Microsoft Word - 4-Effects of Tiamulin on Starry Flounder, Platichthys stellatus Infected with Streptococcus parauberis HFTC008
|
|
- 여정 상
- 5 years ago
- Views:
Transcription
1 JMLS [Journal of Marine Life Science] June 2019; 4(1): [ 보문 ] Tiamulin 이 Streptococcus parauberis HFTC0083 에감염된강도다리 (Platichthys stellatus) 에미치는영향 주민수 1 김보성 2 김도형 2 서정수 3 권문경 3 지보영 3 박찬일 1* 1 경상대학교해양과학대학해양생명과학과 2 부경대학교수산생명의학과 3 국립수산과학원수산방역과 Effects of Tiamulin on Starry Flounder, Platichthys stellatus Infected with Streptococcus parauberis HFTC0083 Min-Soo Joo 1, Boseong Kim 2, Do-Hyung Kim 2, Jung-Soo Seo 3, Mun-Gyeong Kwon 3, Bo-Young Jee 3, Chan-Il Park 1* 1 Institute of Marine Industry, Department of Marine Biology and Aquaculture, College of Marine Science, Gyeongsang National University, Gyengsangnam-do 53064, Korea 2 Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea 3 Aquatic Life Disease Control Division, National Institute of Fisheries Science, Busan 46083, Korea Corresponding Author Chan-Il Park Institute of Marine Industry, Department of Marine Biology and Aquaculture, College of Marine Science, Gyeongsang National University, Gyengsangnam-do 53064, Korea vinus96@hanmail.net Received : May 21, 2019 Revised : May 23, 2019 Accepted : June 11, 2019 수산양식산업에서발생하는다제내성균에의한질병을통제하기위해기존에사용하던수산용의약품대신어류에사용이금지된동물용의약품사용이증가하고있다. 그중, 티아물린은그람양성균에효과적인항균성을나타내기때문에일부양식어가에서불법적으로사용되고있다. 불법적사용을막기위해서는티아물린의수산동물에대한연구를통해수의사나수산질병관리사의처방전에따라수산생물의치료행위가수반되어야한다. 연쇄구균에감염된강도다리에대해티아물린을 5, 10, 15 mg kg -1 의농도로근육주사하였으나치료효과가나타나지않았고 15, 30 mg kg -1 의농도로경구투여하였으나마찬가지로치료효과가미비하였다. 안전성확인을위해 30, 60 mg kg -1 의농도로근육주사와경구투여한경우항생제의독성에의한폐사가발생하였고따라서연쇄구균에감염된강도다리에티아물린으로항생제처리를하는것은부적절하다고할수있다. In order to control disease caused by multi-drug resistant bacteria in the aquaculture, the use of veterinary antibiotics, which are prohibited to fish, is increasing, instead of the existing fisheries antibiotics. Among them, tiamulin is illegally used in some cultured fish because it exhibits effective antibacterial activity against Gram-positive bacteria. To prevent unauthorized use, treatment of fish should be accompanied by a prescription from veterinarians or fisheries disease managers through research on fish of tiamulin. Tiamulin was injected intramuscularly at 5, 10 and 15 mg kg -1 for the streptococcusinfected starry flounder, but did not show any therapeutic effect. Oral administration at a concentration of 15 and 30 mg kg -1 was similarly ineffective. The concentrations of 30 and 60 mg kg -1 resulted in death due to toxicity of antibiotics. Therefore, it is inappropriate to treat antibiotics with streptococcus-infected starry flounder. Keywords: Tiamulin( 티아물린 ), Starry flounder( 강도다리 ), Streptococcus parauberis( 연쇄구균 ), Efficacy( 유효성 ), Safety( 안전성 )
