[00]_목차.hwp

Size: px
Start display at page:

Download "[00]_목차.hwp"

Transcription

1 Korean J. Plant Res. 28(1): (2015) Print ISSN Online ISSN Original Research Article 차정단 1, 최미래 1, 고은실 1, 황승미 1, 강제란 1, 오좌섭 2, 박영진 2, 정용환 3, 전아림 3, 최경민 1 * 1 ( 재 ) 진안홍삼연구소, 2 ( 재 ) 경기과학기술원천연물신약연구소, 3 ( 재 ) 제주테크노파크제주생물종다양성연구소 Synergistic Effects of Cinnamomum camphora Leaves Extract against Clinical Isolated Methicillin-resistant Staphylococcus aureus Jeong-Dan Cha 1, Mi-Rae Choi 1, Eun-Sil Ko 1, Seung-Mi Hwang 1, Jea-Ran Kang 1, Joa-Sub Oh 2, Young-Jin Park 2, Young-Hwan Jung 3, Ah-Lim Jeon 3 and Kyung-Min Choi 1 * 1 Institute of JinAn Red Ginseng, Jinan-Gun , Korea 2 Gyeonggi Institute of Science&Technology Promotion, Natural Products Research Institute, Suwon , Korea 3 Jeju Biodiverstiy Research Institute, Jeju Technopark, Seogwipo , Korea Abstract - Methicillin-resistant Staphylococcus aureus (MRSA) has been emerging worldwide as one of the most important hospital and community pathogens. At the same time, because of the difficulty in developing chemical synthetic drugs and because of their side-effects, scientists are making more efforts to search for new drugs from plant resources to combat clinical multidrug-resistant microbial infections. Cinnamomum camphora (C. camphora) is a plant of family Lauraceae, and grown Jeju island in South Korea that are used as a drug to treat neurasthenia, epilepsy, cystitis, pyelonephritis, digitalis, cancer, and diabetes mellitus in folk remedies. In this study, antibacterial activites of 80% ethanol extract of C. camphora leaves (CCE) were investigated in combination with antibiotics against clinical isolates of MRSA. The results showed that CCE was determined with MIC and MBC values ranging from 156 to 313 and 313 to 625 μg / ml, oxacillin from 128 to 256 and 128 to 512 μg / ml, ampicillin from 4 to 64 and 8 to 128 μg / ml. The combination of CCE with oxacillin or/and ampicillin were synergistic effect against MRSA 1, 6, 7, 8, 10, 11, 12, 13, and 15/ MRSA 1, 2, 6, and 7. Key words - Cinnamomum camphora, Methicillin-resistant Staphylococcus aureus, Synergistic effects 서언 Staphylococcus aureus (S. aureus) 는피부감염증, 식중독, 폐혈증둥여러감염을일으킬수있는주된병원성세균으로널리알려져있다 (Han, 2011) 년영국에서메치실린내성포도상구균 (methicillin-resistant Staphyloccus aureus, MRSA) 이처음보고된이후우리나라에서도 1980 년대들어서면서여러병원에서 MRSA 발생을보고하고있으며현재까지대표적인병원감염원인균중의하나이다 (Lee et al., 2005). 또한최근반코마이신내성포도상구균 (vancomycin-resistant Staphyloccus aureus,vrsa) 과같은슈퍼박테리아의출현으로항균제내성의문제가심각하게대 * 교신저자 ( ) : kyungmc@ijrg.re.kr These authors contributed equally to this works. 두된가운데전통적으로감염질환치료에사용되어온식물로부터항균물질을분리하기위한연구가활발히진행되고있다 (Shin and Seong, 2006; Heo et al., 2012; Hwang et al., 2014). 녹나무 (Cinnamomum camphora) 는 Lauraceae 과로난대성기후에서만자라는나무로겨울에도잎이떨어지지않는상록활엽수이다 (Han, 2011). 또한천연기념물제162 호로국내에서는제주도에서주로자생하며지리적으로는일본, 중국, 대만, 인도네시아에분포한다 (Ko et al., 2005). 재목, 가지, 잎, 뿌리를말려수증기로증류시켜얻은기름을장뇌라고하며, 장뇌에는정유성분인 camphor 가주성분이고 cineol, α-pinene, l-camphene, d-limonene, safrol, α-camphorene 등이함유되어있다 (Stubbs et al., 2004). 