<30362E20BFF8C0FA D B1E8C7FDBCF82E687770>
|
|
- 윤선 기
- 5 years ago
- Views:
Transcription
1 대한내과학회지 : 제 78 권제 3 호 2010 원저 갑상선유두암에서 p16 INK4A 촉진자과메틸화와 p16 INK4A, cyclin D1 및 Rb 발현 계명대학교의과대학 1 내과학교실, 2 병리학교실 김윤정 1 김혜순 1 하유진 1 이호영 1 박근규 1 김미경 1 권선영 2 p16 INK4A promoter hypermethylation and expression of p16 INK4A, cyclin D1, and Rb in papillary thyroid carcinoma Yoon-Jung Kim, M.D. 1, Hye-Soon Kim, M.D. 1, Yu-Jin Ha, M.D. 1, Ho-Young Lee, M.D. 1, Keun-Gyu Park, M.D. 1, Mi-Kyung Kim, M.D. 1, and Sun-Young Kwon, M.D. 2 Departments of 1 Internal Medicine and 2 Pathology, Keimyung University School of Medicine, Daegu, Korea Background/Aims: Dysregulation of the cell cycle is believed to be important in human neoplasia. p16 INK4a, a regulator of the retinoblastoma protein, is inactivated by several mechanisms, including hypermethylation of the promoter. The aim of this study was to assess the relationship between p16 INK4a methylation status and the expression of p16 INK4a, cyclin D1, and retinoblastoma protein in papillary thyroid cancer. Methods: Thirty-five surgically resected papillary thyroid cancer cases treated at Keimyung University Dongsan Medical Center from Jan 2003 to Dec 2005 were included in the study. We examined promoter hypermethylation of p16 INK4a and immunohistochemically analyzed p16 INK4a, cyclin D1, and retinoblastoma protein expression. Results: Aberrant hypermethylation of 5 CpG islands of the p16 INK4a gene promoter was observed in 17 (48.6%) out of 35 cases, and the p16 INK4a protein was lost in 18 (51.4%) cases. With the exception of one case, p16 INK4a promoter hypermethylation correlated with the loss of p16 INK4a protein expression (p<0.0001). Overexpression of cyclin D1 was found in 27 (77.1%) cases and retinoblastoma immunostaining was detected in 10 (28.6%) cases. There was an inverse relationship between p16 INK4a and prb immunostaining (p<0.018, r=-0.398), and a strong direct correlation between cyclin D1 and prb immunostaining (p<0.0001, r=0.710). Cyclin D1 expression was significantly associated with the pathologic T stage of cancer (p=0.04). Conclusions: These data suggest that promoter hypermethylation is a major mechanism underlying the inactivation of p16 INK4a and alterations in the p16 INK4a /cyclin D1/retinoblastoma pathway, which are thought to be very important in papillary thyroid cancer. (Korean J Med 78: , 2010) Key Words: Cyclin D1; Methylation; p16 INK4a ; Retinoblastoma; Thyroid Neoplasm Received: Accepted: Correspondence to Hye-Soon Kim, M.D., Department of Internal Medicine, Keimyung University School of Medicine, 194 Dongsan-dong, Jung-gu, Daegu , Korea hsk12@kmu.ac.kr
2 - The Korean Journal of Medicine: Vol. 78, No. 3, 서론갑상선암은조직학적으로크게갑상선상피세포에서기원하는유두암, 여포암그리고미분화암과갑상선부여세포에서기원하여칼시토닌을분비하는갑상선수질암으로분류할수있다 1). 이중갑상선유두암은전체갑상선암의약 80% 이상을차지하며 10년생존율이 90% 이상으로보고되고있다 2). 세포주기에관여하는단백질의하나인 p16 INK4a 는 cyclin-dependent kinase (CDK) 를억제하는물질로 CDK4 및 CDK6와결합하여 cylind-cdk4 복합체의형성을저해하며, 결과적으로 Retinoblastoma (Rb) 유전자의인산화를억제하여세포주기의 G1기진행을차단하는종양억제인자이다 3). p16 INK4a 유전자의비활성은방광, 유방및전립선암등을비롯한암발생에관여하는것으로보고되고있으며, 이러한종양억제인자의비활성화기전으로는동종접합체결손, 유전자변이및촉진자의과메틸화등이있다 4,5). 최근 p16 INK4a 유전자비활성의원인으로동종접합체결손이나유전자변이등이없이 p16 INK4a 유전자촉진자부위의과메틸화로인한유전자의비활성화가폐암, 신경교종, 유방, 전립선암및신장암등의발생과연관이있다는연구들이보고되었다 6-8). Cyclin D1은 CDK4 및 CDK6와결합하여세포주기의 G1기진행을촉진하여종양의발생에관여한다. 종양억제인자 Rb 는저인산화형태에서세포주기의 G1 정지기의조절인자로작용하는데, p16 INK4a /cyclin D1/Rb 경로의이상은인간의종양발생에있어서세포주기조절기전에손상을가져와암발생에중요한인자로작용하는것으로알려져있다 9). 최근갑상선암발생이급격히증가하고있으나아직까지국내에서는갑상선암발생에있어서세포주기조절에관여하는경로의하나인 p16 INK4a /cyclin D1/Rb 이상에대한연구가이루어지지않았으므로갑상선유두암조직에서 p16 INK4a 촉진자의과메틸화여부와 p16 INK4a, cyclin D1 및 Rb의발현과의관계에대해알아보고암의임상양상과상관관계가있는지알아보고자하였다. 