2 30 주민수 김보성 김도형 서정수 권문경 지보영 박찬일 서론 전세계적으로양식산업이급성장함에따라양식생물의질병발생도증가하게되었고양식현장에서수산용의약품의사용빈도또한증가하고있다. 수산용의약품의오 남용으로인해내성균이출현하게되고 (Smith et al., 1994) 양식생물의안전성과수산식품의공중위생학적안전성에심각한문제를일으키기도한다 (Katz and Brady, 2000). 기존의수산용의약품에내성을가지는균주를억제하기위해서는새로운의약품을사용하여야한다. 현재포유류나가금류에사용하고있는동물용의약품들중에서어류에질병을일으키는세균에도좋은치료효과를나타내는항생제들은수의사로부터처방받고구매하여어류에도사용할수있다. 하지만이동물용의약품들은어종별, 항생제별로적절한용량과용법이정해져있지않고, 수산질병관리사를통한처방과구매가불법인상황이다. 그럼에도불구하고, 일부양식어가에서불법적으로동물용의약품을사용하는사례가발생하고있다. Pleuromutilin은담자균류인 Pleurotus mutilus에서처음발견되었고 (Kavanagh et al., 1951), pleuromutilin 으로부터반합성된 tiamulin 은세균 ribosome 의 50S subunit 을타겟으로하여 peptidyl transferase center에서세포벽합성을억제하여정균활성을나타낸다고알려져있다 (Bøsling et al., 2003). Tiamulin 은 Mycoplasma gallisepticum, M. synoviae, M. meleagridis 그리고 M. iowae와같은 Mycoplasma 균주들에강한항균활성을나타내며그람양성균에도좋은항균성을나타내지만그람음성균에는비교적약한활성을나타낸다 (Werner et al., 1978; Messier et al., 1990). Tiamulin 은돼지와가금류의이질, 폐렴, mycoplasma 감염에대한치료제로써축산농가에서주로사용되고있으며, 돼지의장관전염병으로써대장의염증과혈액성하리가특징인돈적리에효과적이다. Streptococcus parauberis 는우리나라강도다리양식현장에서여름철고수온기에많은피해를입히는원인균주로써 (Woo and Park, 2013) S. parauberis 에감염된어류는외부증상으로출혈과농양을동반한안구돌출, 체색흑화등이나타나고내부증상으로는비장과간의비대, 복부와복벽의점상출혈등이나타난다고알려져있다 (Doménech et al., 1996). 이번연구에서는우리나라의강도다리양식현장에서발생하는주요한질병인연쇄구균병에대한치료제로써 tiamulin 의유효성과안전성에관한연구를수행하였다. 연쇄구균에감염된강도다리에다양한농도별, 방법별로항생제를투여하여나타나는치료효과를확인하였으며, 고농도로 tiamulin 을투여하여강도다리의내부조직에항생제가어떤영향을미치는지확인하여수산용항생제로써의적용가능성을검토해보았다. 재료및방법 1. 실험어 강도다리는경상북도포항소재의한양식장으로부터구입하였으며 S. parauberis 에감염된이력이없는것을사용하였다. 농도별근육주사실험에사용된강도다리는평균체장 12.3 ± 0.8 cm, 평균체중 38.2 ± 2.3 g이었으며농도별경구투여실험과근육주사와경구투여후안전성검사에사용된강도다리는평균체장 10.5 ± 0.7 cm, 평균체중 29.6 ± 1.3 g이었다. 실험에사용하기전일주일간 250 l의유수식수조에순치하였다. 수조의유수량은수조당 1.44 l/min 이었고지속적인유수를통하여수질을유지하였다. 2. 항생제근육주사용 tiamulin 은엘캄코바이오사의바이오- 티아물린 10% 주 ( 본제 1 ml 중 tiamulin hydrogen fumarate 100 mg 함유 ) 를사용하였으며경구투여용 tiamulin 은 ( 주 ) 우진B&G 의데나가드39( 본제 1 kg 중 tiamulin hydrogen fumarate 39 g 함유 ) 를사용하였다. 3. 균주 2015년에경상북도영덕의한양식장에서연쇄구균에감염된강도다리로부터분리된 S. parauberis HFTC0083 균주를사용하여인위감염실험을진행하였다. 사용균주는 1% NaCl이첨가된 Brain Heart Infusion Agar (BHIA; Difco., USA) 증균배지를사용하여 27 에서 24시간배양하였고배양된균주는인위감염에사용하였다. 균주는실험에사용될때까지 -80 에보관하였다. 