[00]_목차.hwp

Size: px

Start display at page:

Download "[00]_목차.hwp"

주은 변
5 years ago
Views:

1 Korean J. Plant Res. 28(1): (2015) Print ISSN Online ISSN Original Research Article 차정단 1, 최미래 1, 고은실 1, 황승미 1, 강제란 1, 오좌섭 2, 박영진 2, 정용환 3, 전아림 3, 최경민 1 * 1 ( 재 ) 진안홍삼연구소, 2 ( 재 ) 경기과학기술원천연물신약연구소, 3 ( 재 ) 제주테크노파크제주생물종다양성연구소 Synergistic Effects of Cinnamomum camphora Leaves Extract against Clinical Isolated Methicillin-resistant Staphylococcus aureus Jeong-Dan Cha 1, Mi-Rae Choi 1, Eun-Sil Ko 1, Seung-Mi Hwang 1, Jea-Ran Kang 1, Joa-Sub Oh 2, Young-Jin Park 2, Young-Hwan Jung 3, Ah-Lim Jeon 3 and Kyung-Min Choi 1 * 1 Institute of JinAn Red Ginseng, Jinan-Gun , Korea 2 Gyeonggi Institute of Science&Technology Promotion, Natural Products Research Institute, Suwon , Korea 3 Jeju Biodiverstiy Research Institute, Jeju Technopark, Seogwipo , Korea Abstract - Methicillin-resistant Staphylococcus aureus (MRSA) has been emerging worldwide as one of the most important hospital and community pathogens. At the same time, because of the difficulty in developing chemical synthetic drugs and because of their side-effects, scientists are making more efforts to search for new drugs from plant resources to combat clinical multidrug-resistant microbial infections. Cinnamomum camphora (C. camphora) is a plant of family Lauraceae, and grown Jeju island in South Korea that are used as a drug to treat neurasthenia, epilepsy, cystitis, pyelonephritis, digitalis, cancer, and diabetes mellitus in folk remedies. In this study, antibacterial activites of 80% ethanol extract of C. camphora leaves (CCE) were investigated in combination with antibiotics against clinical isolates of MRSA. The results showed that CCE was determined with MIC and MBC values ranging from 156 to 313 and 313 to 625 μg / ml, oxacillin from 128 to 256 and 128 to 512 μg / ml, ampicillin from 4 to 64 and 8 to 128 μg / ml. The combination of CCE with oxacillin or/and ampicillin were synergistic effect against MRSA 1, 6, 7, 8, 10, 11, 12, 13, and 15/ MRSA 1, 2, 6, and 7. Key words - Cinnamomum camphora, Methicillin-resistant Staphylococcus aureus, Synergistic effects 서언 Staphylococcus aureus (S. aureus) 는피부감염증, 식중독, 폐혈증둥여러감염을일으킬수있는주된병원성세균으로널리알려져있다 (Han, 2011) 년영국에서메치실린내성포도상구균 (methicillin-resistant Staphyloccus aureus, MRSA) 이처음보고된이후우리나라에서도 1980 년대들어서면서여러병원에서 MRSA 발생을보고하고있으며현재까지대표적인병원감염원인균중의하나이다 (Lee et al., 2005). 또한최근반코마이신내성포도상구균 (vancomycin-resistant Staphyloccus aureus,vrsa) 과같은슈퍼박테리아의출현으로항균제내성의문제가심각하게대 * 교신저자 ( ) : kyungmc@ijrg.re.kr These authors contributed equally to this works. 두된가운데전통적으로감염질환치료에사용되어온식물로부터항균물질을분리하기위한연구가활발히진행되고있다 (Shin and Seong, 2006; Heo et al., 2012; Hwang et al., 2014). 녹나무 (Cinnamomum camphora) 는 Lauraceae 과로난대성기후에서만자라는나무로겨울에도잎이떨어지지않는상록활엽수이다 (Han, 2011). 또한천연기념물제162 호로국내에서는제주도에서주로자생하며지리적으로는일본, 중국, 대만, 인도네시아에분포한다 (Ko et al., 2005). 재목, 가지, 잎, 뿌리를말려수증기로증류시켜얻은기름을장뇌라고하며, 장뇌에는정유성분인 camphor 가주성분이고 cineol, α-pinene, l-camphene, d-limonene, safrol, α-camphorene 등이함유되어있다 (Stubbs et al., 2004). 