대상및방법 1. 대상환자환자는 2003년 1월부터 2005년 12월까지계명대학교동산의료원에서갑상선절제술후전형적인갑상선유두암으로진단된 35예를대상으로하였다. 환자들의임상정보는 의무기록조사를이용해수집하였고, 수술조직슬라이드를확인하였다. 암의병기는 American Joint Committee on Cancer (AJCC) 의 2002년권고안을따라분류하였다 10). 2. DNA 추출수술조직 1 cm 3 을파쇄기로균질화하고 75% 알코올 2 ml를첨가하여섞은후상온에서 10분간원심분리하여상층액을제거하고남은침전물을건조시켰다. TE9 용액 (10 mmol/l Tris-HCl, 1 mmol/l EDTA, ph 8.9) 4.5 ml를첨가하여진탕및부유후 0.5 ml sodium dodecyl sulfate (SDS) 와 proteinase K 혼합액을넣고 60 에서 48~60시간반응시킨후다시 0.1 ml SDS 와 proteinase K 혼합액을첨가하여 60 에서 24~48시간반응시켰다. 10분간끓는물에담근후상온에서서서히식히고 phenol/chloroform/isoamyl alcohol 5 ml 를넣고혼합한후원심분리하고, 상부수액층을옮겨 10 mmol/l ammonium acetate 2 ml와무수알코올 20 ml를첨가하여섞은후 4 에서하룻밤동안반응시켰다. 10,000 g에서 60분간원심분리하여 DNA를침전시킨후 70% 알코올로세척하여건조시켜 500 μl LOTE (3 mmol/l Tris, 0.2 mmol/l EDTA, ph 7.5) 에녹여 4 에서보관하였다. 3. p16 INK4a 촉진자의메틸화분석 (methylation analysis) p16 INK4a 촉진자의메틸화는 Herman 등 11) 이발표한메틸화분석법을이용하여분석하였다. 메틸화된 cytosine은 bisulfied modification에따라 thymidine으로변환되나메틸화되지않은 cytosine은 uracil로변환되므로이를 PCR로증폭하여 cytosine의메틸화여부를확인하였다. 추출한 DNA를 sodium bisulfite, hydroquinone 그리고 sodium hydroxide와반응시킨후탈아미노반응으로메틸화하지않은 cytosine을 uracil로변환시켜 Wizard DNA purification kit (Promega, Madison, Wisconsin, USA) 를이용하여 DNA를분리하고, sodium hydroxide로탈술폰화반응을유도한후에탄올침천시켜 PCR 증폭을하였다. 메틸화된 DNA 증폭을위한 sense primer로 5 TTATTAGAGGGTGGGGCGGATCGC3, antisense primer 는 5 GACCCCGAACCGCGACCGTAA3 를사용하였고, 메틸화되지않은 DNA 증폭에는 5 TTATTAGAGGGTGGG GTGGATTGT3 와 5 CAACCCCAACCACAACCATAA3 가각각사용되었다. PCR 완충액에 dntp 250 mmol/l, primer 10 pmol/l, DNA 50 ng, MgCl mmol/l 그리고 Taq polymerase 0.5 U를 95 에서 5분반응시킨후 95 에서 30초,
3 - Yoon-Jung Kim, et al. p16 INK4A, cyclin D1, and Rb in papillary thyroid carcinoma - Table 1. Clinical data and pathological features No Sex Age Size (cm) pt * ET Multi LN MSP p16 cyclind1 prb 1 F T2 N N N F T1 N ** Y Y F T3 Y Y N F T1 N Y Y F T3 Y N Y F T2 N N N F T2 N N N F T2 N N N M T3 N N N F T1 N N N F T1 N N N F T1 N N N F T2 N Y N F T3 Y Y N F T2 N Y N F T3 Y Y N F T3 Y Y N F T3 Y Y Y M T2 N N N F T2 N Y Y F T1 N N N F T1 N Y Y F T1 N Y N F T3 N N Y F T2 N Y N F T1 N Y N F T1 N N Y F T1 N N N F T1 N N Y F T1 N N N F T3 Y N Y F T1 N N N F T2 N N N M T3 Y N Y F T2 N N N pt, pathologic tumor stage; ET, extrathyroidal extension; Multi, multicentricity; LN, lymph node metastasis; MSP, methylation; Y, yes; ** N, no; 1, expression; 0, nonexpression. 에서 30초, 72 에서 30초반응을 36회반복한후 72 에서 5분반응시켜 1% agarose gel에전기영동하였다. 4. 면역조직화학염색면역조직화학염색을위해갑상선절제술후파라핀으로 처리하여보관중인조직을사용하였다. 10% 포르말린용액에고정후파라핀포매된조직을 4 µm 두께의절편으로깎은후슬라이드에붙여 60 오븐에서 1시간동안가열하고 histoclear 와크실렌을 3:1로혼합된탈랍제 (dewaxing agent) 에 60 에서 3회, 실온에서 1회처리하여탈파라핀화하였다
4 - 대한내과학회지 : 제 78 권제 3 호통권제 595 호 Figure 1. Representative data for methylation-specific PCR for CpG islands of the p16 INK4a gene promoter in papillary thyroid cancer. The presence of a visible PCR product in lane U indicates an unmethylated gene; the presence of a product in lane M indicates a methylated gene. A B C Figure 2. Typical images of p16 INK4a, cyclin D1 and prb expression in papillary cancer by immunohistochemistry ( 100). (A) positive p16 INK4a immunostaining, (B) positive cyclin D1 immunostaining, and (C) positive prb immunostaining. 실온에서무수알코올 4회처리하여함수시키고내재성과산화효소활성을없애기위하여 0.3% H 2O 2-methanol을 40 에서 2분동안가한후완충액으로세척하였다. p16 INK4a, cyclind1 및 prb 발현을보기위해 CINtec TM p16 INK4a Histology Kit (Dako, USA), NCL-CyclinD1-GM (Novocastra Laboratories, UK) 및 anti-prb monoclonal antibody (BDbiosciences, USA) 를각각 1:40, 1:25 및 1:6,000으로희석하여사용하였다. 5. 통계분석임상양상사이의상관관계는 Pearson Chi-Square test로분석하였다. 