인위감염후폐사하는개체의신장과비장으로부터균을재분리하여동정하기위해특이적인 primer (Mata et al., 2004) 를이용한 polymerase chain reaction (PCR) 방법으로동정하였으며 PCR 조건은 94 에서 2분간 initial denaturation 하고, 후에 92 에서 1분, 55 에서 1분, 72 에 1분 30초를 1회로하여총 25회반응시켰으며, 마지막으로 72 에서 5분간 final extension 하였다 (Table 1). 4. 근육주사의농도별유효성조사강도다리에대한 tiamulin 의근육주사농도별유효성을확인하기위하여 Joo et al. (2019) 의연구에서기술한방법을참고하여실험을진행하였다. 실험수온은 24~25 를유지하였으며, PBS에현탁시킨 S. parauberis HFTC0083 균주를어체당 CFU 의농도로 100 μl를피하주사하여인위감염을실시하였다. 인위감염을실시한지 24시간후에주사용 tiamulin 을어체중 (kg) 당각각 5, 10, 15 mg이되도록 PBS에희석하여 100 μl를등근육에주사하였
3 15 June 2019; 4(1): Tiamulin 이연쇄구균에감염된강도다리 (Platichthys stellatus) 에미치는영향 31 Table 1. Specific primers for S. parauberis detection Primer Sequences (5' 3') Target gene Product size (bp) Spa2152 Spa2870 TTTCGTCTGAGGCAATGTTG GCTTCATATATCGCTATACT 23s rrna 718 다. 음성대조구는세균접종대신 PBS를동량피하주사하고 24시간후에항생제대신 PBS를동량근육주사하였다. 양성대조구는인위감염을실시하였고 24시간후에항생제대신 PBS를동량근육주사하였다. 대조구는각각 12마리, 실험구는각각 24마리의강도다리를사용하였다. 인위감염후 2주간폐사율을관찰하였으며 15일째에각실험수조의생존한개체들을마취시킨후해부하고신장을 0.1 g (ml) 적출한뒤 PBS와함께마쇄하여단계희석하고 BHIA 배지에도말하여감염률을확인하였다. 5. 경구투여의농도별유효성조사 강도다리에대한 tiamulin 의경구투여농도별유효성을확인하기위하여 Joo et al. (2019) 의연구에서기술한방법을참고하여실험을진행하였다. 실험수온과인위감염조건은근육주사농도별유효성확인실험과같은조건으로진행되었다. 앞선실험에서결정된최적농도와 2배농도로설정하여실험을진행하였다. 인위감염을실시한지 24시간후에경구투여용 tiamulin 을어체중 (kg) 당각각 15, 30 mg이되도록 PBS에희석하였고 100 μl를 zonde 를사용하여 5일간 1일 1회경구투여하였다. 각실험구당 20마리의강도다리를사용하였다. 인위감염후 2주간폐사율을관찰하였으며 15일째에생존한개체들의감염률을확인하였다. 6. 근육주사와경구투여후강도다리의안전성분석 Tiamulin 이어체에미치는영향을확인하기위하여 Joo et al. (2019) 의연구에서기술한방법을참고하여병리조직학적분석을진행하였다. PBS를 100 μl 근육주사또는경구투여한대조구, 근육주사용 tiamulin 을 PBS에희석하여 15, 30, 60 mg kg -1 의농도로 100 μl 근육주사한세가지실험구와경구투여용 tiamulin 을 PBS 에희석하여 15, 60 mg kg -1 의농도로 100 μl 경구투여한두가지실험구로나누었고각실험구당 20마리의실험어를사용하였다. 근육주사는 1회실시하였으며 24시간동안나타나는폐사율을확인하였다. 경구투여는 5일간 1일 1회투여하였으며경구투여한지 0( 대조구 ), 1, 2, 4, 7, 14, 21일후에각수조에서 3마리씩무작위로선택하여마취하고해부하여간, 신장, 근육조직을적출하였다. 적출한조직을 10% 중성포르말린용액에전고정하였고세절한후동일한고정액에후고정하였으며 70% 에서 100% 에탄올로순 차적인탈수, xylene 으로투명화, paraplast 로치환과정을통하여각장기를 4 μm 두께로절편제작하여 H&E 염색을실시하였다. 그후에염색된장기절편들은광학현미경상에서 400배율로관찰하였다. 관찰하여나타나는병적증상은정도에따라정상, 경도, 중등도, 심도로구분하였다. 결과 1. 근육주사의농도별유효성 최초폐사는 15 mg kg -1 실험구에서발생하였고 day post challenge (DPC) 1에서 8.3% 의폐사율을보였다. 양성대조구와 5 mg kg -1 실험구의최종누적폐사율은 92% 로나타났고 10 mg kg -1 실
4 32 주민수 김보성 김도형 서정수 권문경 지보영 박찬일 Table 2. The cumulative mortality and infection rate in survival fish of efficacy studies of injection method in S. parauberis HFTC0083 infected starry flounder by tiamulin dosing concentration Group Con (-) Con (+) 5 mg kg mg kg mg kg -1 Cumulative mortality (%) Infection rate (%) in survival fish 0 (0/10) 0 (0/2) 0 (0/2) - 0 (0/1) Table 3. The cumulative mortality and infection rate in survival fish of efficacy studies of oral administration method in S. parauberis HFTC0083 infected starry flounder by tiamulin dosing concentration Group Con (-) Con (+) 15 mg kg mg kg -1 Cumulative mortality (%) Infection rate (%) in survival fish 0 (0/10) 100 (1/1) 0 (0/1) - 험구의폐사율은 100%, 15 mg kg -1 실험구의폐사율은 96% 로확인되었다. 