vancomycin-resistant Enterococci using Multiplex Real-time PCR Assay and Melting Curve Analysis Choong-Hwan Cha, M.D., Hae Kyong An, M.T., and Jeong Uk Kim, M.D. Department of Laboratory Medicine, Gangneung Asan Hospital, University of Ulsan College of Medicine, Gangneung, Korea Background : We developed and evaluated the utility of a multiplex real-time PCR assay that uses melting curve analysis and allows simultaneous identification of vancomycin-resistant genotypes and clinically relevant enterococci. Methods : The specificity of the assay was tested using 4 reference strains of vancomycin-resistant enterococci (VRE) and 2 reference strains of vancomycin-susceptible enterococci. Ninety-three clinical isolates of enterococci with different glycopeptide-resistant phenotypes were genotyped and identified using a multiplex real-time PCR assay and melting curve analysis. Results : Representative melting curves were obtained for Enterococcus faecium, Enterococcus faecalis, vana-containing E. faecium, vanb-containing E. faecalis, Enterococcus gallinarum, and Enterococcus casseliflavus. Phenotypic and genotypic analysis of the isolates revealed same results for 82 enterococcal isolates, while in 4 isolates, the glycopeptide-resistant phenotypes were inconsistent with the glycopeptide-resistant genotypes and in the 4 other isolates, species could not be accurately identified. Three isolates with mixed strains, which were detected by the PCR assay, could not be correctly identified using phenotypic methods. Conclusions : VRE genotyping and identification of clinically relevant enterococci were rapidly and correctly performed using multiplex real-time PCR assay and melting curve analysis. (Korean J Lab Med 2010;30:138-46) Key Words : Multiplex real-time PCR, Melting curve analysis, Vancomycin-resistant enterococci 서 반코마이신내성장구균 (vancomycin-resistant enterococci, VRE) 은 1987년유럽에서처음출현한이래세계적으로원내감염의중요한병원균이되었다 [1, 2]. 국내에서 1992년처음보고되었고 1990년대중반부터균주분리가급격히증가하였다 [3, 4]. 현재중환자실에서분리되는 Enterococcus faecium의 30-45% 에서반코마이신에내성을보인다 [5]. VRE에대한적절한감염관리가필요한상황이다. 신속하고정확한검출은 VRE의감염관리에매우중요하다. Received : October 17, 2009 Manuscript No : KJLM Revision received : February 21, 2010 Accepted : March 10, 2010 Corresponding author : Jeong Uk Kim, M.D. Department of Laboratory Medicine, Gangneung Asan Hospital, University of Ulsan College of Medicine, 415 Bangdong-ri, Sacheon-myeon, Gangneung , Korea Tel : , Fax : jukim@gnah.co.kr 론 VRE 선별고형배지에접종하거나선별액체배지에증균후고형배지에접종하는통상의검출방법은결과보고까지 2-5일이걸린다. VanB형과 VanC형 VRE는검출이어려운경우도있다 [6]. 이에중합효소연쇄반응법 (PCR) 과실시간-중합효소연쇄반응법 (real-time PCR) 등 glycopeptides 내성유전자검사법이 VRE 감시배양에사용되었다 [7-13]. 실시간-중합효소연쇄반응법은중합효소연쇄반응법보다 VRE를더빠르게검출하고업무량도적다 [12]. 반응시간이짧고실시간으로반응산물이모니터링되어전기영동이필요하지않기때문이다. 하지만염기서열에특이한소식자를사용하는경우시약비용이증가하는단점이있다. 본연구에서저자들은염기서열에특이한소식자를사용하지않고융해곡선 (melting curve) 분석을이용하여 VRE를검출하는다중실시간-중합효소연쇄반응법 (multiplex real-time PCR) 을개발하여유용성을평가하였다. 138