대상군간의다양한변수비교에는 independent-samples t-test와 Pearson Chi-Square test를이용하였으며기대도수가 5 미만인경우에는 Fisher s exact test를사용하였다. 변수들의상관관계는 Pearson 상관분석으로평가하였다 (correlation coefficient, r). 통계처리는 SPSS 14.0 (SPSS Inc., Chicago, IL,USA) 을사용하였으며통계적유의수준은 p value 0.05 미만으로정하였다. 결과 1. 임상및병리학소견세계보건기구의조직학적분류에따라여포성변종, 원주 세포변종, 고형변종및유두상미소암등의아형을제외한전형적인갑상선유두암으로진단된환자 35명이연구에포함되었다 12). 평균연령은 47.6세였고, 이중남자가 3명, 여자가 32명이었다. AJCC 에따른암의병기및임상양상을표 1에정리하였다. 2. p16 INK4a 촉진자의메틸화분석 p16 INK4a 의발현이억제되는기전의하나인촉진자부위의과메틸화를분석한결과 p16 INK4a 유전자촉진자 5 CpG의과메틸화는 35명중 17명 (48.6%) 에서관찰되었다 ( 그림 1). 갑상선유두암에서 p16 INK4a 촉진자의과메틸화는한예를제외하고조직의 p16 INK4a 단백질소실과일치하였다 (p<0.0001). 3. p16 INK4a, cyclined1 및 prb 면역조직화학염색갑상선유두암조직에서 p16 INK4a, cyclin D1 및 prb 발현여부를면역조직화학염색을이용하여알아보았다. 갑상선유두암에서 p16 INK4a 단백질은 35명중 18명 (51.4%) 에서소실되었다 ( 그림 2A). 세포주기에서 cyclin D1은 CDK4 및 CDK6와결합하여 G1 S 기의과정을촉진하여종양의발생을유발시키게되는데, 이연구에서갑상선유두암환자 35 명중 27명 (77.1%) 에서 cyclin D1이과발현되었다 ( 그림 2B). E2F와복합체를형성함으로써세포주기 G1에서 S phase로
5 - 김윤정외 6 인. 갑상선유두암과 p16 INK4A, cyclin D1 및 Rb - Table 2. Relationship between p16 INK4a expression and clinicopathological parameters in papillary thyroid cancer + (n=17) p16 INK4a - (n=18) Tumor size cm 9 11 >2.0 cm, 4 cm 6 6 >4 cm 2 1 LN metastasis 0.63 Absent Present 6 5 Multiplicity 0.41 Absent 9 12 Present 8 6 pt stage Extrathyroidal ext. * 0.93 Absent * Extrathyroidal ext., extrathyroidal extension. p Table 3. Relationship between cyclin D1 expression and clinicopathological parameters in papillary thyroid cancer + (n=27) Cyclin D1 - (n=8) Tumor size cm 14 6 >2.0 cm, 4 cm 10 2 >4 cm 3 0 LN metastasis 0.67 Absent 19 5 Present 8 3 Multiplicity 0.51 Absent 17 4 Present 10 4 pt stage Extrathyroidal ext. * 0.09 Absent 19 8 Present 8 0 * Extrathyroidal ext., extrathyroidal extension. p 의진행을억제하는유전자인 Rb는 cyclin D1에의해인산화가되면 E2F에서분리되어세포주기조절기능을상실하게되는데 prb 면역조직화학염색이 35명중 10명 (28.6%) 에서관찰되었다 ( 그림 2C). prb와 p16 INK4a 발현은역비례관계였고 (p<0.018, r=-0.398), prb와 cyclind1 의발현은양의상관관계를보였다 (p<0.0001, r=0.710). 4. p16 INK4a, cyclined1 및 prb 발현여부에따른갑상선유두암의특성마지막으로 p16 INK4a, cyclined1 및 prb의면역조직화학염색결과와임상- 병리조직학적인자들과의상관관계에대하여조사하였다. 갑상선유두암조직에서 p16 INK4a 발현여부에따른갑상선유두암의특성을살펴본결과, p16 INK4a 단백질이소실된군과소실되지않은군에서암종의크기, 림프절전이, 다발성유무, 조직학적병기, 갑상선외조직침윤차이는통계적유의성이없었다 ( 표 2). 갑상선유두암조직에서 cyclin D1이발현된군과발현되지않은군사이에암종의크기, 림프절전이, 다발성유무그리고갑상선외조직침윤은차이가없었으나, 조직학적병기는 cyclin D1 발현군에서 유의하게높았다 (p=0.04, 표 3). 갑상선유두암조직에서 prb 발현여부에따른차이는관찰되지않았다 ( 표 4). 고찰갑상선유두암은내분비계에발생하는악성종양중가장흔한암으로, Rearranged in transformation/papillary thyroid carcinomas (RET/PTC) 유전자재배열이서구지역성인 2.6~ 34% 에서 ras 변이는 10~20% 로보고되고있고, BRAF 변이는 29~83% 로가장흔히관찰되는유전자변이로생각되고있다 13,14). 국내에는갑상선유두암에서 BRAF 변이에따른암발생및예후인자와관련된보고가있었으며 15), 정등 16) 은갑상선유두암에서 p53, p21과 bcl-2 종양단백질의발현과의관계에대한조사를통해 p21 염색양성군에서종양의다발성이나갑상선외조직침범이통계적으로의미있게증가함을보고하였다. 암의발생및진행에있어서종양억제유전자의비활성화가중요한역할을하는것으로알려져있는데, 최근종양
6 - The Korean Journal of Medicine: Vol. 78, No. 3, Table 4. Relationship between prb expression and clinicopathological parameters in papillary thyroid cancer + (n=10) prb - (n=25) Tumor size cm 7 13 >2.0 cm, 4 cm 3 9 >4 cm 0 3 LN metastasis 0.49 Absent 6 18 Present 4 7 Multiplicity 0.13 Absent 4 17 Present 6 8 pt stage Extrathyroidal ext. * 0.25 Absent 9 18 Present 1 7 * Extrathyroidal ext., extrathyroidal extension. 억제유전자인 p16 INK4a 촉진자부위의과메틸화가암발생에기여한다는연구들이보고되고있다 6-8). p16 INK4a 은염색체 9p21에존재하며 156개의아미노산으로구성된핵단백질로, CDK4/6에특이적으로결합하여 CDK4/6/cyclinD의결합을억제하고결과적으로 Rb의인산화를막음으로써 Rb와 E2F 의결합을지속시켜세포주기의진행을억제하는역할을한다 17). p16 INK4a 의변이및유전자소실은여러상피세포암, 췌장암및흑색종등에서발견되며, 갑상선종양에서도여포암과유두암의 2/3 및 1/2에서 p16 INK4a 유전자결손이관찰된반면정상조직에서는 p16 INK4a 유전자결손이없음을보고하였다 18). Ram 등 19) 은 44명의갑상선유두암조직에서 p16 INK4a 단백질발현과 mrna 변이및촉진자부위의과메틸화를분석하였으며, p16 INK4a 유전자변이가갑상선유두암의병리기전에중요한작용을할것이라제시하였다. 