가지와뿌리는강심제를만드는약의원료가되고, 잎은서양요리의소스를만들때사용하기도하며민간에서는방해충, 신경쇠약, 간질, 방 c 본학회지의저작권은 ( 사 ) 한국자원식물학회지에있으며, 이의무단전재나복제를금합니다. This is an Open-Access article distributed under the terms of the Creative Commons -9- Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 韓資植誌 Korean J. Plant Res. 28(1) : 009~015(2015) 광염, 신우신염, 강심제로도알려져있고, 제주도에서는당뇨, 암치료약으로사용되어왔다 (Lee, 2003). 다방면에이용되고있는녹나무추출물의 MRSA 항균활성과항생제병용처리후시너지효과를확인하고천연항생제로서의이용가능성을제시하고자한다. 재료및방법천연물확보및추출 본실험에사용된재료는제주지역에서채집하여대한식물도감을참고하여동정하였으며, 실험에사용된녹나무 (Voucher No. JBRI ) 의증거표본은제주생물종다양성연구소표본실에보관하였다. 동정된녹나무잎은음건후믹서기로분쇄하여 80% 에탄올로실온에서 24시간 3회추출하여동결건조후냉동보관하였으며, 실험전 10% Dimethyl sulfoxide (DMSO, Sigma-Aldrich, MO, USA) 에녹여 0.22 mm (Merck millipore, France) 로필터후멸균증류수로농도별희석하여실험하였다. MRSA 분리및동정전라북도의한대학병원의임상샘플을받아 Mannitol Salt Agar (MSA, Sigma-Aldrich) 에 2 mg / ml oxacillin (Sigma-Aldrich) 이첨가된배지에접종하여노란색집락으로변한집락을찾아 1차스크리닝하였다. MRSA 확인동정을위해서는 fema 유전자와 penicillinbinding protein (PBP) 2` (Choi et al., 2009) 을생성하는 meca 유전자를 PCR 법으로시험하였다. Tryptic soy agar (TSA, Becton Dickinson, NJ, USA) 배지에접종하여 37, 호기성배양기에서 18 시간배양한집락을, QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) 를사용하여주형 DNA를분리하였다. 사용된 primer 의염기서열은 Table 1과같으며, Cosmogene Co. (Daejeon, Korea) 에의뢰하여합성하였다. Forward 와 reverse primer를각각 1 ml, PCR mastermix (Bioneer, Korea) 4 ml, DEPC 12 ml, 주형 DNA 2 ml를넣어 PCR 반응의최종액을 20 ml로하였다. PCR 반응은 thermal cycler (Abcam, CA, USA) 를사용하였으며, 위의 2개의유전자증폭조건은 95 5분간 predenaturation, 95 30초 denaturation, 50 annealing 30 초, 72 extention 30 초로 30회반복하 여, 72 5분 last extention 시킨후 4 에서종료시켰다. 반응후 1.5% agarose gel (Lonza, NJ, USA) 에서전기영동하여 ethidium bromide (EtBr, Invitrogen, NY, USA) 로염색한후결과를확인하였다. MRSA 로최종동정된균주는 30% glycerol 이첨가된 Brain Heart Infusion (BHI, Becton Dickinson) broth에풀어 -70 에보관하였다 (Kim et al., 2009). Minimum Inhibitory Concentrations (MICs)/Minimum Bactericidal Concentrations (MBCs) 임상에서분리된 MRSA 균주의녹나무잎추출물 (80% EtOH cinamomum camphora leaves extract, CCE) 과항생제의 minimum inhibitory concentrations (MICs) 는 broth dilution method 로측정하였다. MIC 측정은 Mueller Hinton borth (MHB, Becton Dickinson) 에항생제와 CCE 를단계희석한후, 균의최종희석농도를 CFU/ ml로하여 37 18시간배양후 540 nm에서흡광도를측정하여판독하였다. MIC 농도를기준으로증식하지않은배양액 100 ml를 TSA 에균일하게도말하여 37 18시간배양후 99.9% 살균이되는농도로 MBC 를판독하였다. Checkboard Dilution Assay CCE와 β-lactam 계의항생제인 oxacillin과 ampicillin의 synergistic effect를 checkbord dilution method 로확인하였다 (Arnold and Morrison, 1984; Cha et al., 2014). 각천연물과항생제의혼합에따른 fractional inhibitory concentration (FIC) 와 fractional bactericidal concentration (FBC) 는다음과같이계산하였다. FIC A = MIC A in combination / MIC A FIC B = MIC B in combination / MIC B FIC Index = FIC A + FIC B FBC A = MBC A in combination / MBC A FBC B = MBC B in combination / MBC B FBC Index = FBC A + FBC B Table 1. Primers used for detection of the meca and fema genes from S. aureus Gene Orientation Primer Oligonucleotide sequence (5'-3') PCR product size meca meca-f ATGAGATTAGGCATCGTTTC meca-r TGGATGACAGTACCTGAGCC 554 bp fema fema-f CATGATGGCGAGATTACAGG fema-r CGCTAAAGGTACTAACACACGG 372 bp -10-