음성대조구에서는 15일간폐사가나타나지않았다 (Fig. 1). 실험종료후생존한개체들의감염률확인결과, 감염된개체는없었다 (Table 2). 2. 경구투여의농도별유효성 최초폐사는양성대조구와 30 mg kg -1 실험구에서발생하였다. 양성대조구와 15 mg kg -1 실험구의최종누적폐사율은 95% 로나타났고 30 mg kg -1 실험구의경우 100% 의폐사율이확인되었다. 음성대조구에서는 15일간폐사가나타나지않았다 (Fig. 2). 실험종료후생존한개체들의감염률확인결과, 양성대조구에서는 100% 로나타났고음성대조구와 15 mg kg -1 실험구는 0% 로확인되었다 (Table 3).
5 15 June 2019; 4(1): Tiamulin 이연쇄구균에감염된강도다리 (Platichthys stellatus) 에미치는영향 근육주사와경구투여후강도다리의안전성근육주사 24시간후 30 mg kg -1 실험구의폐사율은 25% 로나타났고 60 mg kg -1 실험구의폐사율은 60% 로나타났다 (data not shown). 경구투여한실험구에서는 60 mg kg -1 실험구에서 3일차에 1마리, 4일차에 2마리의폐사가발생하였다. 조직검사결과모든실험구에서지방간이관찰되었고 (Fig. 3-9) 신장에서는모든실험구에서전반적으로경도의조혈활성이나타났고 (Fig. 3-9) 15 mg kg -1 실험구에서는 1일차 (Fig. 4-q), 2일차 (Fig. 5-k) 에서중등도의조혈활성이관찰되었다. 60 mg kg -1 실험구에서는 1일차 (Fig. 4-t, w) 와 4일차 (Fig. 6-w, z), 7일차 (Fig. 7-t, w, z), 14일차 (Fig. 8-t), 21일차 (Fig. 9-z) 에서중등도의조혈활성이나타났다. 또한신장에서전반적으로경도의세뇨관위축이나타났으며 15 mg kg -1 실험구에서는 1일차 (Fig. 4-n, q) 와 14일차 (Fig. 8-k), 21일차 (Fig. 9-t) 에서중등도 의세뇨관위축이나타났고 60 mg kg -1 실험구에서는 1일차 (Fig. 4-w) 와 2일차 (Fig. 5-t), 7일차 (Fig. 6-t, z) 에서중등도의세뇨관위축이확인되었다. 그리고신장에서전반적으로중등도의 reticuloendothelial system (RES) 활성이확인되었다. 근육에서는모든실험구에서특별한증상이발견되지않았으며유의적인차이가관찰되지않았다. 고찰 이번연구에서는 S. parauberis 에의한연쇄구균병에걸린강도다리에대한 tiamulin 주사제의유효농도를확인해보기위해 5 mg kg -1, 10 mg kg -1, 15 mg kg -1 의농도로설정하여시험하였다. 농도설정은돈적리가발병한돼지에대한 tiamulin 주사치료에관한연구 (Burch et al., 1983) 에서설정한실험농도 10 mg kg -1,
6 34 주민수 김보성 김도형 서정수 권문경 지보영 박찬일 15 mg kg -1 과제조사의제품사용기준인 10 mg kg -1 을참고하였다. In vitro 에서 S. parauberis HFTC0083 에대한 tiamulin hydrogen fumarate 의최소억제농도 (Minimal inhibitory concentration, MIC) 확인결과 1 μg ml -1 로강한감수성을나타냈지만 (data not shown) in vivo에서근육주사와경구투여실험결과에서는치료효과가나타나지않았다. 시험관내에서측정한 MIC로는생체내의반응을정확하게예측할수없으며투여한항생제의대부분이체내에서혈청단백질과결합된상태로존재하여일부분만이조직내로확산되는경우에는치료효과를기대하기어려운경우가있다 (Lee and Shin, 2008). Tiamulin 의강도다리에대한안전성을확인하기위해주사제로강도다리의등근육에 15, 30, 60 mg kg -1 의농도로주사하였고 30, 60 mg kg -1 실험구에서는주사후 10분이내에주사부위의피부가검게변색되는것을관찰할수있었으며 (Supplementary Fig. 1) 주사후 3시간이내에각각 25%, 60% 의폐사가나타난것을확인할수있었다. 또한경구투여용항생제를 5일간 15, 60 mg kg -1 의농도로투여하였을때 60 mg kg -1 의실험구에서총 3마리의폐사가발생하였고, 병원체감염여부를확인해본결과감염되지않은것으로확인되었기때문에고농도의항생제투여로인한폐사로생각된다. 그리고병리조직학적검사결과전체실험구에서지방간이관찰되었고, 신장의경우모든실험구에서전반적으로약한조혈활성과세뇨관위축이나타났으며중등도의 RES 활성이확인되었다. 돼지의경우 tiamulin 주사제 (Denagard 10% injection, Premier Shukuroglou, Athens, Greece) 를과다투여하면타액분비, 구토방향감각상실, 간장경련등을일으킬수있다고명시되어있다. 이외에도 European Medicines Agency (1999) 의연구에따르면, 간중량증가나지방축적이발생하거나, 신근장애, 저칼슘혈증, 심실빈맥성부정맥등의증상에대한지표인 QT interval 의