2 Detection of VRE using Melting Curve Analysis 139 재료및방법 Table 1. Multiplex real-time PCR primers for the detection of vancomycin-resistant enterococci 1. 대상균주 Amplified gene Primer sequences (5-3 ) Size of the PCR Product product (bp) Tm ( ) 본원진단검사의학과에의뢰된임상검체에서분리된 93주의장구균 (E. faecium 72주, Enterococcus faecalis 13주, Enterococcus avium 3주, Enterococcus durans 2주, Enterococcus gallinarum 2주, Enterococcus casseliflavus 1주 ) 을대상으로하였다. 표준균주로는 E. faecium ATCC (vana), E. faecalis ATCC (vanb), E. gallinarum ATCC (vanc1), E. casseliflavus ATCC (vanc2/ C3), E. faecalis ATCC 29212, E. faecium ATCC 19434를사용하였다. 2. 장구균의동정검사및항균제감수성검사대상균주는반코마이신 6 mg/ml를첨가하여자가제조한 Enterococcosel agar (EA) (Becton Dickinson, Sparks, MD, USA) 와반코마이신을첨가하지않은 EA에서선별되었다. 배양 1일과 2일째검은색으로변한집락을혈액한천배지에계대배양하여균동정과항균제감수성검사를시행하였다. 균동정은 MicroScan (Dade Behring, West Sacramento, CA, USA) 과 API 20 STREP (biomerieux, Hazelwood, MO, USA) 을사용하였으며, 반코마이신과타이코프라닌의최소억제농도 (minimum inhibitory concentration, MIC) 는 E-test (AB Biodisk, Solna, Sweden) 로측정하였다. 항균제별 MIC의해석은 CLSI의기준 [14] 을따랐다. 3. DNA 추출중탕가열 (boiling) 법으로 DNA를추출하였다. EA에서자란검은색집락적당량을면봉에묻혀증류수 0.5 ml가들어있는 1.5 ml microtube에풀고 10 분동안끓은물에중탕시켰다. 13,000 rpm으로 3분간원심분리한후상청액을사용하였다. 상청액의 DNA 농도는 ng/ml 가되도록멸균증류수로조절하였다. 4. 다중실시간-중합효소연쇄반응법네종류의 glycopeptide 내성유전자 (vana, vanb, vanc1, vanc2/c3) 와 E. faecalis와 E. faecium 균종에특이한 D- vana TATTGACTTCGTTCAGTACA ±0.3 TGTGGATATGTTTTTACAAG vanb CAGACCCTGTATCGCACCAT ±0.3 AACGGCGTATGGAAGCTATG vanc1 TGCTTGTGATGCGATTTCTC ±0.4 ATCGCTCCTTGATTGGTGAC vanc2/c3 GGGAAGATGGCAGTATCCAA ±0.3 GCAGCAGCCATTTGTTCATA ddl E. faecalis GTGGCTTAAGTCGCTGTGAT ±0.3 AGGCATGGTGTTCAATTCAT ddl E. faecium TTTACAAGCTGCTGGTGTGC ±0.3 AACCCATATTCGCAGGTTTG Abbreviations: Tm, melting temperature; ddl, gene encoding D-alanine- D-alanine ligase; E. faecalis, Enterococcus faecalis; E. faecium, Enterococcus faecium. alanine-d-alanine ligase 유전자 (ddl) 를검출부위로하는시발체를 Primer3 프로그램을이용하여설계하였다 [15]. 각시발체의염기서열, 반응산물의크기, 온도 (Tm) 는 Table 1과같다. Type-it HRM PCR 키트 (QIAGEN Inc., Germantown, MD, USA) 를사용하여실시간-중합효소연쇄반응을실시하였다. 5 ml의 2 HRM PCR Master Mix, 0.8 ml의시발체혼합액 (E. faecalis 시발체, 0.6 mm; E. faecium 시발체, 0.3 mm; vana 시발체, 0.8 mm; vanb 시발체, 0.2 mm; vanc1 시발체, 0.2 mm; vanc2/c3 시발체, 0.2 mm), 3.2 ml의증류수에 1 ml 의DNA를넣어반응액 10 ml를제조하여중합효소연쇄반응을실시하였다. 중합효소연쇄반응은 Rotor-gene 6000 (QIAGEN Inc., Germantown, MD, USA) 를이용하였다. 95 에서 5분반응후 95 에서 10초, 53 에서 30초, 63 에서 20초의반응을 40 회반복하였다. 마지막 PCR 반응이끝난후 65 에서 89 까지초당 0.2 의속도로온도를증가시키면서융해곡선을모니터링하였다. 결 저자들은융해곡선을분석하여네종류의 glycopeptide 내성유전자의검출과 E. faecalis와 E. faecium의동정이가능한다중실시간-중합효소연쇄반응법을개발하였다. ATCC 표준균주들의융해곡선은 Fig. 1과같다. 융해곡선분석이용이하도록반응산물간에 Tm 차이가나도록시발체를설계하였다. 가능한2 이상차이가나도록제작하였지만 vanb와 vanc1 반응 과

3 140 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim A 0.0 B C D E 0 F Fig. 1. Melting curve analysis of amplicons obtained from reference strains by using multiplex real-time PCR. Melting curves for Enterococcus faecium (A); Enterococcus faecalis (B); E. faecium/vana (C); E. faecalis/vanb (D); Enterococcus gallinarum/vanc1 (E); and Enterococcus casseliflavus/vanc2/c3 (F) are shown. 산물간에는 0.5 밖에차이가나지않았다. 시발체에따른반응정도차이는시발체의농도, 불림 (annealing) 및확대 (extension) 온도와유지시간을조절하여 6가지검출부위모두반응이잘일어날수있도록조건을최적화하였다. 임상검체에서분리된장구균 93주의항균제감수성결과에따라대상균주들의내성표현형은다음과같았다. E. faecium 65주, E. faecalis 5주, E. avium 2주, E. durans 1주및 E. gallinarum 1주는 VanA형 ( 반코마이신 MIC, 256 mg/ml; 타이코프라닌 MIC, mg/ml) 이었고 E. faecium 4 주는 VanB형 ( 반코마이신 MIC, mg/ml; 타이코프라닌 MIC, 8-12 mg/ml) 이었으며 E. gallinarum 1주와 E. casseliflavus 1주는 VanC형 ( 반코마이신 MIC, 6-12 mg/ml; 타이코프라닌 MIC, 2 mg/ml) 이었다. 그리고 E. faecium 3주, E. faecalis 8주, E. avium 1주및 E. durans 1주는감수성 ( 반코마이신 MIC, mg/ml; 타이코프라닌 MIC, mg/ml) 을보였다.