3 FIC index 0.5 이하 synergistic, 0.5에서 1사이 additive, 1 에서 2 사이 indifference, 2 이상일경우 antagonism 으로해석하였다 (Cha et al., 2007; Lee and Cha, 2010; Cha et al., 2014). 결과및고찰 MRSA 동정 2 μg / ml의 oxacillin이첨가된 MSA 에서노란색집락이생성된 15 균주에서 fema, meca 의유전자를검출한결과 15균주모든샘플에 서 S. aureus 를확인동정하는 fema 유전자를확인할수있었고, PBP 2`을생성하는 meca 유전자또한확인하였다 (Fig. 1). 항생제와 CCE 와병용처리후항생제내성균주의시너지효과본시험에사용된임상에서분리된 MRSA 에대한 CCE의 MIC, MBC 범위는 μg / ml, μg / ml였고, oxacillin 의 MIC, MBC 범위는 μg / ml, μg / ml, ampicillin의위는 MIC 와 MBC 모두 μg / ml였다 (Table 2). Fig. 1. Agarose gel electrophoresis of amplified 372-bp, 554-bp DNA fragments of the fema, meca genes of S. aureus isolates by PCR. Table 2. Antibacterial activity of ethanol extract of C. camphora leaves on isolates MRSA and reference strains Samples CCE Ampicillin Oxacillin MIC/MBC ( μg / ml ) MSSA ATCC z 625/ / /0.25 MRSA ATCC y 625/ / /512 MRSA 1 x 625/625 32/32 512/512 MRSA 2 625/625 32/32 512/512 MRSA 3 313/625 32/32 512/512 MRSA 4 313/625 32/32 512/512 MRSA 5 313/625 32/32 512/512 MRSA 6 625/625 32/32 512/512 MRSA 7 625/ /32 512/1024 MRSA 8 625/ / /1024 MRSA 9 625/625 64/ /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 z MSSA (ATCC 25923): reference strain Methicillin-sensitive Staphylococcus aureus. y MRSA (ATCC 33591): reference strain Methicillin-resistant Staphylococcus aureus. x MRSA (1-15): Methicillin-resistant Staphylococcus aureus isolated a clinic. -11-

4 韓資植誌 Korean J. Plant Res. 28(1) : 009~015(2015) Table 3. Synergistic effects of the ethanol extract of C. camphora leaves with oxacillin on isolates MRSA and reference strains Strains Agent MIC/MBC ( μg / ml ) Alone Combination z MSSA ATCC x CCE 625/ / /1.0 Oxacillin 0.25/ / /0.5 MRSA ATCC33591 w CCE 625/ / /0.25 Oxacillin 512/ / /0.5 MRSA 1 v MRSA 2 MRSA 3 MRSA 4 MRSA 5 MRSA 6 MRSA 7 MRSA 8 MRSA 9 MRSA 10 MRSA 11 MRSA 12 MRSA 13 MRSA 14 MRSA 15 CCE 313/ / /0.5 CCE 313/ / /0.5 CCE 313/ / /0.5 Oxacillin 512/ / /0.25 Oxacillin 1024/ / /0.5 CCE 625/ / /0.25 CCE 1250/ / /0.5 CCE 625/ / /0.25 Oxacillin 1024/ / /0.5 CCE 1250/ / /0.25 Oxacillin 512/ / /0.25 z The MIC and MBC of CCE with ampicillin. y the FIC index. x MSSA (ATCC 25923): reference strain Methicillin-sensitive Staphylococcus aureus. w MRSA (ATCC 33591): reference strain Methicillin-resistant Staphylococcus aureus. v MRSA (1-15): Methicillin-resistant Staphylococcus aureus isolated a clinic. FIC/FBC FICI/FBCI y Outcome 1.0/1.5 Indifference/Indifference 0.5/1 Synergistic/Additive -12-