정상및갑상선종양조직을비교한연구에서는 p16 INK4a 촉진자의과메틸화가 p16 INK4a 단백질의소실과연관이있었으며, 종양의병기와환자의나이및성별에따른과메틸화차이는관찰되지않았다고보고하였다 8). 또한, 갑상선유두암 39예에 p 서 p16 INK4a, p14 ARF, RB1, p27 KIP1 및 O 6 -MGMT 등의유전자들을분석한연구에서는 p14 ARF 유전자의변이가갑상선유두암의만성염증화에관여하는반면 p16 INK4a 유전자의과메틸화가종양의성장에관여함을발표하였다 20). 이는특정종양억제유전자의과메틸화가종양의생성, 분화및진행초기에중요한소견임을나타내는결과라하겠다. 본연구에서는면역화학염색결과 p16 INK4a 단백질의발현이 35명중 18명 (51.4%) 에서소실되어갑상선유두암에서 p16 INK4a 단백질의소실이종양의발생및진행에관여하는인자의하나라예측할수있었으며, p16 INK4a 단백질이소실된조직 18예중 17 예에서촉진자의 5 CpG 부위과메틸화가관찰되어 p16 INK4a 발현을억제하는주요원인이촉진자과메틸화임을알수있었다. 갑상선유두암조직에서 Cycine D1의면역조직화학염색을실시한결과 35명중 27명 (77.1%) 에서발현이증가하였고, 암의조직학적병기와통계적으로유의한상관관계를보였고, 갑상선외침윤은증가하는경향이관찰되었다. 염색체 11q13에위치하는 cyclin D1은세포주기에서 CDK4/6와복합체를형성하여 Rb 유전자를인산화시킴으로써세포주기 G1 phase로의이동을가속화시켜종양유전자의과발현을통해다양한암을유발하는것으로알려져있다 21). 135명의폐암조직에서 cyclin D1의발현이 24.5% 에서관찰되었으며종양의분화도및림프절전이와연관성을보이고낮은생존율을나타내는연구가보고된바있으며 22), Carlos A 등 23) 은 35 명의갑상선유두암환자를대상으로 cyclin D1의과발현및이와관련된병기및예후인자들을조사한결과 cyclin D1의과발현은종양의재발및사망에밀접한관계가있음을보고하였다. 종양억제유전자 Rb는염색체 13q14에존재하며 110~114 KD로이루어진핵단백질로모든세포에서발현되며비인산화형태에서종양억제유전자로작용한다. 비인산화형태의 Rb는 E2F와복합체를형성함으로써세포주기 G1에서 S phase로의이동을억제하게되는데, cyclin D1의과발현은 Rb를인산화시킴으로써 E2F와의복합체형성을억제한다 9). Anwar 등 24) 은갑상선유두암에서 Rb 활성의감소를관찰하였고, Rb의활성여부가양성및악성갑상성질환의구별에도움이된다고발표하였다. 본연구에서도 prb의발현이갑상선유두암환자 35명의조직중 10명 (28.6%) 에서관찰되었으며 cyclin D1의발현과유의한상관관계를보였다. 이는 cyclin D1의과발현으로인한 Rb의인산화가세포주기조절에이상을초래하게되는데, 갑상선유두암조직에서 p16 INK4a
7 - Yoon-Jung Kim, et al. p16 INK4A, cyclin D1, and Rb in papillary thyroid carcinoma - 의과메틸화로 p16 INK4a /cyclin D1/Rb 경로의이상이발생함을알수있었다. 결론적으로, p16 INK4a 촉진자부위의과메틸화로인한 p16 INK4a 감소가세포주기조절기전에손상을가져와암발생의중요한인자중하나로작용할것으로예측되며, 특히 cycine D1의과발현은암의조직학적병기와유의한상관관계를보였고, 갑상선외침윤이증가하는경향이관찰되어갑상선유두암예후와관련한예측인자및치료목표로서의가능성을제시하여주었다고생각된다. 앞으로더많은갑상선유두암조직에서 p16 INK4a, cyclin D1 및 Rb를비롯한세포주기의이상을알아보고치료경과및예후와의연관성을관찰하는것이갑상선유두암의발생기전을이해하고치료및예후를판정함에있어서도움을줄것으로사료된다. 요약목적 : 종양억제인자 Rb는세포주기의 G1 정지기의조절인자로작용하며 p16 INK4a /cyclin D1/Rb 경로의이상은인간의종양에중요한인자로작용하는것으로알려져있다. p16 INK4a 는촉진자의과메틸화를포함한여러가지기전으로비활성화된다. 이연구는갑상선유두암에서 p 16INK4a 촉진자의과메틸화여부와 p16 INK4a, cyclin D1 및 Rb의발현양상에대해알아보고자하였다. 방법 : 2003년 1월부터 2005년 12월까지계명대학교동산의료원에서갑상선절제술후전형적인갑상선유두암으로진단된 35예를대상으로하였다. p16 INK4a 촉진자의과메틸화여부를관찰하고, 조직에서 p16 INK4a, cyclin D1 및 Rb의단백질발현을면역조직화학염색을이용하여분석하였다. 결과 : p16 INK4a 유전자촉진자의 5 CpG 부위과메틸화는 35명중 17명 (48.6%) 에서관찰되었으며, p16 INK4a 단백질은 35명중 18명 (51.4%) 에서소실되었다. 한예를제외하고는, p16 INK4a 촉진자의과메틸화는 p16 INK4a 단백질소실과일치하였다 (p<0.0001). cyclin D1의과발현은 35명중 27명 (77.1%) 에서관찰되었고, prb 면역염색은 35명중 10명 (28.6%) 에서관찰되었다. prb와 p16 INK4a 면역염색은역비례관계였으며 (p<0.018, r=-0.398), prb와 cyclind1 면역염색은양의상관관계를보여주었다 (p<0.0001, r=0.710). 또한 cyclind1 의발현은종양의 T 병기와연관성이있었고 (p=0.04), 갑상선외침윤이증가하는경향이관찰되었다. 결론 : 촉진자의과메틸화에의한 p16 INK4a 비활성화및이와연관된 cyclin D1 과발현및 Rb 인산화가갑상선유두암 병인의주요한기전의하나일가능성을제시하고있다. 중심단어 : Cyclin D1; 메틸화 ; p16 INK4a ; Retinoblastoma; 갑상선신생물 REFERENCES 1) Hundahl SA, Fleming ID, Fremgen AM, Menck HR. A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., Cancer 83: , ) Gilliland FD, Hunt WC, Morris DM, Key CR. Prognostic factors for thyroid carcinoma: a population-based study of 15,698 cases from the Surveillance, Epidemiology and End Results (SEER) program Cancer 79: , ) Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366: , ) Cairns P, Polascik TJ, Eby Y, Tokino K, Califano J, Merlo A, Mao L, Herath J, Jenkins R, Westra W, Rutter JL, Buckler A, Gabrielson E, Tockman M, Cho KR, Hedrick L, Bova GS, Isaacs W, Koch W, Schwab D, Sidransky D. Frequency of homozygous deletion at p16/cdkn2 in primary human tumours. Nat Genet 11: , ) Herman JG, Merlo A, Mao L, Lapidus RG, Issa JP, Davidson NE, Sidransky D, Baylin SB. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res 55: , ) Calabro V, Strazzullo M, La Mantia G, Fedele M, Paulin C, Fusco A, Lania L. Status and expression of the p16ink4 gene in human thyroid tumors and thyroid-tumor cell lines. Int J Cancer 67:29-34, ) Kim DH, Cho M, Kim DH, Joo KR, Park NH, Yang US. Methylation of the p16 tumor suppressor gene in Korean patients with colon cancer and adenoma. Korean J Med 64: , ) Boltze C, Zack S, Quednow C, Bettge S, Roessner A, Schneider-Stock R. Hypermethylation of the CDKN2/p16INK4A promotor in thyroid carcinogenesis. Pathol Res Pract 199: , ) Hartwell LH, Kastan MB. Cell cycle control and cancer. Science 266: , ) Green FL. AJCC cancer staging manual. 6th ed. p , New York, Springer-Verlag Press, ) Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 93: , ) Eszlinger M, Krohn K, Hauptmann S, Dralle H, Giordano TJ, Paschke R. Perspectives for improved and more accurate classification of thyroid epithelial tumors. J Clin Endocrinol Metab 93: , ) Patel KN, Singh B. Genetic considerations in thyroid cancer
8 - 대한내과학회지 : 제 78 권제 3 호통권제 595 호 Cancer Control 13: , ) Puxeddu E, Moretti S, Elisei R, Romei C, Pascucci R, Martinelli M, Marino C, Avenia N, Rossi ED, Fadda G, Cavaliere A, Ribacchi R, Falorni A, Pontecorvi A, Pacini F, Pinchera A, Santeusanio F. BRAF(V599E) mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. J Clin Endocrinol Metab 89: , ) Rha SY, Lee JC, Kwon KH, Lee HJ, Kim KS, Jo YS, Ku BJ, Shong M, Kim YK, Ro HK. The relationship between the BRAF mutations in thyroid papillary carcinomas and the prognostic factors. J Korean Soc Endocrinol 20: , ) Jung TS, Kim KS, Oh YL, Jung JH, Lee EY, Jung HS, Min YK, Lee MS, Lee MK, Kim KW, Chung JH. p53, p21 and bcl-2 protein expressions and the clinical significance in papillary thyroid carcinoma. J Korean Soc Endocrinol 22:98-104, ) Ortega S, Malumbres M, Barbacid M. Cyclin D-dependent kinases, INK4 inhibitors and cancer. Biochim Biophys Acta 1602:73-87, ) Jones CJ, Shaw JJ, Wyllie FS, Gaillard N, Schlumberger M, Wynford-Thomas D. High frequency deletion of the tumour suppressor gene P16INK4a (MTS1) in human thyroid cancer cell lines. Mol Cell Endocrinol 116: , ) Lam AK, Lo CY, Leung P, Lang BH, Chan WF, Luk JM. Clinicopathological roles of alterations of tumor suppressor gene p16 in papillary thyroid carcinoma. Ann Surg Oncol 14: , ) Ishida E, Nakamura M, Shimada K, Higuchi T, Takatsu K, Yane K, Konishi N. DNA hypermethylation status of multiple genes in papillary thyroid carcinomas. Pathobiology 74: , ) Alao JP. The regulation of cyclin D1 degradation: roles in cancer development and the potential for therapeutic invention. Mol Cancer 6:24, ) Caputi M, Groeger AM, Esposito V, Dean C, De Luca A, Pacilio C, Muller MR, Giordano GG, Baldi F, Wolner E, Giordano A. Prognostic role of cyclin D1 in lung cancer: relationship to proliferating cell nuclear antigen. Am J Respir Cell Mol Biol 20: , ) Muro-Cacho CA, Holt T, Klotch D, Mora L, Livingston S, Futran N. Cyclin D1 expression as a prognostic parameter in papillary carcinoma of the thyroid. Otolaryngol Head Neck Surg 120: , ) Anwar F, Emond MJ, Schmidt RA, Hwang HC, Bronner MP. Retinoblastoma expression in thyroid neoplasms. Mod Pathol 13: ,
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More informationKaes017.hwp
갑상선의 Poorly Differentiated (Insular) Carcinoma Insular Carcinoma: An Aggressive Subtype of Differentiated Thyroid Neoplasms Seok-Jin Nam, M.D., Sang-Dal Lee, M.D., Hal-lin Park, M.D., Young-Ryun Oh, M.D.