4 Detection of VRE using Melting Curve Analysis 141 Table 2. Genotype analysis of 93 enterococcal isolates with different glycopeptides-resistant phenotypes by using multiplex real-time PCR and melting curve analysis Species Resistant phenotype No. of strains Results obtained by multiple real-time PCR ddl E. faecium ddl E. faecalis vana vanb vanc1 vanc2/c3 E. faecium VanA VanB Susceptible E. faecalis VanA Susceptible E. gallinarum VanA VanC E. casseliflavus VanC E. avium VanA Susceptible E. durans VanA Susceptible Abbreviations: ddl, gene encoding D-alanine-D-alanine ligase; E. faecium, Enterococcus faecium; E. faecalis, Enterococcus faecalis; E. gallinarum, Enterococcus gallinarum; E. casseliflavus, Enterococcus casseliflavus; E. avium, Enterococcus avium; E. durans, Enterococcus durans A 0.25 B C Fig. 2. Melting curve analysis for the identification of mixed strains. (A) Melting curve for DNA extracted from black colonies growing on the Enterococcal agar plate. VanA, ddl Enterococcus faecalis, and ddl Enterococcus faecium peaks are shown. (B) Melting curve for DNA extracted from pure colonies of E. faecium with phenotype VanA growing on the blood agar plate. Peaks for E. faecium with VanA and ddl genes. (C) Melting curve for DNA extracted from pure colonies of E. faecalis with phenotype VanA growing on the blood agar plate. Peaks for E. faecalis with VanA and ddl genes. 균종별유전자형분석결과는다음과같았다 (Table 2). VanA 형 E. faecium 65주와 VanB형 E. faecium 4주는모두 vana 유전자형의 E. faecium으로분석하였다. Glycopeptides에감수성을보인 E. faecium 3주중 2주는 E. faecium으로동정되었으나한균주에서는 vanc2/c3 (E. casseliflavus/e. flavescens) 유전자가검출되어생화학적동정과불일치하였다. VanA형 E. faecalis 5주는모두 vana 유전자형의 E. faecalis 로분석하였고감수성을보인 E. faecalis 8주는 E. faecalis의 ddl 유전자만검출되어생화학적동정과일치하였다. VanA형 E. avium 1주는 vana 유전자만검출되었고 VanC형 E. casseliflavus 1주는 vanc2/c3 유전자가검출되어생화학적동정과일치하였다. VanA형 E. durans 1주는 vana 유전자형의 E. faecium으로동정되고감수성을보인 E. avium 1주와 E. durans 1주는모두 E. faecalis로동정되어생화학적동정결과

5 142 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim A B C Fig. 3. Melting curve analysis of amplicons obtained from 3 mixed strains of 2 or more enterococci by using multiplex real-time PCR. Melting curves for Enterococcus faecalis and Enterococcus faecium with vana gene (A); E. faecalis and E. faecium with vana gene and Enterococcus gallinarum with vanc1 gene (B); and Enterococcus casseliflavus/enterococcus flavescens with vanc2/c3 gene and E. gallinarum with vanc1 gene (C). 와일치하지않았다. 한편, 한검체에 2종이상의장구균이섞여있는경우도있었다. 장구균 93주중 VanA형 E. faecium 1주와 VanA형 E. faecalis 1주는한검체에서분리된균주로 EA 선택배지에서자란집락에서 vana E. faecium과 vana E. faecalis가검출되었고혈액한천배지에계대배양했을때두종류의순수집락으로구분되어분리되었다 (Fig. 2). 그러나 VanA형 E. avium 1주, VanA형 E. gallinarum 1주및 VanC형 E. gallinarum 1 주는 2종이상의균주가혼합된것처럼 VanA형 E. avium 1주는 vana 유전자와 E. faecium과 E. faecalis의 ddl 유전자가동시에검출되었으며 VanA형 E. gallinarum 1주는 vanc1 유전자및 vana 유전자와 E. faecium과 E. faecalis의 ddl 유전자가동시에검출되었고 VanC형 E. gallinarum 1주는 vanc1 유전자와 vanc2/c3 유전자가함께검출되었으나 EA 선택배지에자란집락을계대배양하였을때순수집락으로분리할수없었다 (Fig. 3). 고찰최근국내에실시간-중합효소연쇄반응장비를도입하는검 사실이증가하는추세이다. 실시간-중합효소연쇄반응장비는고가의기기이지만중합효소연쇄반응보다더민감하고특이적인검사법의개발이가능하다. 염기서열에특이한소식자를사용하고융해곡선분석으로특이도가높다 [16]. 융해곡선분석은 1997년처음소개되었다. 융해는두가닥 DNA가가온되면한가닥 DNA로분리되는현상을말한다. 두가닥 DNA에비특이적으로결합하는형광색소 (fluorescent dye) 인 SYBR Green 을사용하여융해과정이실시간으로측정된다. 반응산물의염기서열, 크기및 GC 비율에따라특징적인융해곡선을보여전기영동없이도융해곡선분석만으로반응산물을확인할수있었다 [17]. 널리사용되는 SYBR Green은고농도에서중합효소연쇄반응을저하시키고융해과정에서형광색소의재분포가일어나유전자형결정 (genotyping) 까지가능한고해상융해곡선 (high-resolution melting curve) 분석에는적합하지않았다. 최근개발된 SYTO 9, EvaGreen, LCGreen 등의형광색소는이러한단점이개선되어고해상융해곡선분석에사용되고있다 [16, 18]. 본연구에사용된 Type-it HRM PCR 키트의 master mix에는 EvaGreen이들어있다. 다중중합효소연쇄반응법은두쌍이상의시발체를사용하여두가지이상의검출부위를동시에검출할수있게고안된중합