5 Table 4. Synergistic effects of the ethanol extract of C. camphora leaves with ampicillin in isolated MRSA and reference MSSA and MRSA strains Strains Agent MIC/MBC( μg / ml ) Alone combination z MSSA ATCC x CCE 625/ / /1 Ampicillin 1.25/ / /0.5 MRSA ATCC33591 w MRSA 1 v Ampicillin 32/32 8/ /0.5 MRSA 2 MRSA 3 MRSA 4 MRSA 5 MRSA 6 MRSA 7 MRSA 8 MRSA 9 MRSA 10 MRSA 11 MRSA 12 MRSA 13 MRSA 14 MRSA 15 CCE 625/ / /0.25 CCE 313/625 78/ /0.5 CCE 313/ / /0.25 CCE 313/625 78/ /0.5 Ampicillin 32/32 8/ /0.5 CCE 625/ / /0.25 CCE 625/ / /0.25 Ampicillin 64/128 32/32 0.5/0.25 CCE 625/ / /0.25 Ampicillin 64/64 16/ /0.5 CCE 1250/ / /0.5 Ampicillin 256/256 64/ /0.5 CCE 625/ / /0.5 z The MIC and MBC of CCE with ampicillin. y the FIC index. x MSSA (ATCC 25923): reference strain Methicillin-sensitive Staphylococcus aureus. w MRSA (ATCC 33591): reference strain Methicillin-resistant Staphylococcus aureus. v MRSA (1-15): Methicillin-resistant Staphylococcus aureus isolated a clinic. FIC/FBC FICI/FBCI y Outcome 1/1.5 Additive/Indifference 0.5/1 Synergistic/Additive 0.75/0.5 Additive/Synergistic 0.5/1 Synergistic/Additive 0.75/0.5 Additive/Synergistic 0.75/1 Additive/Additive -13-