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information두경부 편평세포암에서 p16, Cyclin D1 단백의 발현양상 부 편평세포암에서 p16단백의 표현양상과 임상병기 및 조 4-326(BioGenex, USA), p16은 쥐 단클론 항체인 G17 직분화도에 따른 표현양상의 차이를 알아보고 cyclin D (P
KISEP Head and Neck Korean J Otolaryngol 1998;417:901-905 두경부편평세포암에서 p16, Cyclin D1 단백의발현양상 김상현 박숙아 오영석 Expression of p16 Protein and Cyclin D1 Protein in Head and Neck Squamous Cell Carcinomas Sang Hyun
More information<3230B1C733C8A32DB8F1C2F72E687770>
대한내분비학회지 : 제 20 권제 3 호 2005 원저 갑상선유두암에서의 BRAF 변이와예후인자와의관계 충남대학교의과대학내과학교실 나소영 이준철 권기현 이효진 김군순 조영석 구본정 송민호 김영건 노흥규 The Relationship between the BRAF Mutations in Thyroid Papillary Carcinomas and the Prognostic
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information<30322EBABBB9AE2E687770>
대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information( )Jksc057.hwp
직장암환자의전직장간막절제술의 예측인자분석 : 불완전절제와절제시간에영향을미치는인자에관한연구 Analysis of Factors Affecting the Degree of Difficulty in Total Mesorectal Excision for Rectal Cancer: Investigation of the Factors Affecting Incomplete
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationuntitled
ORIGINAL ARTICLE pissn: 2384-3799 eissn: 2466-1899 Int J Thyroidol 2018 November 11(2): 123-129 https://doi.org/10.11106/ijt.2018.11.2.123 갑상선종양에서 메틸화와 BRAF 유전자변이에관한연구 고려대학교의과대학이비인후 - 두경부외과학교실 오경호, 정광윤,
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information(72) 발명자 오인환 서울 노원구 중계로 195, 101동 803호 (중계동, 신 안동진아파트) 서혜리 서울 종로구 평창14길 23, (평창동) 한훈식 서울 강남구 언주로71길 25-5, 301호 (역삼동, 영 훈하이츠) 이 발명을 지원한 국가연구개발사업 과제고유번호
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2014년04월14일 (11) 등록번호 10-1384704 (24) 등록일자 2014년04월07일 (51) 국제특허분류(Int. Cl.) F16L 9/18 (2006.01) F17D 1/00 (2006.01) F16L 3/00 (2006.01) (21) 출원번호 10-2012-0113933
More information연하곤란
2015.03.04 부울경소화기내시경지회 Intramucosal gastric cancer: The rate of lymph node metastasis in signet ring cell carcinoma was as low as that in welldifferentiated adenocarcinoma 인제대부산백병원 소화기내과 지삼룡 Signet ring
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More informationKaes025.hwp
고위험군유두상갑상선암환자에대한방사성옥소최대허용선량측정법및치료법의검증 Verification of Measurement Methods and Therapeutic Efficacy of Maximum Permissible Dose of I-131 in High Risk Patients with Differentiated Papillary Thyroid Cancer
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide
연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through
More informationuntitled
대한내분비외과학회지 : 제10권제1호 Vol. 10, No. 1, March 2010 원저 다발성유두상갑상선암의임상병리학적특성분석 인제대학교의과대학부산백병원외과학교실 이민욱ㆍ하태권ㆍ유성목ㆍ김상효 Analysis of the Clinicopathologic Characteristics of Multifocal Papillary Thyroid Carcinoma
More informationVery low-risk Low-risk Intermediate-risk High-risk Appendiceal mucinous tumours Mucinous adenoma Mucinou
I. Workshop 결과에대한설문조사결과 A. 종양의행태 (behavior) 코드부여에이견이있는소화기계암에대한설문조사결과 Organ or Subject Stomach Colon Diagnosis 응답자수 ( 총 240 명 ) Low grade adenoma/dysplasia 230 10 0 1 2 3 6 무응답 High grade adenoma/dysplasia
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationKjhps016( ).hwp
Surgical Extent and Types in Pancreatic Cancer Song Cheol Kim, M.D. Department of Surgery, Ulsan University College of Medicine & Asan Medical Center, Seoul, Korea Pancreatic cancer continues to pose a
More informationuntitled
ISSN 1598-1703 (Print) / 2287-6782 (Online) Korean J Endocrine Surg 2012;12:252-257 ORIGINAL ARTICLE 갑상선유두미세암에서중심림프절전이를예측할수있는인자에관한분석 한림대학교의과대학외과학교실, 한림대학교성심병원유방내분비외과 안소은ㆍ김준호ㆍ이강율ㆍ임영아ㆍ이연옥ㆍ김해성ㆍ김이수 Predictive
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information지원연구분야 ( 코드 ) LC0202 과제번호 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 소속위암연구과직위책임연구원