6 Detection of VRE using Melting Curve Analysis 143 효소연쇄반응법이다. 일회반응으로여러대상을검출할수있어검사시간과시약비용을줄일수있다. 실시간-중합효소연쇄반응장비에서도소식자의형광색상과반응산물의 Tm 차이를이용하여다중검사가가능하다 [19-21]. 융해곡선분석을이용하는다중실시간-중합효소연쇄반응법은다중중합효소연쇄반응법과달리반응산물의크기보다반응산물의 Tm에차이가나도록시발체를설계한다. 다중반응은 dntp, Taq polymerase 등반응시약들의농도가한정된조건하에놓이게되어시발체간에경합반응이일어난다. 상대적으로약한반응이일어나는시발체는단일반응때보다민감도가저하될가능성이있다. Satake 등 [9] 은다중중합효소연쇄반응으로 VRE 유전자를검출하는경우단일반응때보다검출률이저하되는것을보고하였다. 저자들은 EA 선택배지에자란집락에서 DNA를추출하도록고안하였기에주형 DNA의농도를민감도이상으로유지할수있어다중반응에서민감도가저하되는문제는유의하지않다고추정하였다. 본검사법은 DNA를추출할때증류수 50 ml 를사용하면 EA 선별배지에자란집락한개로내성유전자형결정과균동정이가능하였다. 과량의주형 DNA를사용하면융해곡선이오른쪽으로이동되며 Tm 차이가적은 vanb와 vanc1 반응산물간의구분이어렵게되었다. 그래서중합효소연쇄반응에사용되는주형DNA 농도를 ng으로조정하여반응산물이검출되지않거나 Tm값이증가되는현상이일어나지않도록하였다. 신속하고정확한 VRE의검출은적절한감염관리를시행하여전파를차단하는데매우중요하다 [13]. 더욱이 vana 유전자를가진반코마이신내성 Staphylococcus aureus의출현으로 VRE 감염관리의중요성이강조되고있다 [22]. 중합효소연쇄반응법으로 VRE 유전자를검출하는방법은가장특이도가높은검사법이고저도내성을갖는 VRE 검출에도유용하다 [6]. 실시간-중합효소연쇄반응기기의등장으로중합효소연쇄반응보다신속하게내성유전자의검출이가능하게되었다 [12]. 지금까지여러방식의내성유전자검출법이보고되었으나 [7-13], 융해곡선분석을이용한방법은없었다. 이에저자들은염기서열에특이한소식자를사용하지않고융해곡선분석을이용하여 van 유전자의검출과장구균의동정이동시에가능한다중실시간- 중합효소연쇄반응법을개발하게되었다. VRE는 7종류 (VanA, VanB, VanC, VanD, VanE, VanG, VanL) 의표현형이있으며해당유전자형에의해발현된다 [6, 23]. 주로 VanA, VanB, VanC형이임상검체에서검출되며균종으로는 E. faecium과 E. faecalis가대부분을차지하고있다 [4, 24-27]. vana와 vanb 유전자와달리 vanc 유전자는내인성의균종특이성이 있으며유전자형의결정만으로균동정이가능하다. vanc1은 E. gallinarum, vanc2는 E. casseliflavus, vanc3는 E. flavescens에특이적이지만 vanc2와 vanc3 유전자는염기서열이 98.3% 가동일하여중합효소연쇄반응으로구분하기어렵다 [28]. 저자들은임상검체에서주로검출되는 VanA, VanB, VanC 형의 VRE가갖고있는 vana, vanb, vanc1, vanc2/c3 유전자를검출하고 E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/e. flavescens의동정이가능하도록시발체를설계하였다. 유용성평가에사용된장구균 93주는 2000년 2월이후강릉아산병원진단검사의학과에서분리되어 -70 에보관된균주들과 2009년 5월과 6월두달동안반코마이신 6 mg/ml가첨가된 EA 선택배지에의뢰된대변및직장주변도말검체를배양하여분리한균주였다. 신속하게 VRE를검출하는방법으로대변이나직장주변도말검체에서직접 DNA를추출하거나 [9, 13, 29-31], 선택배지로장구균을선별하는방법들이연구되었다 [32-34]. 검체에서직접 DNA를추출하는방법은억제제로인하여 VRE 검출률이저하된다 [9, 13, 34]. 이에저자들은 6 mg/ml 가첨가된 EA 선택배지로장구균을선별하여중탕가열법으로 DNA를추출하는방법을사용하였다. 이방법으로중합효소연쇄반응의저하없이 EA 선별배지에검은색집락을형성한당일에내성유전자형결정과동정이가능하였다. 생화학적균동정과 MIC의측정은 EA 선별배지에자란검은집락을혈액한천배지에계대배양하여실시하였으므로실시간-중합효소연쇄반응법을이용한 VRE 검출보다 2일이상이더소요되었다. 감시배양에서는한검체에두종이상의장구균이섞여있는경우도있었다. EA 선택배지에검은집락을형성하는장구균들은집락의형태감별만으로 2종이상의장구균이섞여있는지알수가없었고순수집락을분리하는데 2차계대배양이필요하였다. 대상균주중 3주는 2차계대배양에서도순수집락으로분리할수없어 2차계대배양의집락으로균동정과 MIC를측정하여 VanA형 E. gallinarum, VanA형 E. avium, VanC형 E. gallinarum으로판정하였다. 본검사법으로는이런경우에도 EA 선택배지에집락을형성한당일에정확하게유전자형의결정과균동정을할수있었다. VanA형 E. gallinarum은 vana E. faecium, vana E. faecalis, E. gallinarum가혼합된경우였고, VanA형 E. avium은 vana E. faecium과 vana E. faecalis가혼합된경우였으며 VanC형 E. gallinarum은 E. casseliflavus/e. flavescens와 E. gallinarum이혼합된경우였다. 대상균주중 4주는생화학적동정결과와분자생물학적동정결과가불일치하였다. E. faecium 1주, E. avium 1주, E. dur-