6 韓資植誌 Korean J. Plant Res. 28(1) : 009~015(2015) CCE 와 oxacillin의병용처리결과는 CCE 에서 MIC 와 MBC 의범위는 μg / ml와 μg / ml이고, oxacillin에서는 MIC 와 MBC 의범위는 μg / ml와 μg / ml로나타났으며, CCE와 oxacillin 의단독처리시보다병용처리시항균활성이높은것을확인할수있었다 (Table 3, 4). CCE 와 ampicilin 병용처리시 CCE의 MIC 와 MBC 의범위는 μg / ml와 μg / ml이고, ampicillin 에서는 MIC와 MBC 의범위는 4-64 μg / ml와 μg / ml로나타났으며, ampicillin과 CCE 와의병용처리역시높은항균활성을확인할수있었다. 또한, FIC index 와 FBC index 로계산하여판독한결과 CCE 와 oxacillin의병용처리는 MRSA 2, 3, 4, 5, 9, 14를제외한 MRSA 에서 synergistic 효과를확인하였고 (FIC 0.5), CCE 와 ampicillin 의병용처리시 MRSA 1, 2, 6, 7에서시너지효과를관찰할수있었다. 시너지효과는 CCE 와 oxacillin의병용효과가 ampicillin 과의병용효과보다더좋은것을확인하였다. 또한, reference 균주인 S. aureus ATCC 은 FIC와 FBC index 결과에서 oxacillin, ampicillin 모두시너지효과가없었고, 반면에 S. aureus ATCC 에서는시너지효과가확인되어 MRSA 균주특이적으로시너지효과가있음을확인할수있었다 (Table 2, 3). MRSA 는병원성감염의중요한원인균이고최근 VRSA 와같은슈퍼박테리아의증가로인해항균제내성의문제가심각하게대두되어천연물질을이용한항균물질을분리하기위한연구가활발하게진행되고있다. Zhao et al. (2001) 의보고에따르면녹차잎에서추출한 EGCg 추출물과 β-lactam 계항생제의 MRSA 시너지활성을확인할수있었고, Cha et al. (2014) 은단삼에서분리한 cyptotanshinone 에서분리한물질로 MRSA 와 VRSA 의시너지활성을본결과 oxacillin, ampicillin, vancomycin 에서항생제처리보다병용처리의항균활성이월등히높은것을확인하였다 (Cha et al., 2014). 또한 Ha (2009) 는녹나무부탄올분획물이멜라닌생합성에관여한다고보고하였고, Han (2011) 은메탄올추출녹나무의방충효과와 Klebsiella pneumoniae 의항균활성에효과가있다고보고하였다 (Ha et al., 2009; Han 2011). 본연구에서도 CCE을이용해항균활성과항생제시너지활성을보았고, 내성균이단독으로항생제나 CCE 에노출되었을때보다병용처리하였을때항균활성이높은것을확인하였으며, 그결과 β-lactam 계내성영향을미치지않는새로운약물개발을위한천연물질소재로제시할수있다고사료된다. 사사 본연구는산업통상자원부의 2011 년도지역특화기술융복합연구지원사업 ( 과제번호 : R ) 에의해수행되었습니다. 적요 메치실린내성황색포도상구균 (MRSA) 은가장중요한지역사회병원성균주의하나로서항생제내성문제가세계적으로대두되고있다. 감염치료에대한부작용과내성이적은새로운항생제의개발에많은관심과연구가필요하다. Cinnamomum camphora 는제주도에서자생하는녹나무과의식물이다. 민간에서는신경쇠약, 간질, 방광염, 신우신염, 당뇨, 암과당뇨병치료제로이용되고있다. 본연구에서는 80% 에탄올을이용하여녹나무잎을추출물하여임상에서분리한메치실린내성균주에대한항균활성을연구하였다. 그결과녹나무잎추출물에서높은항균활성을관찰할수있었고, 항생제와의병용처리녹나무잎추출물의 MIC 와 MBC 의범위는 μg / ml와 μg / ml로판독되었고, oxacillin 의병용처리의범위는 μg / ml와 μg / ml, 그리고 ampicillin 의병용처리범위는μg / ml와 μg / ml로판독되었다. 녹나무잎추출물과항생제의병용처리는 MRSA 항균활성에대한상승효과가높게나타났다. References Arnol, S.B. and J. Morrison Disparity between timed-kill and checkerboard methods for determination of in vitro bactericidal interactions of vancomycin plus rifampin versus methicillin-susceptible and -resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 26: Cha, J.D., M.R. Jeong, S.I. Jeong and K.Y. Lee Antibacterial actibity of sophoraflavanone G isolated from the roots of Sophora flavescens. J. Microbial. Biotechnol. 17(5): Cha, JD., J.H. Lee, K.M. Choi, S.M. Choi and J.H. Park Synergistic effect between cryptotanshinone and antibiotics against clinic methicillin and vancomycin-resistant Staphylococcus aureus. Evid. Based complement. Alternat. Med. 2014: Choi, J.H., M.H. Yu, E.Y. Hwang and I.S. Lee Effect of Rosmarinus officinalis L. fractions on antimicrobial activity against methicillin-resistant Staphylococcus aureus (MRSA) and resistant genes regulation. J. Korean Soc. Food Sci. Nutr. 38: Choi, I.L., J.Y. Cho and S.C. Lim Antimicrobial activity of medicinal herbs against Staphylococcus aureus. Korean J. Plant Res. 19(8): Domaracki, B.E., A.M. Evans and R.A. Venezia