7 15 June 2019; 4(1): Tiamulin 이연쇄구균에감염된강도다리 (Platichthys stellatus) 에미치는영향 35 각된다. 결론적으로, tiamulin 은연쇄구균에감염된강도다리에대한치료효과가미비하며일정수준이상의농도에서숙주에대한강한독성반응을일으켜숙주를폐사로이르게하는부작용이심각하였다. 따라서연쇄구균에감염된강도다리에는적합한항생제라고볼수없다고생각된다. 사사 이논문은 2019 년해양수산부재원으로해양수산과학기술진흥 원의지원을받아수행된연구임 ( 스마트수산양식연구센터 ). 참고문헌 연장 (Nachimuthu et al., 2012) 과심한저칼륨혈증, 동성맥, heart block 을야기할수있는 double peaked T-waves 의증가 (Lionte et al., 2012) 등의증상이발생할수있다. 조혈활성은평소에는휴지기였다가혈중내에세균이나약물이침투하게되었을때활성이나타난다. 특히항생제의부작용으로인해빈혈, 혈소판감소, 백혈구감소등이발생할수있으며항생제투여를중단하게되면회복을하기위해조혈활성이나타날수있다 (Josefsdottir et al., 2017). 세포질이넓어지고대식세포의활성화가이루어지는현상을 RES 활성이라고하며조직에서거즈모양으로나타난다. RES 활성이나타나는조직에는대식세포등과같은포식세포들이항진하고있고조직에서흰색으로나타난다. 또한혈중내에세균감염이나항생제같은약물에의해활성화될수있다고알려져있다. 세뇨관이공포화된것은세뇨관에직접적인독성이영향을미쳤기때문이며이또한항생제에의해손상을입은것으로생 Bøsling J, Poulsen SM, Vester B, Long KS Resistance to the peptydal transferase inhibitor tiamulin caused by mutation of ribosomal protein L3. Antimicrob. Agents Chemother 47: Burch DGS Tiamulin injection for the treatment of swine dysentery. Vet Record 113: Doménech A, Fernández-Garayzábal JF, Pascual C, Garcia JA, Cutuli MT, Moreno MA, Collins MD, Dominguez L Streptococcosis in cultured turbot, Scophthalmus maximus (L.), associated with Streptococcus parauberis. J Fish Dis 19: European agency for the evaluation of medicinal products, veterinary medicines and information technology unit; committee for veterinary medicinal products: tiamulin, summary report (1). European Medicines Agency (EMA). P.3, EMEA/MRL/578/ 99-FINAL. Joo MS, Kim BS, Kim DH, Seo JS, Kwon MG, Jee BY, Park CI The efficacy and safety of enrofloxacin antibiotics to Streptococcus parauberis PH0710 infected starry flounder (Platichthys stellatus). J Fish Mar Sci Educ 31: Josefsdottir KS, Baldridge MT, Kadmon CS, King KY Antibiotics impair murine hematopoiesis by depleting the intestinal microbiota. Blood 129: Katz SE, Brady MS Antibiotic residues in food and their significance. Food Biotechnol 14: Kavanagh F, Hervey A, Robbins WJ Antibiotic substances from basidiomycetes: VIII. Pleurotus multilus (Fr.) SACC. and Pleurotus passeckerianus pilat. Proc Natl Acad Sci USA 37: Lee DG, Shin HH Parmacokinetics and pharmacodynamics of antibiotics: General concepts and recent advances. Infect Chemother 40:
8 36 주민수 김보성 김도형 서정수 권문경 지보영 박찬일 Lionte C, Bologa C, Sorodoc L Toxic and drug-induced changes of the electrocardiogram. Advances in Electrocardiograms-Clinical Applications 15: Mata AI, Gibello A, Casamayor A, Blanco MM, Domínguez L, Fernández-Garayzábal JF Multiplex PCR assay for detection of bacterial pathogens associated with warm-water Streptococcosis in fish. Appl Environ Microbiol 70: Messier S, Higgins R, Moore C Minimal inhibitory concentrations of five antimicrobials against Treponema hyodysenteriae and Treponema innocens. J Vet Diagn Invest 2: Nachimuthu S, Assar MD, Schussler JM Drug-induced QT interval prolongation: mechanisms and clinical management. Ther Adv Drug Saf 3: Smith P, Hiney MP, Samuelsen OB Bacterial resistance to antimicrobial agents used in fish farming: a critical evaluation of method and meaning. Annu Rev Fish Dis 4: Werner H, Laber G, Schutze E, Krasemann C In vitro activity of tiamulin ( HFU), a new pleuromulin derivative, against clinically significant anaerobes. J Antibiot 31: Woo SH, Park SI Streptococcus parauberis infection in starry flounder, Platichthys stellatus: characterization of innate immune responses following experimental infection. Fish Shellfish Immunol 35:
9 15 June 2019; 4(1): Tiamulin 이연쇄구균에감염된강도다리 (Platichthys stellatus) 에미치는영향 37 Supplementary
42(3)-11(p ).fm
The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et
한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information6À嵶¼º¿¬±¸ºÐ¾ß
Korea Food & Drug Administration 6 01 K o r e a F o o d & D r u g A d m i n i s t r a t i o n 504 505 년들도 친숙하게 독성물질에 대한 정보들에 접근할 수 있도록 하였다. 그림6-1-3 국립독성연구원 홈페이지 K o r e a F o o d & D r u g A d m i n i
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationDBPIA-NURIMEDIA
JFM SE, 29(3), pp. 834~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3 호, 통권87 호, 2017. http://dx.doi.org/10.13000/jfmse.2017.29.3.834 2016 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information- 1 - - 2 - - 3 - 1 1 1. 연구목적 2. 연구필요성 - 4 - - 5 - - 6 - - 7 - 2-8 - 3 1. 브루셀라증 - 9 - (2006 5 12 ) ( ) (%) : (2007) (2007 112008 1 ) - 10 - 2. 큐열 9. (2009, ) (2007 112008 1 ) - 11 - 3. 장출혈성대장균감염증 - 12
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *
, 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationADMINISTRATION AND MANAGEMENT JOURNAL 2 3 ADMINISTRATION AND MANAGEMENT JOURNAL 4 5 ADMINISTRATION AND MANAGEMENT JOURNAL 6 7 ADMINISTRATION AND MANAGEMENT JOURNAL 8 9 ADMINISTRATION AND MANAGEMENT
More information04-ƯÁý2b71Ú°æ½Äš
Safety Evaluation and Signal Analysis of Health/Functional Foods Kyoung Sik Park Nutrition&Functional Food Standardization Division, KFDA 1. Corresponding author : Kyoung Sik Park Tel : 02-380-1317 E-mail
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information,.,..,....,, Abstract The importance of integrated design which tries to i
- - The Brand Touchpoint Analysis through Corporate Identity Typeface of Mobile Telecommunication Companies - Focusing on and - : Lee, Ka Young Dept. Lifestyle Design, Dankook University : Kim, Ji In Dept.
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information02ÇãÀÎÇý~26š
The Spatial and temporal distributions of NET(Net Effective Temperature) with a Function of Temperature, Humidity and Wind Speed in Korea* Inhye Heo**, Youngeun Choi***, and Won-Tae Kwon**** Abstract :
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationuntitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationContents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과
2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information도비라
광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationÆ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information<5B31362E30332E31315D20C5EBC7D5B0C7B0ADC1F5C1F8BBE7BEF720BEC8B3BB2DB1DDBFAC2E687770>
2016 지역사회 통합건강증진사업 안내 - 지역사회 중심 금연지원 서비스 - 2016. 3. 주요변경사항 5 1부 국가 금연정책 추진 및 현황 Ⅰ. 국가 금연정책 개요 1. 금연정책의 배경 및 필요성 11 2. 세계 금연정책 동향 20 3. 우리나라 금연정책 추진경과 24 4. 2016년도 금연정책 추진방향 31 Ⅱ. 국가 금연사업 현황 1. 흡연자 금연지원서비스
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
More information레이아웃 1
대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More informationQbD 적용을위한품질심사해설서 ( 예시 )
QbD 적용을위한품질심사해설서 ( 예시 ) 목차 - 1 - 적용예시 1. FDA 사례요약 - 제네릭의약품 ( 속방성정제 ) - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - 약동학적변수 Lot #2 Lot #3 Lot #4 (d 90 20 um) (d 90 30 um) (d 90 45 um) 대조약 - 8 - 90 max - 9 - 0-t max
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationJkafm093.hwp
가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information<30372EC0CCC0AFC1F82E687770>
산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More informationMBL fm
Microbiol. Biotechnol. Lett. (2017), 45(3), 250 256 pissn 1598-642X eissn 2234-7305 Microbiology and Biotechnology Letters 해양유래미생물을이용한어류질병세균에대한항균활성탐색 김동휘, 박소현, 김지현, 이해리, 허문수 * 제주대학교해양과학대학수산생명의학과 Received:
More information