가지와뿌리는강심제를만드는약의원료가되고, 잎은서양요리의소스를만들때사용하기도하며민간에서는방해충, 신경쇠약, 간질, 방 c 본학회지의저작권은 ( 사 ) 한국자원식물학회지에있으며, 이의무단전재나복제를금합니다. This is an Open-Access article distributed under the terms of the Creative Commons -9- Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 韓資植誌 Korean J. Plant Res. 28(1) : 009~015(2015) 광염, 신우신염, 강심제로도알려져있고, 제주도에서는당뇨, 암치료약으로사용되어왔다 (Lee, 2003). 다방면에이용되고있는녹나무추출물의 MRSA 항균활성과항생제병용처리후시너지효과를확인하고천연항생제로서의이용가능성을제시하고자한다. 재료및방법천연물확보및추출 본실험에사용된재료는제주지역에서채집하여대한식물도감을참고하여동정하였으며, 실험에사용된녹나무 (Voucher No. JBRI ) 의증거표본은제주생물종다양성연구소표본실에보관하였다. 동정된녹나무잎은음건후믹서기로분쇄하여 80% 에탄올로실온에서 24시간 3회추출하여동결건조후냉동보관하였으며, 실험전 10% Dimethyl sulfoxide (DMSO, Sigma-Aldrich, MO, USA) 에녹여 0.22 mm (Merck millipore, France) 로필터후멸균증류수로농도별희석하여실험하였다. MRSA 분리및동정전라북도의한대학병원의임상샘플을받아 Mannitol Salt Agar (MSA, Sigma-Aldrich) 에 2 mg / ml oxacillin (Sigma-Aldrich) 이첨가된배지에접종하여노란색집락으로변한집락을찾아 1차스크리닝하였다. MRSA 확인동정을위해서는 fema 유전자와 penicillinbinding protein (PBP) 2` (Choi et al., 2009) 을생성하는 meca 유전자를 PCR 법으로시험하였다. Tryptic soy agar (TSA, Becton Dickinson, NJ, USA) 배지에접종하여 37, 호기성배양기에서 18 시간배양한집락을, QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) 를사용하여주형 DNA를분리하였다. 사용된 primer 의염기서열은 Table 1과같으며, Cosmogene Co. (Daejeon, Korea) 에의뢰하여합성하였다. Forward 와 reverse primer를각각 1 ml, PCR mastermix (Bioneer, Korea) 4 ml, DEPC 12 ml, 주형 DNA 2 ml를넣어 PCR 반응의최종액을 20 ml로하였다. PCR 반응은 thermal cycler (Abcam, CA, USA) 를사용하였으며, 위의 2개의유전자증폭조건은 95 5분간 predenaturation, 95 30초 denaturation, 50 annealing 30 초, 72 extention 30 초로 30회반복하 여, 72 5분 last extention 시킨후 4 에서종료시켰다. 반응후 1.5% agarose gel (Lonza, NJ, USA) 에서전기영동하여 ethidium bromide (EtBr, Invitrogen, NY, USA) 로염색한후결과를확인하였다. MRSA 로최종동정된균주는 30% glycerol 이첨가된 Brain Heart Infusion (BHI, Becton Dickinson) broth에풀어 -70 에보관하였다 (Kim et al., 2009). Minimum Inhibitory Concentrations (MICs)/Minimum Bactericidal Concentrations (MBCs) 임상에서분리된 MRSA 균주의녹나무잎추출물 (80% EtOH cinamomum camphora leaves extract, CCE) 과항생제의 minimum inhibitory concentrations (MICs) 는 broth dilution method 로측정하였다. MIC 측정은 Mueller Hinton borth (MHB, Becton Dickinson) 에항생제와 CCE 를단계희석한후, 균의최종희석농도를 CFU/ ml로하여 37 18시간배양후 540 nm에서흡광도를측정하여판독하였다. MIC 농도를기준으로증식하지않은배양액 100 ml를 TSA 에균일하게도말하여 37 18시간배양후 99.9% 살균이되는농도로 MBC 를판독하였다. Checkboard Dilution Assay CCE와 β-lactam 계의항생제인 oxacillin과 ampicillin의 synergistic effect를 checkbord dilution method 로확인하였다 (Arnold and Morrison, 1984; Cha et al., 2014). 각천연물과항생제의혼합에따른 fractional inhibitory concentration (FIC) 와 fractional bactericidal concentration (FBC) 는다음과같이계산하였다. FIC A = MIC A in combination / MIC A FIC B = MIC B in combination / MIC B FIC Index = FIC A + FIC B FBC A = MBC A in combination / MBC A FBC B = MBC B in combination / MBC B FBC Index = FBC A + FBC B Table 1. Primers used for detection of the meca and fema genes from S. aureus Gene Orientation Primer Oligonucleotide sequence (5'-3') PCR product size meca meca-f ATGAGATTAGGCATCGTTTC meca-r TGGATGACAGTACCTGAGCC 554 bp fema fema-f CATGATGGCGAGATTACAGG fema-r CGCTAAAGGTACTAACACACGG 372 bp -10-