7 144 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim ans 2주는실시간-중합효소연쇄반응법으로각각 E. casseliflavus/e. flavescens, E. faecalis, vana형 E. faecium, E. faecalis로동정되었다. 상용화된생화학적동정키트만으로장구균을정확하게동정하는데한계가있는것같다. Angeletti 등 [35] 은임상검체에서분리한장구균 279주중에 26 주에서중합효소연쇄반응법과 16S 리보소옴 DNA의염기순서분석법을사용한분자생물학적동정결과와생화학적동정결과가불일치함을보고하였다. Leuconostoc spp, Aerococcus spp, Streptococcus bovis 등을장구균으로잘못동정하였거나장구균의종명에차이를보였다. 한편, glycopeptides 내성유전자형과표현형이일치하지않는 VRE 균주도검출되었다. VanB형 E. faecium 4주는 vana 유전자가검출되었다. 최근국내병원에서 vana 유전자를지닌 VanB형 E. faecium이높은비율로검출되고있는데임상적의미는아직명확하게밝혀지지않고있다 [36, 37]. 이런 VRE는생체내에서타이코프라닌에내성을보일가능성이있어병원검사실에서는내성유전자검사의실시가필요하다. 결론적으로저자들의융해곡선분석을이용한다중실시간-중합효소연쇄반응법은 EA 선택배지에서검은집락을형성한당일에유전자형의결정과균동정이가능할뿐만아니라여러 van 유전자를갖는경우나 2종이상의장구균이섞여있는경우에도정확하고신속하게검출할수있어 VRE 감시배양에유용할것이다. 요약배경 : 저자들은융해곡선 (melting curve) 분석을이용하여반코마이신내성장구균 (VRE) 의유전자형결정과임상에서흔히검출되는장구균의동정이동시에가능한다중실시간-중합효소연쇄반응법 (multiplex real-time PCR) 을개발하여그유용성을평가하였다. 방법 : 검사법의특이도는반코마이신내성장구균 4개표준균주와반코마이신에감수성이있는장구균 2개표준균주로평가하였고, 다양한항균제감수성양상을갖는임상검체에서분리된장구균 93 균주에대한내성유전자와균동정을실시하였다. 결과 : Enterococcus faecium, Enterococcus faecalis, vana형 E. faecium, vanb형 E. faecalis, Enterococcus gallinarum 및 Enterococcus casseliflavus의대표적인융해곡선을얻었다. 장구균 93주중 82 주는유전자형과표현형이모두일치하였다. 4주는 glycopeptides 내성양상이불일치하였고다른 4주는균동정에불일치를보였다. 그리고 3주에서는순수집락을분리할수없어 glycopeptides 내성양상과균동정 에불일치를보였다. 결론 : 융해곡선분석을이용한다중실시간-중합효소연쇄반응법으로 VRE 유전자검사와장구균동정검사를신속하고정확하게실시할수있었다. 참고문헌 1. Leclercq R, Derlot E, Duval J, Courvalin P. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med 1988;319: Willems RJ, Top J, van Santen M, Robinson DA, Coque TM, Baquero F, et al. Global spread of vancomycin-resistant Enterococcus faecium from distinct nosocomial genetic complex. Emerg Infect Dis 2005;11: Park JW, Kim YR, Shin WS, Kang MW, Han KJ, Shim SI. Susceptibility tests of vancomycin-resistant enterococci. Korean J Infect Dis 1992;24: ( 박지원, 김양리, 신완식, 강문원, 한경원, 심상인. Vancomycin 내성 enterococci에대한감수성검사. 감염 1992;24:133-7.) 4. Lee WG, Jung MK, Kwak YS. Vancomycin-resistant enterococci: incidence, antimicrobial susceptibility, and resistance genotypes. Korean J Clin Pathol 1998;18:51-6. ( 이위교, 정민권, 곽연식. Vancomycin 내성장구균의분리율, 항균제감수성및내성형에관한연구. 대한임상병리학회지 1998;18:51-6.) 5. Korean Society for Nosocomial Infection Control. Konis web-based reports & analysis program. icu.htm (Updated on Jun 2009). 6. Leven M. Molecular methods for the detection of antibacterial resistance genes. In: Lorian V, ed. Antibiotics in laboratory medicine. 5th ed. Philadelphia, PA: Lippincott Williams & Wilkins, 2005: Clark NC, Cooksey RC, Hill BC, Swenson JM, Tenover FC. Characterization of glycopeptide-resistant enterococci from U.S. hospitals. Antimicrob Agents Chemother 1993;37: Dutka-Malen S, Evers S, Courvalin P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol 1995;33: Satake S, Clark N, Rimland D, Nolte FS, Tenover FC. Detection of vancomycin-resistant enterococci in fecal samples by PCR. J Clin Microbiol 1997;35: Kariyama R, Mitsuhata R, Chow JW, Clewell DB, Kumon H. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant enterococci. J Clin Microbiol 2000;38:

8 Detection of VRE using Melting Curve Analysis Perez-Hernandez X, Mendez-Alvarez S, Claverie-Martin F. A PCR assay for rapid detection of vancomycin-resistant enterococci. Diagn Microbiol Infect Dis 2002;42: Palladino S, Kay ID, Costa AM, Lambert EJ, Flexman JP. Real-time PCR for the rapid detection of vana and vanb genes. Diagn Microbiol Infect Dis 2003;45: Palladino S, Kay ID, Flexman JP, Boehm I, Costa AM, Lambert EJ, et al. Rapid detection of vana and vanb genes directly from clinical specimens and enrichment broths by real-time multiplex PCR assay. J Clin Microbiol 2003;41: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: nineteenth informational supplement. Wayne, PA: Clinical and Laboratory Standards Institute, Rozen S and Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Misener S and Krawetz SA, eds. Bioinformatics methods and protocols. Totowa, NJ: Humana Press, 2000: Shipley GL. An introduction to real-time PCR. In: Dorak MT, ed. Real-time PCR. Abingdon, Oxfordshire: Taylor & Francis, 2006: Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem 1997;245: Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. Highresolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003;49: Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH. Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 1997;23: Markoulatos P, Siafakas N, Moncany M. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal 2002;16: Wittwer CT, Herrmann MG, Gundry CN, Elenitoba-Johnson KS. Real-time multiplex PCR assays. Methods 2001;25: Chang S, Sievert DM, Hageman JC, Boulton ML, Tenover FC, Downes FP, et al. Infection with vancomycin-resistant Staphylococcus aureus containing the vana resistance gene. N Engl J Med 2003;348: Boyd DA, Willey BM, Fawcett D, Gillani N, Mulvey MR. Molecular characterization of Enterococcus faecalis N with low-level vancomycin resistance harboring a novel D-Ala-D-Ser gene cluster, vanl. Antimicrob Agents Chemother 2008;52: Hong KS, Kang ES, Lee MA. Investigation of prevalence of vancomycin-resistant enterococci and genotypes of glycopeptide resistance using polymerase chain reaction. Korean J Clin Pathol 1998;18: ( 홍기숙, 강은숙, 이미애. Vancomycin 내성 Enterococci의빈도조사및중합효소연쇄반응을이용한유전자형의분석. 대한임상병리학회지 1998;18:372-8.) 25. Lee SY, Park JH, Park HS, Lee MA, Kang ES, Hong KS. Comparison of antimicrobial susceptibility testing methods to detect glycopeptide resistance in enterococci: E-test, Vitek, disk diffusion and agar dilution method. Korean J Clin Pathol 2000;20: ( 이수연, 박진희, 박향숙, 이미애, 강은숙, 홍기숙. Glycopeptide 내성장구균의항균제감수성검사법비교 : E-test, Vitek, 디스크확산법및한천희석법. 대한임상병리학회지 2000;20:301-7.) 26. Park JH, Lee SY, Lee MA, Chung WS. Investigation of risk factors for vancomycin-resistant enterococci (VRE) infection and colonization. Korean J Clin Pathol 2000;20: ( 박진희, 이수연, 이미애, 정화순. 반코마이신내성장구균장내군집및감염의위험인자분석. 대한임상병리학회지 2000;20: ) 27. Kwon OG, Uh Y, Jang IH, Lee MK, Yoon KJ, Kim HY. Trend of isolation and genotypes of vancomycin-resistant enterococci isolated from tertiary care hospital in Wonju area. Korean J Clin Pathol 2000; 20: ( 권오건, 어영, 장인호, 이미경, 윤갑준, 김효열. 원주지역 3차병원에서분리된 vancomycin 내성장구균의분리추이와내성유전자형. 대한임상병리학회지 2000;20: ) 28. Navarro F and Courvalin P. Analysis of genes encoding D-alanine- D-alanine ligase-related enzymes in Enterococcus casseliflavus and Enterococcus flavescens. Antimicrob Agents Chemother 1994;38: Paule SM, Trick WE, Tenover FC, Lankford M, Cunningham S, Stosor V, et al. Comparison of PCR assay to culture for surveillance detection of vancomycin-resistant enterococci. J Clin Microbiol 2003; 41: Sloan LM, Uhl JR, Vetter EA, Schleck CD, Harmsen WS, Manahan J, et al. Comparison of the Roche LightCycler vana/vanb detection assay and culture for detection of vancomycin-resistant enterococci from perianal swabs. J Clin Microbiol 2004;42: Stamper PD, Cai M, Lema C, Eskey K, Carroll KC. Comparison of the BD GeneOhm VanR assay to culture for identification of vancomycin-resistant enterococci in rectal and stool specimens. J Clin Microbiol 2007;45: Sahm DF, Free L, Smith C, Eveland M, Mundy LM. Rapid charac-

9 146 Choong-Hwan Cha, Hae Kyong An, and Jeong Uk Kim terization schemes for surveillance isolates of vancomycin-resistant enterococci. J Clin Microbiol 1997;35: Petrich A, Luinstra K, Page B, Callery S, Stevens D, Gafni A, et al. Effect of routine use of a multiplex PCR for detection of vana- and vanb- mediated enterococcal resistance on accuracy, costs and earlier reporting. Diagn Microbiol Infect Dis 2001;41: Drews SJ, Johnson G, Gharabaghi F, Roscoe M, Matlow A, Tellier R, et al. A 24-hour screening protocol for identification of vancomycin-resistant Enterococcus faecium. J Clin Microbiol 2006;44: Angeletti S, Lorino G, Gherardi G, Battistoni F, De Cesaris M, Dicuonzo G. Routine molecular identification of enterococci by genespecific PCR and 16S ribosomal DNA sequencing. J Clin Microbiol 2001;39: Song JH, Ko KS, Oh WS, Park S, Heo ST, Kwon KT, et al. High frequency of vancomycin-resistant Enterococcus faecium isolates with VanB phenotype and vana genotype in Korean hospitals. Diagn Microbiol Infect Dis 2006;56: Park IJ, Lee WG, Shin JH, Lee KW, Woo GJ. VanB phenotype-vana genotype Enterococcus faecium with heterogeneous expression of teicoplanin resistance. J Clin Microbiol 2008;46:

대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈

대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈 대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈 6 박연준 7 최태열 8 어영 9 신종희 10 이종욱 11 안지영 12 이성희 13 우건조

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

2003_17_어영.hwp

2003_17_어영.hwp 임상병리와정도관리 : 제 25 권제 2 호 2003 J. Lab. Med. & Quality Assuarance 2003:25:215-221 215 Microplate 를이용한장구균동정법 어영 황규열 장인호 윤갑준 이경원 * 이형환 ** 연세대학교원주의과대학진단검사의학과, 연세대학교의과대학진단검사의학과 *, 건국대학교생명과학과 ** Identification