7 Vancomycin and oxacillin synergy for methicillin-resistant Staphylococci. Antimicrob. Agents Chemother. 44(5): Ha, S.K., E.J. Moon, M.J. Lee, H.M. Park, E.S. Yoo, M.S. Oh and S.Y. Kim Effect of the BuOH soluble fraction of Cinnamomum camphora on melanin biosynthesis. Korean J. Medicinal Crop. Sci. 17(4): Han, J.H Studies on the effect of antimicrobial and antiinsecticidal activity from warm temperate zone species of tree. MS Thesis, Jeonbuk National Univ., Korea. Heo, B.G., Y.J. Park, S.J. Lee, K.S. Kim, J.Y. Cho and H.O. Boo Antioxidant enzyme activity and antimicrobial activity of Isatis tinctoria extract. Korean J. Plant Res. 25(5): Hwang, H.J., J.S. Yu, H.Y. Lee, D.J. Kwon, W. Han, S.I. Heo and S.Y. Kim Evaluations on deodorization effect and anti-oral microbial activity of essential oil from Pinus koraiensis. Korean J. Plant Res. 27(1):1-10. Kenneth, H.R. and J. H. Herbert Synergy of daptomycin with oxacillin and other-lactams against methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 48(8): Kim, S.M., D.C. Lee, S.D. Park, B.S. Kim, J.K. Kim, M.R. Choi, S.Y. Park, S.M. Hwang, N.Y. Shin, E.S. Shim, P.S. Kwon, D.Y. Kwon, S.H. Hur, H.J. Kim, H.B Lim and Y.S. Chong Genotype, coagulase type and antimicrobial susceptibility of methicillin-resistant Staphylococcus aureus isolated from dermatology patients and healthy individuals in Korea. J. Bacteriol. Virol. 39(4): Ko, B.S., M.Y. Lee, H.K. Kim, J.K. Chun, S.B. Choi, D.W. Jun, J.S. Jang and S.M. Park Effect of Cinnamomum camphora leaf fractions on insulin action. J. Korean Soc. Food Sci. Nutr. 34(9): Lee, J.W., Y.J. Ji, M.H. Yu, H.G. Im, M.H. Hwangbo and I.S. Lee Antimicrobial effect of extract of Glycyrrhiza uralensis on methicillin-resistant Staphylococcus aureus. Korean J. Food Sic. Technol. 37(3): Lee, Y.S., and J.D. Cha Synergistic antibacterial activity of Fig (Ficus carica) leaves extract against clinical isolates of methicillin-resistant Staphylococcus aureus. Kor. J. Microbiol. Biotechnol. 38(4): Lee, H.J Inhibitory effect of Cinnamomum camphora, Jeju native plant, on the Inflammatory biomarkers in RAW264.7 cells. MS Thesis, Jeju National Univ. Korea. Shin, S.H. and I.W. Seong Antimicrobial activity of the extracts from Paeonia japonica against methicillin-resistant Staphylococcus aureus. Korean J. Microbiol. 42(1): Stubbs, B.J., A Specht, D. Brushett Essential oil of cinnamomum camphora (L.) nees and eberm.-variation in oil composition throughtout the tree in two chemotypes from Eastern Australia. J. Essential Oil Res. 16: Lim, Y.J., Y.S. Cho and K.H. Oh Antibacterial synergic effect and cellular responses of nalidixic acid-resistant Salmonella typhimurium exposed to tea polyphenols and nalidixic acid. Korean J. Microbiol. 44(2): Zhao, W.H., Z.Q. Hu, S. Okubo, Y. Hara and T. Shimamura Mechanism of synergy between epigallocatechin gallate and β-lactams against methicillin-resistant Staphylococcus aureus. Antimicrob. Agent Chemother. 45(6): (Received 23 July 2014 ; Revised 9 January 2015 ; Accepted 9 February 2015) -15-

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

untitled

untitled 理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상 6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

개최요강

개최요강 55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

Microsoft Word - 05-김종배.doc

Microsoft Word - 05-김종배.doc J. Exp. Biomed. Sci. 11 (2005) 447 453 Patterns of Antimicrobial Resistance and Detection of meca Gene from Methicillin Resistant Staphylococcus aureus Isolated from Healthcare Facilities and U.S. Military

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의

목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의 K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

101~110 ¿õ´ã.¿ìȲ

101~110 ¿õ´ã.¿ìȲ 101 DOI : 10.3831/KPI.2010.13.2.101 Received : 10. 05. 06 Accepted : 10. 05. 27 The Experimental Study on the Effect of Fel Ursi & Bovis Calculus Pharmacopuncture Solution in Bacterial Species which cause

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

< FB5B5BAF1B6F32C20B8F1C2F D34292E687770>

< FB5B5BAF1B6F32C20B8F1C2F D34292E687770> Case Report J Sasang Constitut Med 2014;26(4):379-388 http://dx.doi.org/10.7730/jscm.2014.26.4.379 Abstract A Case Study of Soyangin Patient with Hyperhidrosis Treated Successfully with Hyungbangsabaek-san(

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

μ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2 (Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree

More information

< BFF8C0FA2D B9E8C7F6C1D62E687770>

< BFF8C0FA2D B9E8C7F6C1D62E687770> 대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,

More information

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( ) . 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).