3 FIC index 0.5 이하 synergistic, 0.5에서 1사이 additive, 1 에서 2 사이 indifference, 2 이상일경우 antagonism 으로해석하였다 (Cha et al., 2007; Lee and Cha, 2010; Cha et al., 2014). 결과및고찰 MRSA 동정 2 μg / ml의 oxacillin이첨가된 MSA 에서노란색집락이생성된 15 균주에서 fema, meca 의유전자를검출한결과 15균주모든샘플에 서 S. aureus 를확인동정하는 fema 유전자를확인할수있었고, PBP 2`을생성하는 meca 유전자또한확인하였다 (Fig. 1). 항생제와 CCE 와병용처리후항생제내성균주의시너지효과본시험에사용된임상에서분리된 MRSA 에대한 CCE의 MIC, MBC 범위는 μg / ml, μg / ml였고, oxacillin 의 MIC, MBC 범위는 μg / ml, μg / ml, ampicillin의위는 MIC 와 MBC 모두 μg / ml였다 (Table 2). Fig. 1. Agarose gel electrophoresis of amplified 372-bp, 554-bp DNA fragments of the fema, meca genes of S. aureus isolates by PCR. Table 2. Antibacterial activity of ethanol extract of C. camphora leaves on isolates MRSA and reference strains Samples CCE Ampicillin Oxacillin MIC/MBC ( μg / ml ) MSSA ATCC z 625/ / /0.25 MRSA ATCC y 625/ / /512 MRSA 1 x 625/625 32/32 512/512 MRSA 2 625/625 32/32 512/512 MRSA 3 313/625 32/32 512/512 MRSA 4 313/625 32/32 512/512 MRSA 5 313/625 32/32 512/512 MRSA 6 625/625 32/32 512/512 MRSA 7 625/ /32 512/1024 MRSA 8 625/ / /1024 MRSA 9 625/625 64/ /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 MRSA / / /1024 z MSSA (ATCC 25923): reference strain Methicillin-sensitive Staphylococcus aureus. y MRSA (ATCC 33591): reference strain Methicillin-resistant Staphylococcus aureus. x MRSA (1-15): Methicillin-resistant Staphylococcus aureus isolated a clinic. -11-