More information

증례토론 Lab Med Online Vol. 3, No. 4: , October 임상미생물학 대변감시배양에서 vanb PCR 양성이지만 vanb 형반코마이신내성장구균배양음

증례토론 Lab Med Online Vol. 3, No. 4: , October 임상미생물학 대변감시배양에서 vanb PCR 양성이지만 vanb 형반코마이신내성장구균배양음 증례토론 Lab Med Online Vol. 3, No. 4: 264-268, October 2013 임상미생물학 대변감시배양에서 PCR 양성이지만 형반코마이신내성장구균배양음성인증례 Occurrence of a PCR-Positive but Culture-Negative Case for Vancomycin-Resistant Enterococci in Stool

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제 1 장제 23 장 장알균감염증 장알균 (Enterococcus) 은위장관과비뇨생식계에상재하는통성혐기성그람양성알균으로비교적독성이약하여정상인에서는질병을일으키지않으나노인이나면역저하환자, 만성기저질환자또는병원에입원중인환자에서요로감염, 창상감염, 균혈증등의각종기회감염증을유발한다. 또한장알균은페니실린과세파로스포린계등여러항균제에다제내성을나타내고, 최근 glycopeptide계인반코마이신내성장알균

More information

대한임상병리학회지 : 제 19 권제 1 호 1999 Korean J Clin Pathol 1999; 19: 임상미생물학 장구균의간략동정법개발 어영 장인호 윤갑준 연세대학교원주의과대학임상병리과학교실 Development of Simple Identificati

대한임상병리학회지 : 제 19 권제 1 호 1999 Korean J Clin Pathol 1999; 19: 임상미생물학 장구균의간략동정법개발 어영 장인호 윤갑준 연세대학교원주의과대학임상병리과학교실 Development of Simple Identificati 대한임상병리학회지 : 제 19 권제 1 호 1999 Korean J Clin Pathol 1999; 19: 57-61 임상미생물학 장구균의간략동정법개발 어영 장인호 윤갑준 연세대학교원주의과대학임상병리과학교실 Development of Simple Identification Method of Enterococci Young Uh, M.D., In Ho Jang,

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

3 황금록 성흥섭 남궁승외 2 인 입원환자사이에서 VRE의보균율이급격히증가하여병원감염의중요한원인균이되었다 [2, 3]. 1993년 VRE에의한요로감염환자의소변에서 vancomycin 의존성 Enterococcus faecalis가최초로분리됨으로써 [4], 세균이항균제에

3 황금록 성흥섭 남궁승외 2 인 입원환자사이에서 VRE의보균율이급격히증가하여병원감염의중요한원인균이되었다 [2, 3]. 1993년 VRE에의한요로감염환자의소변에서 vancomycin 의존성 Enterococcus faecalis가최초로분리됨으로써 [4], 세균이항균제에 대한진단검사의학회지제 29 권제 4 호 29 Korean J Lab Med 29;29:299-36 DOI 1.3343/kjlm.29.29.4.299 Original Article Clinical Microbiology Vancomycin 의존성장구균의미생물학적특성과역학적특성 황금록 성흥섭 남궁승 윤남섭 김미나 울산의대서울아산병원진단검사의학과 Microbiological

More information

fm

fm pissn 1229-1153 J. Fd Hyg. Safety Vol. 29, No. 3, pp. 228~233 (2014) http://dx.doi.org/10.13103/jfhs.2014.29.3.228 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 축산물과수산물에서분리된장구균의항생제감수성및유전형분석

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Resistance Mechanism and Epidemiology of Vancomycin-resistant Enterococci Wee Gyo Lee Department of Laboratory Medicine, Ajou University School of

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

Evaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated

Evaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated 대한진단검사의학회지제 29 권제 3 호 2009 Korean J Lab Med 2009;29:212-7 DOI 10.3343/kjlm.2009.29.3.212 Original Article Clinical Microbiology 폐렴알균의항균제감수성검사를위한 Phoenix System 의평가 이교관 1 류남희 2 김성태 1 채석래 1 허희진 1 동국대학교일산병원진단검사의학과

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

<3037C1D6BCBCC0CD2E687770>

<3037C1D6BCBCC0CD2E687770> 대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

대한임상검사과학회지 39(1 ):7-18, 2007 최근 Bergey s mannual(200 1 ) 에의하면 Phylum B Xill Firumicutes phy. nov. Class ill. Bacilli, Order IILactobacillales Family N

대한임상검사과학회지 39(1 ):7-18, 2007 최근 Bergey s mannual(200 1 ) 에의하면 Phylum B Xill Firumicutes phy. nov. Class ill. Bacilli, Order IILactobacillales Family N 대한임상검사학회지 : 39 권제 1 호, 7-18, 2007 ISSN 1738-3544 엄상검체에서장구균의분리빈도와항균제감수성 신현성임상병리연구실 l, 충남대학병원진단검사의학과 2, 서울대학교재료공학과 3 신현성 1. 박연보 2 신두식 3 Isolation Frequency and Antimicrobial Susceptibility of Enterococcus

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

( ).fm

( ).fm Korean J. Food Sci. An. Vol. 33, No. 1, pp. 133~138(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.1.133 ARTICLE 시판축산물및수산물에서 Enterococcus faecalis 와 Enterococcus faecium 분포및항생제감수성에관한연구 성창현 천정환 곽효선 1

More information

Microsoft PowerPoint - 4.조지현 [호환 모드]

Microsoft PowerPoint - 4.조지현 [호환 모드] 감염관리를위한진단검사 다제내성균감시검사 (MULTIDRUG RESISTANT ORGANISMS) 조지현원광의대진단검사의학과 다제내성균감시검사 1. MDRO 정의 (multidrug resistant organisms) 2. MDRO 중요성과국내 MDRO 현황 3. MDRO 검사 (screen, confirm) 1) MRSA, VRSA/VISA, CNS 2)

More information

<30372EC0CCC0AFC1F82E687770>

<30372EC0CCC0AFC1F82E687770> 산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

Viridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과

Viridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과 대한진단검사의학회지 : 제 23 권제 4 호 2003 Korean J Lab Med 2003; 23: 246-50 임상미생물학 Viridans Streptococci 균혈증의임상적의의 조은해 이남용 성균관대학교의과대학삼성서울병원진단검사의학교실 Clinical Significance of Viridans Streptococcal Bacteremia Eun Hae

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

임상병리검사과학회지 : 제 29 권제 l 호 Vancomycin 내성및감수성 Enterococcus 훨 ecalis 에대한 여러항균제의시험관내항균력 원광보건전문대학임상병리과원광대학병원임상병리과 * 순천대학교대학원생물학과 연세대학교의과대학임상병리과 검신무 정수

임상병리검사과학회지 : 제 29 권제 l 호 Vancomycin 내성및감수성 Enterococcus 훨 ecalis 에대한 여러항균제의시험관내항균력 원광보건전문대학임상병리과원광대학병원임상병리과 * 순천대학교대학원생물학과 연세대학교의과대학임상병리과 검신무 정수 임상병리검사과학회지 : 제 29 권제 l 호 1997. Vancomycin 내성및감수성 Enterococcus 훨 ecalis 에대한 여러항균제의시험관내항균력 원광보건전문대학임상병리과원광대학병원임상병리과 * 순천대학교대학원생물학과 연세대학교의과대학임상병리과 검신무 정수진 정재옥. 신용섭. 섬은숙. 이규식 정윤섭 In Vitro Antimicrobial Activity

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

Microsoft Word - KSR2016S168

Microsoft Word - KSR2016S168 2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

ISO17025.PDF

ISO17025.PDF ISO/IEC 17025 1999-12-15 1 2 3 4 41 42 43 44, 45 / 46 47 48 49 / 410 411 412 413 414 5 51 52 53 54 / 55 56 57 58 / 59 / 510 A( ) ISO/IEC 17025 ISO 9001:1994 ISO 9002:1994 B( ) 1 11 /, / 12 / 1, 2, 3/ (

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

.,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;, 1995), () 65, 4 51, (,, ). 33, 4 30, (, 201

.,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;, 1995), () 65, 4 51, (,, ). 33, 4 30, (, 201 4 21.,,,.,,. 1, 2, 3, 4.,,,,,,.,,,,., ( ). 60-66,,,,,.. (Corresponding Author): / / 303 Tel: 063-220-2495/ E-mail: ikkim@jj.ac.kr .,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;,

More information

조사연구 aim of this study is to find main cause of the forecasting error and bias of telephone survey. We use the telephone survey paradata released by N

조사연구 aim of this study is to find main cause of the forecasting error and bias of telephone survey. We use the telephone survey paradata released by N 조사연구 권 호 DOI http://dx.doi.org/10.20997/sr.17.3.5 연구노트 2016 년국회의원선거전화여론조사정확성분석 Analysis of Accuracy of Telephone Survey for the 2016 National Assembly Elections 1)2) a) b) 주제어 선거여론조사 전화조사 예측오차 편향 대국회의원선거

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

<31325FB1E8B0E6BCBA2E687770>

<31325FB1E8B0E6BCBA2E687770> 88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,

., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5, * 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

untitled

untitled Ann Clin Microbiol Vol. 18, No. 4, December, 2015 http://dx.doi.org/10.5145/acm.2015.18.4.103 pissn 2288-0585 eissn 2288-6850 Active Surveillance of Multidrug-Resistant Organisms with Rapid Detection Methods

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

2003_12_강희정.hwp

2003_12_강희정.hwp 임상검사와정도관리 : 제 25 권제 1 호 2003 J. Lab. Med. & Quality Assuarance 2003:25:189-193 189 BacLink 2 를이용한 Microscan 의데이터변환과항균제내성률통계분석 김재석 이영경 박지영 강희정 강성하 김영철 조현찬 한림대학교의과대학진단검사의학교실 Database Conversion and Analysis

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

MRSA screening -Pros & Cons-

MRSA screening -Pros & Cons- 그람양성다제내성세균격리 -Pros & Cons- 서울대학교의과대학내과학교실분당서울대학교병원감염내과 / 감염관리실김홍빈 Increasing prevalence of MRSA & VRE 100 80 Resistant (%) 60 40 Penicilllin non-susceptible S. pneumoniae Methicillin-resistant S. aureus

More information

141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)

141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3) 141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: : A Study on the Ac

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI:   : A Study on the Ac Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.269-293 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.269 : A Study on the Actual Condition of Character Education in Early Childhood

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

44.이미숙(08-294).hwp

44.이미숙(08-294).hwp 대한내과학회지 : 제 77 권부록 1 호 2009 증례 08-294 Vancomycin 내성 Enterococcus durans에의한뇌실염 1예 경희대학교의과대학 1 내과학교실, 2 진단검사의학교실 문송미 1 한재준 1 유태경 1 ㆍ진상욱 1 ㆍ손준성 1 ㆍ이미숙 1 ㆍ이희주 2 A case of ventriculitis caused by Vancomycin-Resistant

More information