More information

main.hwp

main.hwp 열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement

More information

<31332E28C7B0C1BE29B9E8BCAEBAB92E687770>

<31332E28C7B0C1BE29B9E8BCAEBAB92E687770> 韓 育 誌 (Korean J. Breed. Sci.) 40(2) : **~** (2008) 단경 내병 다수성 땅콩 품종 풍산 배석복 * 정영근 2 박장환 이명희 황정동 심강보 정찬식 강철환 박금룡 박충범 최규환 4 이재철 5 김인재 6 김제규 영남농업연구소, 2 호남농업연구소, 작물과학원, 4 전라북도노업기술원, 5 충청남도농업기술원, 6 충청북도 농업기술원,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

AA - Report Web - Results

AA - Report Web - Results LINE DANCE FEMALE PRIMARY NEWCOMER OverAll Pulse Cuban Street Stage 101 Ja Yeong Jeon 전자영 1 1 1 1 102 Seung Yun Cho 조승연 2 2 2 2 LINE DANCE FEMALE YOUTH NEWCOMER OverAll Pulse Cuban Street Stage 110 Seong

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 -

주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 - - 1 - 주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 - 식품소비구조의변화가국민건강에미치는영향 硏究責任者 : 孟元在 ( 自然第 2 分科 ) 共同硏究者 : 洪熙玉 ( 祥明大學校兼任敎授 ) 1. 서론 2. 연도별식품소비변화추이 - 3 - (g/ / ) 1970 1980 1990

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016)   ISSN 228 (JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method

More information

<3135C8A3B3EDB9AE303333312DBCF6C1A42E687770>

<3135C8A3B3EDB9AE303333312DBCF6C1A42E687770> 기업파티 공간연출 분석에 관한 연구 -국내 기업파티 사례 중심으로- A Study on the Analysis of Space Display for Company Party -Focusing on the parties of domestic companies- 백승범 / 100-스타일 대표 Paik Seung beom / 100-style President 김주연

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 18, No. 11 : 2593~2599 Nov. 2014 오픈소스 모바일 UI컴포넌트 선정 절차 프레임워크 손효정 1 이민규 2 성백민

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA J East Asian Soc Diet Life 27(3): 348 363 (2017) http://dx.doi.org/10.17495/easdl.2017.6.27.3.348 348 1 1 2 1 1, 2 Mixed Culture Characteristics of Fungi Strains isolated from Korean Traditional Nuruk

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

81 F Epigastric discomfort after meals for 3 hours

81 F Epigastric discomfort after meals for 3 hours Interesting EKG CASE 1-1 81 F Epigastric discomfort after meals for 3 hours 05, Cho SY, #3907730 Tn-T 0.01 ng/ml CK-MB 2.1 ng/ml BP 180/130 mmhg CASE 1-2 After 20 minutes 05, Cho SY, #3907730 CASE 1-3

More information

(....).hwp

(....).hwp sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

07변성우_ok.hwp

07변성우_ok.hwp 2 : (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.631 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a), b) Metadata Management System Implementation

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

t

t t t 4 Community Chest of Korea 5 6 Community Chest of Korea 7 Community Chest of Korea w w w. c h e s t. o r. k r 8 Community Chest of Korea * 9 * 1 0 Community Chest of Korea * 1 1 * 1 2 Community Chest

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

untitled

untitled Original Article Experiences of Unwed Mothers Choi, Yang-Ja 1) Kim, Kwuy-Bun 2) 1) Professor, Redcross College of Nursing, 2) Professor, Kyung Hee University, College of Nursing Science 1) 2) 1) 2) Purpose:

More information

PJTROHMPCJPS.hwp

PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770>

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770> 부산광역시보건환경연구원보제 14 권 (I), 15~27, 2004 Rep. Busan Inst. Health & Environ, Vol.14, 15~27, 2004 미생물과 이주현 Study on the Antimicrobial Susceptbility of Vibrio spp. Isolated from Environmental source and Patients

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

<B9AEC8ADB0E6C1A6BFACB1B820C1A63137B1C720C1A633C8A3283135303131332033C2F720BCF6C1A4BABB292E687770>

<B9AEC8ADB0E6C1A6BFACB1B820C1A63137B1C720C1A633C8A3283135303131332033C2F720BCF6C1A4BABB292E687770> 한국문화경제학회 문화경제연구 제17권 제3호, 2014년 12월, pp.189~223 드라마 제작 영유 기업들의 변화와 성장: 상장기업을 중심으로 7년간의 사업현황 검토 김 훈 * 김 정 훈 ** 목 차 Ⅰ. 서 론 Ⅱ. 국내 엔터테인먼트 시장규모 및 제작시장 현황 Ⅲ. 상장기업 경영 현황 조사결과 Ⅳ. 결론 및 시사점 한국 드라마산업은 한류를 이끄는 주요산업으로

More information