4 韓資植誌 Korean J. Plant Res. 28(1) : 009~015(2015) Table 3. Synergistic effects of the ethanol extract of C. camphora leaves with oxacillin on isolates MRSA and reference strains Strains Agent MIC/MBC ( μg / ml ) Alone Combination z MSSA ATCC x CCE 625/ / /1.0 Oxacillin 0.25/ / /0.5 MRSA ATCC33591 w CCE 625/ / /0.25 Oxacillin 512/ / /0.5 MRSA 1 v MRSA 2 MRSA 3 MRSA 4 MRSA 5 MRSA 6 MRSA 7 MRSA 8 MRSA 9 MRSA 10 MRSA 11 MRSA 12 MRSA 13 MRSA 14 MRSA 15 CCE 313/ / /0.5 CCE 313/ / /0.5 CCE 313/ / /0.5 Oxacillin 512/ / /0.25 Oxacillin 1024/ / /0.5 CCE 625/ / /0.25 CCE 1250/ / /0.5 CCE 625/ / /0.25 Oxacillin 1024/ / /0.5 CCE 1250/ / /0.25 Oxacillin 512/ / /0.25 z The MIC and MBC of CCE with ampicillin. y the FIC index. x MSSA (ATCC 25923): reference strain Methicillin-sensitive Staphylococcus aureus. w MRSA (ATCC 33591): reference strain Methicillin-resistant Staphylococcus aureus. v MRSA (1-15): Methicillin-resistant Staphylococcus aureus isolated a clinic. FIC/FBC FICI/FBCI y Outcome 1.0/1.5 Indifference/Indifference 0.5/1 Synergistic/Additive -12-

5 Table 4. Synergistic effects of the ethanol extract of C. camphora leaves with ampicillin in isolated MRSA and reference MSSA and MRSA strains Strains Agent MIC/MBC( μg / ml ) Alone combination z MSSA ATCC x CCE 625/ / /1 Ampicillin 1.25/ / /0.5 MRSA ATCC33591 w MRSA 1 v Ampicillin 32/32 8/ /0.5 MRSA 2 MRSA 3 MRSA 4 MRSA 5 MRSA 6 MRSA 7 MRSA 8 MRSA 9 MRSA 10 MRSA 11 MRSA 12 MRSA 13 MRSA 14 MRSA 15 CCE 625/ / /0.25 CCE 313/625 78/ /0.5 CCE 313/ / /0.25 CCE 313/625 78/ /0.5 Ampicillin 32/32 8/ /0.5 CCE 625/ / /0.25 CCE 625/ / /0.25 Ampicillin 64/128 32/32 0.5/0.25 CCE 625/ / /0.25 Ampicillin 64/64 16/ /0.5 CCE 1250/ / /0.5 Ampicillin 256/256 64/ /0.5 CCE 625/ / /0.5 z The MIC and MBC of CCE with ampicillin. y the FIC index. x MSSA (ATCC 25923): reference strain Methicillin-sensitive Staphylococcus aureus. w MRSA (ATCC 33591): reference strain Methicillin-resistant Staphylococcus aureus. v MRSA (1-15): Methicillin-resistant Staphylococcus aureus isolated a clinic. FIC/FBC FICI/FBCI y Outcome 1/1.5 Additive/Indifference 0.5/1 Synergistic/Additive 0.75/0.5 Additive/Synergistic 0.5/1 Synergistic/Additive 0.75/0.5 Additive/Synergistic 0.75/1 Additive/Additive -13-