지원연구분야 ( 코드 ) LC0202 과제번호 1110550 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 1 2 3 소속위암연구과직위책임연구원 성명류근원전공외과 세부과제명 세부과제책임자 성명 소속 ( 직위 ) 전공 총연구기간 2011
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More information레이아웃 1
대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationuntitled
대한내분비외과학회지 : 제12권제2호 Vol. 12, No. 2, June 2012 원저 유두상갑상선암에서 Cyclin D1, Cytokeratin 7, Cytokeratin 20, Vimentin 의발현및예후인자와의연관성에대한분석 조선대학교병원외과 김호진ㆍ김유석ㆍ김세원ㆍ김권천 Expression of Cyclin D1, Cytokeratin 7, Cytokeratin
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information120304강신용
Clinical Features and Prognostic Factors Influencing Long-term Survival in pt2 Gallbladder Carcinoma Patients Purpose: The prognosis of gallbladder carcinoma is unfavorable, and the depth of invasion,
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information( )Kaes008.hwp
대한내분비외과학회지 : 제7권제1호 Vol. 7, No. 1, March 2007 원저 갑상선수질암의임상적고찰 경북대학교의과대학외과학교실 육종필 신정혜 황승욱 정진향 박호용 The Clinical Characteristics, Prognostic of Medullary Thyroid Cancer Jongpil Ryuk, M.D., Junghye Shin, M.D.,
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More informationuntitled
대한내분비외과학회지 : 제12권제2호 Vol. 12, No. 2, June 2012 원저 세포흡인검사에서 Peptide Nucleic Acid-Mediated PCR Clamping 법을이용한 BRAF V600E 유전자변이검사 동아대학교의과대학 1 이비인후-두경부외과학교실, 5 외과학교실, 6 병리학교실 2 영상의학과학교실, 3 내분비내과학교실, 4 핵의학교실,
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationuntitled
ORIGINAL ARTICLE pissn: 2384-3799 eissn: 2466-1899 Int J Thyroidol 2017 November 10(2): 82-88 https://doi.org/10.11106/ijt.2017.10.2.82 설문지조사를이용한시대별갑상선암의진단동기및환경적위험인자의변화 서울대학교의과대학내과 1, 국립암센터갑상선암센터 2, 서울특별시보라매병원내과
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More informationuntitled
DOI: 10.3857/JKSTRO.2008.26.2.113 노령의 피부암에서 방사선치료 계명대학교 의과대학 동산의료원 방사선종양학교실 김 진 희 목 적: 노령의 피부암에서 방사선치료 후 국소 제어률, 생존율, 실패양상, 부작용을 알아보기 위해 이 연구를 시행 하였다. 대상 및 방법: 1990년 1월부터 2002년 10월까지 계명대학교 동산의료원 방사선종양학과에서
More information구강암에서 p53, p21, Bax 단백의 발현양상 및 예후와의 연관성 요구되고 있다.5) 이미 Apolinario 등1)과 Lee 등2)은 면역 (Calbio, England)를 1 20으로, bax에 대한 일차항체로 조직화학적으로 단백발현된 양상과 생존률과의 비교연
KISEP Head and Neck Korean J Otolaryngol 2000;43:523-7 구강편평세포암에서 p53, p21, Bax 단백의면역조직화학적발현양상및예후적의의 김상현 황동조 김정수 문준환 노호상 The Expression Pattern and the Prognostic Value of p53, p21, and Bax Proteins in
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information394 조향정 윤기중 문형배 복구를유도한다. 그리고세포자멸사를일으켜손상된 DNA가복제되지않도록하여손상된세포의성장을 G1기에서정지시켜 S기로진행하는것을막는다. 그러나돌연변이로인하여 p53이기능을하지못하면종양유전자로작용하여종양발생에관여하게되며, 세포자멸사를억제하는것으로알려
대한병리학회지 : 제 37 권제 6 호 2003 The Korean Journal of Pathology. 2003; 37: 393-9 유방의침윤성관암종에서 p21, p53 및 bcl-2 단백의발현 조향정 윤기중 1 문형배 1 원광대학병원운영군산의료원병리과 1 원광대학교의과대학병리학교실 Expression of p21, p53 and bcl-2 Proteins
More informationuntitled
대한내분비외과학회지 : 제9권제1호 Vol. 9,. 1, March 2009 원저 갑상선유두암에서 CK7, CK20, Vimentin, p53 과 Ki-67 의발현 가천의과학대학교길병원외과학교실, 1 병리학교실 이승환ㆍ박승연ㆍ김나래 1 ㆍ이영돈 The Expressions of CK7, CK20, Vimentin, p53 and Ki-67 in Papillary
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationuntitled
ORIGINAL ARTICLE pissn: 2384-3799 eissn: 2466-1899 Int J Thyroidol 2016 May 9(1): 29-34 http://dx.doi.org/10.11106/ijt.2016.9.1.29 하시모토 갑상선염을 동반한 갑상선유두암에서 BRAF V600E 돌연변이의 임상병리학적 의미 울산대학교 의과대학 서울아산병원 내과
More information(49-54)Kjhps004.hwp
Biliary Cystadenoma and Cystadenocarcinoma of the Liver Jae Hoon Lee, M.D., Dong Ho Choi, M.D. 1, Kyeong Geun Lee, M.D., Hwon Kyum Park M.D. and Kwang Soo Lee, M.D. Department of Surgery, College of Medicine,
More informationTable 1. Distribution by site and stage of laryngeal cancer Supraglottic Glottic Transglottic Total Stage Total 20