6 韓資植誌 Korean J. Plant Res. 28(1) : 009~015(2015) CCE 와 oxacillin의병용처리결과는 CCE 에서 MIC 와 MBC 의범위는 μg / ml와 μg / ml이고, oxacillin에서는 MIC 와 MBC 의범위는 μg / ml와 μg / ml로나타났으며, CCE와 oxacillin 의단독처리시보다병용처리시항균활성이높은것을확인할수있었다 (Table 3, 4). CCE 와 ampicilin 병용처리시 CCE의 MIC 와 MBC 의범위는 μg / ml와 μg / ml이고, ampicillin 에서는 MIC와 MBC 의범위는 4-64 μg / ml와 μg / ml로나타났으며, ampicillin과 CCE 와의병용처리역시높은항균활성을확인할수있었다. 또한, FIC index 와 FBC index 로계산하여판독한결과 CCE 와 oxacillin의병용처리는 MRSA 2, 3, 4, 5, 9, 14를제외한 MRSA 에서 synergistic 효과를확인하였고 (FIC 0.5), CCE 와 ampicillin 의병용처리시 MRSA 1, 2, 6, 7에서시너지효과를관찰할수있었다. 시너지효과는 CCE 와 oxacillin의병용효과가 ampicillin 과의병용효과보다더좋은것을확인하였다. 또한, reference 균주인 S. aureus ATCC 은 FIC와 FBC index 결과에서 oxacillin, ampicillin 모두시너지효과가없었고, 반면에 S. aureus ATCC 에서는시너지효과가확인되어 MRSA 균주특이적으로시너지효과가있음을확인할수있었다 (Table 2, 3). MRSA 는병원성감염의중요한원인균이고최근 VRSA 와같은슈퍼박테리아의증가로인해항균제내성의문제가심각하게대두되어천연물질을이용한항균물질을분리하기위한연구가활발하게진행되고있다. Zhao et al. (2001) 의보고에따르면녹차잎에서추출한 EGCg 추출물과 β-lactam 계항생제의 MRSA 시너지활성을확인할수있었고, Cha et al. (2014) 은단삼에서분리한 cyptotanshinone 에서분리한물질로 MRSA 와 VRSA 의시너지활성을본결과 oxacillin, ampicillin, vancomycin 에서항생제처리보다병용처리의항균활성이월등히높은것을확인하였다 (Cha et al., 2014). 또한 Ha (2009) 는녹나무부탄올분획물이멜라닌생합성에관여한다고보고하였고, Han (2011) 은메탄올추출녹나무의방충효과와 Klebsiella pneumoniae 의항균활성에효과가있다고보고하였다 (Ha et al., 2009; Han 2011). 본연구에서도 CCE을이용해항균활성과항생제시너지활성을보았고, 내성균이단독으로항생제나 CCE 에노출되었을때보다병용처리하였을때항균활성이높은것을확인하였으며, 그결과 β-lactam 계내성영향을미치지않는새로운약물개발을위한천연물질소재로제시할수있다고사료된다. 사사 본연구는산업통상자원부의 2011 년도지역특화기술융복합연구지원사업 ( 과제번호 : R ) 에의해수행되었습니다. 적요 메치실린내성황색포도상구균 (MRSA) 은가장중요한지역사회병원성균주의하나로서항생제내성문제가세계적으로대두되고있다. 감염치료에대한부작용과내성이적은새로운항생제의개발에많은관심과연구가필요하다. Cinnamomum camphora 는제주도에서자생하는녹나무과의식물이다. 민간에서는신경쇠약, 간질, 방광염, 신우신염, 당뇨, 암과당뇨병치료제로이용되고있다. 본연구에서는 80% 에탄올을이용하여녹나무잎을추출물하여임상에서분리한메치실린내성균주에대한항균활성을연구하였다. 그결과녹나무잎추출물에서높은항균활성을관찰할수있었고, 항생제와의병용처리녹나무잎추출물의 MIC 와 MBC 의범위는 μg / ml와 μg / ml로판독되었고, oxacillin 의병용처리의범위는 μg / ml와 μg / ml, 그리고 ampicillin 의병용처리범위는μg / ml와 μg / ml로판독되었다. 녹나무잎추출물과항생제의병용처리는 MRSA 항균활성에대한상승효과가높게나타났다. References Arnol, S.B. and J. Morrison Disparity between timed-kill and checkerboard methods for determination of in vitro bactericidal interactions of vancomycin plus rifampin versus methicillin-susceptible and -resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 26: Cha, J.D., M.R. Jeong, S.I. Jeong and K.Y. Lee Antibacterial actibity of sophoraflavanone G isolated from the roots of Sophora flavescens. J. Microbial. Biotechnol. 17(5): Cha, JD., J.H. Lee, K.M. Choi, S.M. Choi and J.H. Park Synergistic effect between cryptotanshinone and antibiotics against clinic methicillin and vancomycin-resistant Staphylococcus aureus. Evid. Based complement. Alternat. Med. 2014: Choi, J.H., M.H. Yu, E.Y. Hwang and I.S. Lee Effect of Rosmarinus officinalis L. fractions on antimicrobial activity against methicillin-resistant Staphylococcus aureus (MRSA) and resistant genes regulation. J. Korean Soc. Food Sci. Nutr. 38: Choi, I.L., J.Y. Cho and S.C. Lim Antimicrobial activity of medicinal herbs against Staphylococcus aureus. Korean J. Plant Res. 19(8): Domaracki, B.E., A.M. Evans and R.A. Venezia