KISEP Head and Neck Korean J Otolaryngol 1999;42:1284-9 후두암수술환자에대한치료성적 송달원 김희준 정현수 김영한 안재현 이복수 박선호 Treatment Result in Laryngeal Cancer Patients Submitted to Surgical Treatment Dal Won Song, MD, Hee Jun
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationuntitled
대한내분비외과학회지 : 제10권제3호 Vol. 10, No. 3, September 2010 원저 갑상선미세유두암에서종양크기의구분에따른임상병리학적특징의분석 가톨릭대학교의과대학대전성모병원외과학교실 조윤정ㆍ이동호ㆍ이상철ㆍ김세준ㆍ김정구ㆍ안창준ㆍ이관주 Analysis of Clinicopathologic Features of Papillary Thyroid Microcarcinoma
More information내시경 conference
부울경소화기내시경학회 6월집담회 고신대학교복음병원소화기내과전임의서광일 F/63 CASE C.C) epigastric pain for 2 wks P. I) 2014.04.16 EGD at LMC adm via OPD for further evaluation. P. Hx) CASE HTN/DM/Hepatitis/Tbc (+/+/-/-) S. Hx) N-S ROS)
More information<5B31375DC3D6BCF7B0E62DC0DAB1C3B0E6BACEC0CCC7FCBCBAC1F52D3131BFF93239C0CFC1A2BCF62E687770>
대한임상검사학회지 : 36 권제 2 호, 178-184, 2004 인유두종바이러스의감염또는감염되지않은자궁경부이형성증에서 p53 및 Ki-67의발현 건국대학교농축대학원생물공학과 1, 서울보건대학임상병리과 2, 분당제생병원진단검사의학과 3 최숙경 1 김태전 2 홍승복 3 이훈택 1 Expression of p53 and Ki-67 in Cervical Dysplasia
More informationuntitled
DOI: 10.4046/trd.2011.70.2.132 ISSN: 1738-3536(Print)/2005-6184(Online) Tuberc Respir Dis 2011;70:132-138 CopyrightC2011. The Korean Academy of Tuberculosis and Respiratory Diseases. All rights reserved.
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationuntitled
ORIGINAL ARTICLE ISSN: 2005-162X Clin Exp Thyroidol 2014 November 7(2): 167-171 http://dx.doi.org/10.11106/cet.2014.7.2.167 우리나라갑상선암의치료양상분석 (2008-2012 년 ) 건강보험심사평가원 1, 성균관대학교의과대학삼성서울병원내분비 - 대사내과, 갑상선센터
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More informationMicrosoft Word doc
의학박사학위논문 결장직장암에서 Bone Morphogenetic Protein 2 유전자의후향적변이에관한연구 The Study of Epigenetic Alteration of the Bone Morphogenetic Protein 2 in Human Colorectal Cancer 2007 년 2월 인하대학교대학원의학과 ( 외과학전공 ) 구지회 1 의학박사학위논문
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationMicrosoft PowerPoint - 김미영
암세포의위험한여행 한국과학기술원 김미영 강의개요 전이란무엇인가? 전이는어떤과정을통해진행될까? 전이예측방법은어떤것들이있을까? Cancer ( 악성종양 ) US South Korea 질병사망률질병사망률 1. 심장병 26% 1. Cancer 26.7% 2. Cancer 23% 2. 뇌출혈 12.7% 3. 뇌출혈 5.6% 3. 심장병 7.9% >20,000 환자가악성종양에의해매일사망함
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information대한병리학회지 : 제 35 권제 4 호 2001 The Korean Journal of Pathology. 2001; 35: 결장선암종에병발한선종에서 K-ras 유전자돌연변이와 K-ras, p16, Cyclin D1, p53 단백발현 오화은 조성진 1 원남희
대한병리학회지 : 제 35 권제 4 호 2001 The Korean Journal of Pathology. 2001; 35: 291-8 결장선암종에병발한선종에서 K-ras 유전자돌연변이와 K-ras, p16, Cyclin D1, p53 단백발현 오화은 조성진 1 원남희 1 이대일 1 김인선 1 염범우 1 관동대학교의과대학명지병원해부병리과 1 고려대학교의과대학병리학교실
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More informationuntitled
ORIGINAL ARTICLE pissn: 2384-3799 eissn: 2466-1899 Int J Thyroidol 2017 November 10(2): 89-95 https://doi.org/10.11106/ijt.2017.10.2.89 경부림프절전이를동반한갑상선유두암환자에서혈중호중구림프구비율의임상적의의 고신대학교의과대학의학과 1, 이비인후과학교실 2
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationKinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc
Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationFluoroscopic anatomy for supraventricular tachycardia ablation Hui-Nam Pak, MD, PhD Division of Cardiology, Yonsei Cariovascular Center and Cardiovascular Research Institute, Yonsei University College
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More information186 홍숙희 김대철 조세헌외 1 인 켜나쁜예후를보이는것으로알려져있다. 2,4-6 그러나 p27 발현은높지만세포증식은억제되지않는종양에서는 p27이핵이아닌세포질에잘못발현된현상이관찰된다. 이러한현상은 p27 이핵이아닌세포질에격리됨으로써, 핵안의 cyclin E/CDK2 와
The Korean Journal of Pathology 2006; 40: 185-92 유방암종에서 p27 kip1 단백의세포내발현위치와예후와의관련성 홍숙희 김대철 조세헌 1 홍영습 2 동아대학교의과대학병리학교실 1 외과학교실, 2 예방의학교실 Subcellular Localization of p27 kip1 in Breast Cancer and Its Prognostic
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information