7 Vancomycin and oxacillin synergy for methicillin-resistant Staphylococci. Antimicrob. Agents Chemother. 44(5): Ha, S.K., E.J. Moon, M.J. Lee, H.M. Park, E.S. Yoo, M.S. Oh and S.Y. Kim Effect of the BuOH soluble fraction of Cinnamomum camphora on melanin biosynthesis. Korean J. Medicinal Crop. Sci. 17(4): Han, J.H Studies on the effect of antimicrobial and antiinsecticidal activity from warm temperate zone species of tree. MS Thesis, Jeonbuk National Univ., Korea. Heo, B.G., Y.J. Park, S.J. Lee, K.S. Kim, J.Y. Cho and H.O. Boo Antioxidant enzyme activity and antimicrobial activity of Isatis tinctoria extract. Korean J. Plant Res. 25(5): Hwang, H.J., J.S. Yu, H.Y. Lee, D.J. Kwon, W. Han, S.I. Heo and S.Y. Kim Evaluations on deodorization effect and anti-oral microbial activity of essential oil from Pinus koraiensis. Korean J. Plant Res. 27(1):1-10. Kenneth, H.R. and J. H. Herbert Synergy of daptomycin with oxacillin and other-lactams against methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 48(8): Kim, S.M., D.C. Lee, S.D. Park, B.S. Kim, J.K. Kim, M.R. Choi, S.Y. Park, S.M. Hwang, N.Y. Shin, E.S. Shim, P.S. Kwon, D.Y. Kwon, S.H. Hur, H.J. Kim, H.B Lim and Y.S. Chong Genotype, coagulase type and antimicrobial susceptibility of methicillin-resistant Staphylococcus aureus isolated from dermatology patients and healthy individuals in Korea. J. Bacteriol. Virol. 39(4): Ko, B.S., M.Y. Lee, H.K. Kim, J.K. Chun, S.B. Choi, D.W. Jun, J.S. Jang and S.M. Park Effect of Cinnamomum camphora leaf fractions on insulin action. J. Korean Soc. Food Sci. Nutr. 34(9): Lee, J.W., Y.J. Ji, M.H. Yu, H.G. Im, M.H. Hwangbo and I.S. Lee Antimicrobial effect of extract of Glycyrrhiza uralensis on methicillin-resistant Staphylococcus aureus. Korean J. Food Sic. Technol. 37(3): Lee, Y.S., and J.D. Cha Synergistic antibacterial activity of Fig (Ficus carica) leaves extract against clinical isolates of methicillin-resistant Staphylococcus aureus. Kor. J. Microbiol. Biotechnol. 38(4): Lee, H.J Inhibitory effect of Cinnamomum camphora, Jeju native plant, on the Inflammatory biomarkers in RAW264.7 cells. MS Thesis, Jeju National Univ. Korea. Shin, S.H. and I.W. Seong Antimicrobial activity of the extracts from Paeonia japonica against methicillin-resistant Staphylococcus aureus. Korean J. Microbiol. 42(1): Stubbs, B.J., A Specht, D. Brushett Essential oil of cinnamomum camphora (L.) nees and eberm.-variation in oil composition throughtout the tree in two chemotypes from Eastern Australia. J. Essential Oil Res. 16: Lim, Y.J., Y.S. Cho and K.H. Oh Antibacterial synergic effect and cellular responses of nalidixic acid-resistant Salmonella typhimurium exposed to tea polyphenols and nalidixic acid. Korean J. Microbiol. 44(2): Zhao, W.H., Z.Q. Hu, S. Okubo, Y. Hara and T. Shimamura Mechanism of synergy between epigallocatechin gallate and β-lactams against methicillin-resistant Staphylococcus aureus. Antimicrob. Agent Chemother. 45(6): (Received 23 July 2014 ; Revised 9 January 2015 ; Accepted 9 February 2015) -15-

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar