식물병연구 Research Article Open Access Res. Plant Dis. 23(2): (2017) 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Sp

Size: px
Start display at page:

Download "식물병연구 Research Article Open Access Res. Plant Dis. 23(2): (2017) 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Sp"

Transcription

1 식물병연구 Research Article Open Access Res. Plant Dis. 23(2): (2017) 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Specific Primer Sets for RT-PCR Detection of Major RNA Viruses of Tomato Plants in Korea 신준성 1 ㆍ한정헌 2 ㆍ신유주 1 ㆍ곽해련 3 ㆍ최홍수 3 * ㆍ김정수 4 * 1 바이오큐브시스템, 2 농촌진흥청국립농업과학원유전자공학과, 3 농촌진흥청국립농업과학원작물보호과, 4 안동대학교식물의학과 *Co-corresponding authors HS Choi Tel: Fax: hschoi@korea.kr JS Kim Tel: Fax: plvirus@anu.ac.kr These authors contributed equally to this work as first authors. Jun-Sung Shin 1, Jung-Heon Han 2, Yu-Ju Shin 1, Hae-Ryun Kwak 3, Hong-Soo Choi 3 *, and Jeong-Soo Kim 4 * 1 BioCube System, Inc., Gwacheon 13820, Korea 2 Gene Engineering Division, National Institute of Agricultural Sciences, Rural Development Administration, Jeonju 54874, Korea 3 Crop Protection Division, National Institute of Agricultural Sciences, Rural Development Administration, Wanju 55365, Korea 4 Department of Plant Medicals, Andong National University, Andong 36729, Korea Received September 12, 2016 Revised April 16, 2017 Accepted April 17, 2017 Major tomato viruses in Korea are Tomato chlorosis virus (ToCV), Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), and Tomato mosaic virus (ToMV). RT-PCR conditions for the viruses were examined, especially in primer set and RT-PCR mixture. Total 46 primer sets from the unique sequence of the viruses were tested for nonspecific background products in a RT-PCR mixture without template. Among them 16 primer sets were applied to healthy tomato RNA, resulting the compatibility between RT-PCR mixture and primer set influenced RT-PCR to reduce nonspecific background products. Based on the combinations among cdna synthesis parameters and RT-PCR mixtures, two reaction mixtures were finally selected for ToCV detection. The condition allowed to determine more specific primer sets; C029 (ToCV), C072 (TSWV), C070 (CMV), C048 (PepMoV), and C065 (ToMV). These primer sets are expected to be of use to specific detection of the major viruses in tomato plants. Keywords: Detection, Primer, RT-PCR, Tomato, Virus 서론 국내의토마토에서발생하는주요바이러스는 Tomato Research in Plant Disease pissn , eissn chlorosis virus (ToCV), Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Tomato mosaic virus (ToMV), Tomato yellow leaf curl virus (TYLCV) 이며, TYLCV를제외한나머지는모두 RNA 바이러스이다 (Ji 등, 2008; Kataya 등, 2008; Kim 등, 2011). ToCV 는 2013년에논산, 익산, 함평, 화순, 제주에서처음발생하였고, 감염된식물체는잎갈변과엽맥퇴록병징을보이며, 7종이상의잡초에서감염이확인되었다 (Kil 등, 2015). TSWV는 2004년안양 The Korean Society of Plant Pathology cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 193

2 194 Research in Plant Disease Vol. 23 No. 2 관양동지역에서대발생하였고, 감염식물에괴사및다중원형반점을일으킨다 (Cho 등, 2005). CMV는국내채소류에서가장많이발생하는바이러스로토마토에서는잎에모자이크와고사리잎 (fern leaf) 모양병징을일으킨다 (Kim 등, 2011). 이밖에 PepMoV와 ToMV는토마토품종에따라황화모자이크, 엽맥괴사, 퇴록반점등을일으키는것으로알려져있다 (Kim 등, 2008). 식물바이러스진단은바이러스피해를최소화하기위한초기대응책이며 (Aboul-Ata 등, 2011), 효소면역항체법 (enzyme-linked immunosorbent assay, ELISA) 에서부터차세대염기서열분석 (next generation sequencing, NGS) 법까지다양한방법이이용된다 (Boonham 등, 2014; Jeong 등, 2014). 특히, 역전사중합반응 (RT-PCR) 법은혈청학적진단법에비해검출감도와특이도가높다 (Hu 등, 1995; Mumford 등, 1994; Park과 Kim, 2004; Webster 등, 2004). 또한실험절차가간편하고진단에필요한프라이머설계및제작이용이하여식물바이러스진단에널리이용된다 (Webster 등, 2004). 일반적으로식물바이러스진단용프라이머는대상바이러스자체또는그와유사한계통의유전체서열을참고하여설계한다. RT-PCR 진단에서기주의유전체서열을고려하지않고설계된프라이머를사용할경우, 프라이머염기서열과상동성이있는기주유래비특이산물의생성을완전히회피하는것은매우어려운일이다. 따라서 RT-PCR의진단효율을높이기위해서는목적바이러스에특이적인프라이머선발, 주형준비법과사용량, cdna 합성온도와시간, RT-PCR 반응액의종류, 프라이머및 PCR 증폭조건등을고려해야한다 (Chen 등, 2011; Hassani-Mehraban 등, 2016; Kumar 등, 2011; Lee 등, 2011; Okuda와 Hanada, 2001; Webster 등, 2004). 이들가운데프라이머는진단의특이성에가장많은영향을주는요인이다 (Hassani-Mehraban 등, 2016; Kumar 등, 2011; Mumford 등, 1994; Webster 등, 2004). 오늘날에는 NGS 기술발달로과거 10여년전에비해식물바이러스뿐만아니라다양한작물의유전체정보가풍성해졌다 (Thottathil 등, 2016). 2012년에는국내과학자가포함된국제협력연구를통해토마토의전장유전체서열이완전히분석되었다 (The Tomato Genome Consortium, 2012). 이는기주의전장유전체정보를고려해토마토에발생하는바이러스에특이적인프라이머설계가가능함을의미한다. 따라서본연구에서는토마토전장유전체서열, expressed sequence tag (EST), 식물바이러스염기서열간상동성분석을통해바이러스특이적인프라이머후보군을탐색하고, one step RT- PCR mix와 cdna 합성조건을달리하여토마토주요바이러스 진단에필요한특이프라이머세트를선발하고자하였다. 재료및방법 식물및바이러스. 바이러스증식및건전 RNA 채취를위해국내에시판되는토마토두품종 ( 서광과주옥 ) 을사용하였다. 바이러스는농촌진흥청작물보호과식물바이러스실에서유지하고있는 ToCV-tom, PepMoV-tom, ToMV-n1을사용하였고, TSWV-old와 CMV-P1은농우바이오 (Nongwoo Bio, Suwon, Korea) 이장하박사로부터분양받았다. 바이러스증식및주형준비. 감염 RNA 채취를위해각각의바이러스가감염된토마토또는담배잎을접종원으로사용하여 TSWV는주옥토마토에, 나머지바이러스는서광토마토에증식하였다. 접종액은멸균한막자사발에감염잎 (1 g) 과접종액 (0.1 M Tris-HCl, ph 8.0, 1% sodium sulfite) 3 ml를널고마쇄한다음, 일반두루마리화장지 4겹으로여과하여준비하였다. 접종개체는적정량의 carborundum (600 mesh) 을혼합한여과액을묻힌붓으로떡잎또는본엽 1 2매전개된잎을수회문질러준비하였고, 흐르는물로곧바로세척한다음과천소재실험농장에서재배하였다. 접종후 25일경접종엽을제외한나머지잎을일괄채취하고, 필요한양만큼알루미늄호일로포장한다음 20 C에보관하면서필요시꺼내어사용하였다. 식물체전체 RNA 는제품사용설명서에따라 BCS Plant RNA Prep Kit (BioCube System, Gwacheon, Korea) 로정제하였고, 정제한 RNA는 20 C에보관하면서분리후 7일이내에사용하였다. RNA 농도는 Nanodrop ND2000 (Thermo Scientific, Waltham, MA, USA) 를이용하여 ng/µl 농도가되도록필요한농도로조절하여사용하였다. 검정용프라이머분석및제작. National Center for Biotechnology Information (NCBI) 에등록된바이러스염기서열을분석한다음전장염기서열이보고된대표바이러스를선발하고 (Table 1), 생물정보분석회사인씨더스 (Seeders, Daejeon, Korea) 에분석의뢰하였다. 분석방법을간단히요약하면, 바이러스유전체서열과토마토전장유전체서열, 토마토 EST, 2014년 11월까지 NCBI에등록된모든식물바이러스유전체염기서열 (plant virus genome sequence data, PVS data) 간의상동성분석을통해 5가지바이러스특이서열을 1차로선발하였다. 프라이머는선발서열과 Primer3 프로그램 (Koressaar와 Remm, 2007) 으로예상증폭산물의크

3 Research in Plant Disease Vol. 23 No Table 1. Description of reference viruses for primer design Virus NCBI accession no. Genome Genome size (bp) Isolate Country ToCV NC_ RNA 1 8,595 Florida USA NC_ RNA 2 8,247 Florida USA TSWV NC_ RNA L 8,897 CNPH1 USA NC_ RNA M 4,821 Almeria Spain NC_ RNA S 2,916 CPNH9 USA PepMoV NC_ RNA 9,640 California USA CMV NC_ RNA 1 3,357 Fny USA NC_ RNA 2 3,050 Fny USA NC_ RNA 3 2,216 Fny USA ToMV NC_ RNA 6,383 Queensland Australia ToCV, Tomato chlorosis virus; TSWV, Tomato spotted wilt virus; PepMoV, Pepper mottle virus; CMV, Cucumber mosaic virus; ToMV, Tomato mosaic virus. 기가 500 1,500 bp, Tm값은 60 C, 나머지조건은프로그램의기본값에적합하도록설계한다음, 마크로젠사 (Macrogen, Seoul, Korea) 에의뢰하여합성하였다. RT-PCR 반응액과증폭산물확인. RT-PCR 반응액은 Taq DNA polymerase의농도 (1 U/10 µl 또는 2 U/10 µl) 와활성억제방식을달리하여 cdna 합성과 DNA 증폭이동일반응액에서일어나도록 one-step 방식으로제조하였다. Taq DNA polymerase 활성억제방식은 RT-PCR mix1과 2는 chemical inhibition 방식, RT-PCR mix3과 4는 antibody inhibition 방식이며, 반응액에포함된 Taq DNA polymerase의농도는 RT- PCR mix1과 3은 1 U/10 µl, RT-PCR mix2와 4는 2 U/10 µl가되도록제작하였다. cdna 합성및 DNA 증폭은 PCR기 (Life Eco; Bioer Technology, Hangzhou, China) 에서수행하였다. 증폭산물가운데 10 µl를 EtBr 혹은 GelGreen (BioCube System) 이첨가된 1% agarose gel에서 100 V 5 A 조건으로 30 60분간전기영동하고, 반응결과는 gel-documentation system GDS200D (intron, Seongnam, Korea) 로확인하였다. RT-PCR mix와프라이머조합별특이도비교. 첫번째실험에서는식물 RNA 연구용으로시판되고있는 RT- PCR mix3과공시프라이머조합간반응양상을조사하였다. RT-PCR 반응액은주형을첨가하지않고, 2 RT-PCR mix 10 µl, 멸균수 8 µl, 10 pmol/µl 농도의정방향과역방향프라이머를각각 1 µl씩첨가하여제조하였다. 반응은 42 C/20분, 95 C/10분, 35회 (95 C/1분, 56.0 C, 59.6 C, 63.7 C 처리구에서 1분, 72 C/1분 ) 로수행하였으며, 반응양상은비특이증폭산물유무와정도 ( 약함과강함 ) 에따라판별하였다. 두번째실험에서는첫번째실험에서선발한프라이머조합을대상으로특이성을심층조사하였다. 건전한서광토마토의 RNA (100 ng/µl) 1 µl를주형으로사용하였고, RT-PCR mix 종류와 Tm값구배조건 (51.0 C, 52.2 C, 53.9 C, 56.0 C, 58.5 C, 60.7 C, 62.4 C), 멸균수 7 µl 첨가를제외한나머지실험조건은첫번째실험과동일하게하였다. 비특이정도는비특이증폭산물의총개수, 밴드진하기, dimer의진하기와넓이등을고려하여육안으로판별하였다. 선발한프라이머개수가적었던 ToCV와 TSWV 경우는조합별결과를젤그림상에서비교하였고, PepMoV, ToMV, CMV 프라이머조합은다음과같은조건으로비교하였다. 프라이어별로세가지 Tm값 (56.0 C, 59.6 C, 63.7 C) 에서발생한비특이증폭산물의총개수 (A), 1 kb DNA ladder의 500 bp 밴드의진하기를 1로했을때증폭산물의상대적인진하기 (B), 1 kb DNA ladder의 bp 사이의구간넓이를 3으로했을때 dimer의상대적인진하기와넓이 (0: 없음, 1: 얇거나흐림, 5: 넓거나아주진함 ) (C) 를 A B+C 형식으로수치화하였다. 그리고이들값을바이러스별로묶어평균값으로환산하고오차값을계산한다음그값이작을수록특이도가높은것으로판독하였다. RT-PCR mix 종류와주형농도, cdna 합성온도및시간별반응양상비교. 본실험에서는 4가지 RT-PCR mix 와 ToCV 진단용프라이머조합가운데주형을넣지않은상태에서가장특이도가높았던 C029 프라이머조합을사용

4 196 Research in Plant Disease Vol. 23 No. 2 하였다. 특이성은이전처럼비특이증폭산물을 A B+C 형식으로수치화한다음판별하였다. 주형농도, cdna 합성온도와시간변화에따른특이도비교는다음의조건 1, 2, 3에따라각각수행하였다. 조건 1: RT-PCR 반응액은 2 RT-PCR mix 10 µl, 멸균수 7 µl, 10 pmol/µl 농도의정방향과역방향프라이머를각각 1 µl, 농도를달리한 RNA (100, 200, 400, 800 ng/µl) 1 µl를첨가하여제조하였다. cdna 합성은 42 C/20분, PCR 반응은 95 C/10분, 35회 (95 C/1분, 58 C/1분, 72 C/1분 ) 로수행하였다. 조건 2: RT-PCR 반응액은조건 1의주형농도를 100 ng/ µl로고정하여제조하였고, cdna는 42 C, 45 C, 48 C, 51 C, 56 C 온도처리구에서 20분간합성하였으며, PCR 반응은조건 1과동일하게수행하였다. 조건 3: cdna는 48 C에서각각 5, 10, 15, 20분간합성하였고, 나머지는조건 2와동일하게실험하였다. 선발프라이머검출감도및특이도비교. 건전 RNA 와감염 RNA는토마토와주옥 (TSWV의경우 ) 토마토잎에서분리하였는데, 원액과이를 diethylpyrocarbonate (DEPC)- water로 10배씩연속희석한용액을주형으로사용하였다. RT-PCR 반응액은 2 RT-PCR mix3 10 µl, 멸균수 7 µl, 10 pmol/µl 농도의정방향과역방향프라이머를각각 1 µl, RNA ( 약 200 ng/µl) 1 µl를첨가하여제조하였으며, cdna 합성은 48 C/5분, PCR 반응은 95 C/10분, 35회 (95 C/1분, 58 C/1분, 72 C/1분 ), 72 C/1분 1회로수행하였다. 결과 프라이머조합별특이도비교. 시판중인 RT-PCR mix3 에주형을넣지않고, 세가지 Tm값 (56.0 C, 59.6 C, 63.7 C) 에서 46개프라이머조합 (Table 2) 의증폭양상을조사하였다. C041 (ToCV), C044 (ToCV), C073 (TSWV) 프라이머조합에서는 Tm값변화에상관없이비특이산물이증폭되지않았다. 반면에 ToCV 의 C029, C032, C040, PepMoV 의 C048, C054, C055, ToMV의 C065, C066, CMV의 C068, C069, C070, C071, TSWV의 C072 조합에서는비특이산물이약하게증폭되었고, 나머지프라이머조합에서는결과판독에영향을줄정도로비특이산물이많이증폭되었다 (Table 2). 한편, 프라이머이외에다른반응조건을최적화한다면비특이산물이조금생성된다할지라도목적바이러스진단에사용할수있을것으로판단되었다. 따라서비특이산물이증폭되지않거나약하게증폭된프라이머조합을이 후실험재료로선발하였다. 진단용 RT-PCR mix 선발. 이전실험에서선발한프라이머조합과건전한서광토마토 RNA를이용하여 RT- PCR mix별비특이산물생성정도를조사하였다. ToCV 진단용프라이머의경우 RT-PCR mix별증폭양상은비슷하였다. C041의경우주형을넣지않은상태에서는비특이산물이증폭되지않았으나 (Table 2), 건전한 RNA 주형이존재할때는특이도가다소떨어졌다 (Fig. 1). TSWV 진단용프라이머조합은 RT-PCR mix 간에비특이산물생성정도가다르게나타났는데, C072는 RT-PCR mix1과 4에서목적산물범위에비특이산물이많이생성되었고, C073은 RT-PCR mix4에서비특이정도가가장심하였다 (Fig. 1). 대체적으로 ToCV와 TSWV 프라이머조합에서는 RT-PCR mix2와 3이 RT-PCR mix1 과 4에비해다소양호한결과를보였으나, C072의경우 RT- PCR mix2와 3 간의특이도정도를 gel 그림으로세부비교하는것에는다소어려움이있었다 (Fig. 1). 따라서 PepMoV, ToMV, CMV 프라이머조합에서는재료및방법에서술한것처럼프라이머조합의비특이정도를바이러스별평균값과오차값의크기로비교하였다. PepMoV 와 CMV 프라이머조합의경우 ToCV 및 TSWV용프라이머조합에서처럼대체적으로 RT-PCR mix3에서양호한결과를보였으며, ToMV용프라이머조합에서는 RT-PCR mix1이가장특이도가높은것으로나타났다 (Fig. 2). 한편, Taq DNA polymerase 활성억제방식에따른비특이정도를비교했을때 chemical inhibition 방식의반응액 (RT-PCR mix1과 2) 이 antibody inhibition 방식 (RT-PCR mix3과 4) 보다다소높게나타났으며, 동일방식의반응액간에는 Taq DNA polymerase 의농도가 1 U/10 µl일때 2 U/10 µl보다비특이정도가낮게나타났다 (Fig. 2). cdna 합성조건최적화및선발프라이머적용. RT- PCR을이용한진단에서 cdna 합성은진단의특이성을결정짓는중요한단계이다. cdna 합성에적합한조건을찾고자공시한 4종의 RT-PCR mix에서주형의농도, cdna 합성온도및반응시간변화에따른비특이정도를비교하였다. 이를위해주형을넣지않은 RT-PCR mix3에서비특이정도가낮고, 건전한 RNA 주형첨가시비특이산물이약하게생성된 ToCV용 C041이적합하다고판단되어본실험에사용하였다. 각각의 RT-PCR 반응액에서주형 ( 서광토마토건전주의 RNA) 을농도별로첨가하고비특이정도를조사한결과, 비특이정도는 RT-PCR mix1, 3, 2, 4 순으로낮게나타났으며,

5 Research in Plant Disease Vol. 23 No Table 2. Parameters and suitability of primers used in this study Virus Code Forward primer Reverse primer Amplicon size (bp) Nonspecific background product* ToCV C029 ATCGGACATTATGTTCAAGG AAATCCTCATTACCACATCG 281 Weak C030 CCTGATTGGTTCTAAACTGC CCACACCTACCACGATACTT 198 Strong C031 ATTGCTTAGACCGATTCAGA TCACCCATTTTAGCGTACTT 372 Strong C032 TATGTGTCAGGCCATTGTAA TTCATAAGCAGGTTCGAGAT 348 Weak C033 TGATGTTTCCAGTGTTTTCA TGGTAAATGAAATTCCCAAC 418 Strong C034 GTGTTACGATGGGTTTGTTT CTTGAGTTTGTCCCAAAGAG 559 Strong C035 TTCCAAGTTCGATAGGAAGA CGAAACATATAACGACGAATC 565 Strong C036 TCGACTTTTCGAGGTTGTAT CCACACCTACCACGATACTT 556 Strong C037 CATGTTTTCCAACAGGAGAT GGGATTATCATATTGCCTCA 832 Strong C038 CTCTTTGGGACAAACTCAAG ATCGAACTTGGAAACGAGTA 980 Strong C039 GATGAAACCGAAGATGGATA AACAACAGTCAAATCGCTCT 943 Strong C040 TCTGATGCCTTGGTTACTTT AAGCAACAAACCTACCTTGA 564 Weak C041 TGATGTTTCCAGTGTTTTCA TAGTTTGCACCAAAGGAACT 527 No C042 ATCTCGAACCTGCTTATGAA TCAGACTCGGGTTAGGTAAA 657 Strong C043 TTTACCTAACCCGAGTCTGA TAGTTTGCACCAAAGGAACT 713 Strong C044 TACAGCTTAACCCGTTGAAT CATTGTCAATACAGTGGCAG 518 No C045 TAGACACATGGCAATGGTAA AAAACGCACTGTCTGTACCT 1,055 Strong PepMoV C046 GATGGATTTGGCTACAACAT CAGCTAATTCAAAAGCCCTA 443 Strong C047 AATAGTGTGTTTGGGTCGTC CTACCTGTGCCTTGACTCTC 308 Strong C048 TGTTCACTAGGCTCAGGAGT GACGACCCAAACACACTATT 461 Weak C049 GTGATGAATGGCTTAATGGT CCAAATAACCTTGTTTGAGC 371 Strong C050 ACACTGGCAATAATGCTTTT TCCAGTGGATTTACCAGAAC 390 Strong C051 TATCTGGTGGTCCATTTTTC CTACCTGTGCCTTGACTCTC 355 Strong C052 TGTTCACTAGGCTCAGGAGT GAAAAATGGACCACCAGATA 414 Strong C053 GTGGTCTCTGGGATGAAATA CCAACTACGATCACCTCCT 249 Strong C054 GAATGCTAGTTTTCTGTGGG ATGTTGTAGCCAAATCCATC 557 Weak C055 CACCATTCCAAGAATCAAAT CCAAATAACCTTGTTTGAGC 576 Weak C056 ATGATGAAAAACAGGTCGTC GACGACCCAAACACACTATT 613 Strong C057 AAGAGGAGCGAATTGTATCA ACCATTAAGCCATTCATCAC 694 Strong C058 GTTTTGCTGATAGAACCGAC TGAATTCGTTCTCCGTAACT 740 Strong C059 GAAGCTGCTCTGTATTGCTT CAAGAGAAGACTTGGACTGG 769 Strong C060 GACGCTCTAAGACGAAAAGA ATCAGGTTTGGCACTCTAAA 772 Strong C061 AAAGAATTCAGGCATTGAAA ATCAGGTTTGGCACTCTAAA 757 Strong C062 GGCTCTAAAAGCTGAACTGA TGATACAATTCGCTCCTCTT 745 Strong C063 AGTGGTTGGAATCTCAAATG CAGGGAATTTCATTATAGCG 815 Strong ToMV C064 TAGTTCAGCAAAGGTGGTTT ACGTCTGCATAAGTCTCACC 681 Strong C065 TTCACACAGTCTGACAAGGA GGAAGATCCACAAAATCAAA 824 Weak C066 AGATTGCTCAAAGATGGAGA AATTTCATGGTAACAGCGTC 1,064 Weak

6 198 Research in Plant Disease Vol. 23 No. 2 Table 2. Continued Virus Code Forward primer Reverse primer Amplicon size (bp) Nonspecific background product* CMV C067 CAGACTTATTCGTACCGAGG GTAGATGATTTCGCGGATAG 323 Strong C068 ACTCTCTGACGAGTTCGGTA CAATTCCATAATTCTTTCGC 392 Strong C069 GTCGAGTCATGGACAAATCT ACTGACCATTTTAGCCGTAA 803 Weak C070 ACATCAATGAATTGGTAGCC CTCGGTACGAATAAGTCTGG 876 Weak C071 CTATCCGCGAAATCATCTAC TCAACTTGACTAATGGTCCC 959 Weak TSWV C072 GCAATTCTGGTTCTCTATGC CATTCTTCAGAGTGTCCCAT 375 Weak C073 CTAATGAAATCGGAAAATCG AGAATAATCGGATAGTCGCA 197 No C074 GACAGCCTGGAACATAAAAG GAAAATGTGGAACACAAGGT 673 Strong ToCV, Tomato chlorosis virus; PepMoV, Pepper mottle virus; ToMV, Tomato mosaic virus; CMV, Cucumber mosaic virus; TSWV, Tomato spotted wilt virus. *RT-PCR was performed with each primer combination in the RT-PCR mix3 without template RNA. The condition was as follows cdna synthesis (42 C/20 min), denaturation (95 C/10 min), amplification (35 cycles of 95 C/1 min, 58.5 C/1 min, 60.7 C/1 min, 62.4 C/1 min, and 72 C/1 min), and final extension (72 C/10 min). The result was determined by visual observation for the average amount or intensity of nonspecific background products of each gel. C029 /281 RT-PCR mix1 RT-PCR mix2 RT-PCR mix3 RT-PCR mix4 M M M M TSWV ToCV C032 /348 C041 /527 C072 /375 C073 /197 Fig. 1. Gel images of nonspecific background products on four different RT-PCR mixtures. RT-PCR was performed using 1 μl of RNA (100 ng/μl) from healthy tomato of Seogwang as template. The condition was as follows; cdna synthesis (42 C/20 min), denaturation (95 C/10 min), amplification (35 cycles of 95 C/1 min, 51.0 C 62.4 C/1 min, and 72 C/1 min), and final extension (72 C/10 min). Each gel is divided into eight lanes; lane M for 100 bp DNA ladder, lane 1 7 for 51.0 C, 52.2 C, 53.9 C, 56.0 C, 58.5 C, 60.7 C, and 62.4 C in order. The label at left side of each gel indicates target virus name and primer combination/expected size of amplicon. ToCV, Tomato chlorosis virus; TSWV, Tomato spotted wilt virus. RT-PCR mix4를제외한나머지반응액에서는주형의농도변화에관계없이일정하였다. 특이한것은 RT-PCR mix4의경우주형의농도가 200 ng/µl 이하일때보다 400 ng/µl 이상처리구에서비특이정도가더높게나타났다 (Fig. 3A). 주형의농도와 cdna 합성시간을 100 ng/µl와 20분으로고정하고온도변화에따른비특이정도를조사했을때, RT- PCR mix4를제외한나머지반응액에서는권장온도인 48 C 이하에서비슷한경향을보였으나, 역전사효소의활성이떨어지는 51 C 이상에서는 RT-PCR mix3이다른반응액에비 해영향을많이받았다 (Fig. 3B). 한편, cdna 합성시간에따른비특이정도는 RT-PCR mix1 을제외한나머지반응액에서합성시간이길어질수록증가하는경향을보였다. 비특이정도는 RT-PCR mix1이전시간대에서가장낮았고, 합성시간 10분에서 RT-PCR mix3은 RT-PCR mix1과비슷한결과를보였다 (Fig. 3C). RT-PCR mix1의경우 RT-PCR mix3에비해기능이다소우수하였으나, 최적화된 RT-PCR 조건에서는큰차이가없을것으로판단되어 RT-PCR mix3을이용해다음실험을진행

7 Research in Plant Disease Vol. 23 No 하였다. RT-PCR mix3 에적합한조건을이전실험에서비특 이산물이생성되지않거나 (C041, C044, C073) 그정도가약 했던 (C029, C032, C040, C048, C054, C055, C065, C066, C069, C070, C071, C072) 프라이머조합에적용했을때, 바이러스 별로 ToCV 는 C029, TSWV 는 C072, CMV 는 C070, PepMoV 는 C048, ToMV C065 의특이도와민감도가가장좋았다 (data not shown). 이를기준으로바이러스진단을위해선발한 프라이머조합의전체적인결과를보면 C029 (ToCV), C048 Average value for non-specificity A B C RT-PCR mix1 RT-PCR mix2 RT-PCR mix3 RT-PCR mix4 PepMoV ToMV RT-PCR mixtures CMV Fig. 2. Bar graph for average value of non-specificity in different RT-PCR mixtures. The average value was calculated from amount and intensity of nonspecific background products in each primer combinations for target virus. RT-PCR was performed at the condition described in Fig. 1 except for Tm value (56.0 C, 59.6 C, and 63.7 C). (A) PepMoV, Pepper mottle virus. (B) ToMV, Tomato mosaic virus. (C) CMV, Cucumber mosaic virus. (PepMoV), C070 (CMV) 은건전과감염 RNA 원액과희석액모두에서비특이산물이전혀생성되지않았고, 결과에영향을줄정도는아니었으나 C072 (TSWV) 와 C065 (ToMV) 는고농도시료에서비특이산물이증폭되었다 (Fig. 4). 고찰 본연구에서는바이러스특이프라이머조합을선발하고자토마토와대상바이러스의염기서열상동성을기초로바이러스특이염기서열을선발하고프라이머를제작하였다. 그럼에도불구하고주형을넣지않은 RT-PCR 반응에서프라이머조합에따라비특이산물이생성됨을확인하였다 (Table 2). 일반적으로 PCR mix에는 Taq DNA polymerase 정제방법에따라발현용벡터 DNA 잔존물이남게되는데 (Chen 등, 2015), 반응액내에존재하는벡터 DNA 잔존물과건전 RNA 간의간섭현상등이비특이산물생성의주요원인가운데하나일것으로판단되었다. 다만본실험결과는비특이산물이많이생성될수있도록 RT-PCR 검정조건이최적화되지않은상태에서수행하였다. 그러므로 C072처럼주형이없거나건전한 RNA 첨가조건에서일부비특이산물이생성된다고해서진단에활용할수없는것은아니다 (Fig. 3). 진단대상이되는바이러스에보다특이적인프라이머를선발하기위해서는기주식물과바이러스뿐만아니라 Taq DNA polymerase 단백질발현시스템인대장균유전체도함께분석할필요가있다 Average value for non-specificity RT-PCR mix1 RT-PCR mix2 RT-PCR mix3 RT-PCR mix4 A B C RNA concentration (100 ng/ l) Temperature(C) Incubation time (min) Parameters for cdna synthesis Fig. 3. Bar graph for average value of non-specificity according to the combinations between cdna synthesis parameter and reaction mixture in RT-PCR. The average value was calculated from amount and intensity of nonspecific background products in each primer combination. RT-PCR was performed with C029 primer combination of Tomato chlorosis virus at the condition described in Fig. 1 with exceptions; cdna synthesis (48 C/20 min) (A), template RNA (100 ng/μl) from healthy tomato of Seogwang (B), and cdna synthesis (20 min) (C). Tm value for PCR is 58 C over all test.

8 200 Research in Plant Disease Vol. 23 No. 2 ToCV C029/281 TSWV C072/375 CMV C070/876 PepMoV C048/461 ToMV C065/824 고판단된다. 한편, 프라이머종류와함께 RT-PCR mix 의조성과종류에 따라진단의특이성에차이를보였는데, TSWV 진단용 C072 는 RT-PCR mix1 과이와조성이다른 RT-PCR mix4 에서비특 이정도가심하고 (Fig. 1), 다른바이러스프라이머조합에 서는 RT-PCR mix2 와 4 에서그정도가심하였다 (Fig. 2). 이는 Taq DNA polymerase 농도가높을때비특이산물이많이생 성된다는이전의보고와관련이있을것으로판단되었다 (Usta 등, 2005). 반면에 ToCV 진단용프라이머는주형의농 도, cdna 합성온도와시간을달리했을때 RT-PCR mix 1 의 특이도가가장높은것으로나타났다 (Fig. 3). 이는 C072 와 C029 의결과가상충되는것으로 RT-PCR 반응액과선택한 프라이머간의친화성이진단의특이성에중요한요인임 을암시한다. RNA dilution Healthy Diseases M M Fig. 4. RT-PCR detection of five tomato viruses using finally selected primer combinations for each virus. Each gel is divided into eight lanes; lane M for 100 bp DNA ladder, lane 1 for initial sap of purified total RNA, and lanes of 2 7 for 10-fold serial dilutions. The label at left side of each gel indicates target virus name and primer combination/expected size of amplicon. Template RNA was prepared from Seogwang tomato plant except for TSWV ( Juok tomato). RT-PCR was performed as follows: cdna synthesis (47 C/5 min), denaturation (95 C/10 min), amplification (35 cycles of 95 C/1 min, 65 C/1 min, and 72 C/1 min), and final extension (72 C/10 min). ToCV, Tomato chlorosis virus; TSWV, Tomato spotted wilt virus; CMV, Cucumber mosaic virus; PepMoV, Pepper mottle virus; ToMV, Tomato mosaic virus. 그러나 RT-PCR mix3 은 cdna 합성온도를역전사효소의 내성온도인 50 C 이하와합성시간 5 분이내에서는 RT-PCR mix1 과큰차이를보이지않았다 (Fig. 3). 결과적으로 RT-PCR mix3 은 RT-PCR mix1 에비해적용성이다소높은것으로보 인다. 끝으로 RT-PCR mix3 을이용해선발한프라이머의진 단특이성을보면, ToMV 용 C065 의경우주형이고농도일때 비특이산물이강하게증폭되었다 (Fig. 4). 이는경우에따라프라이머자체만으로비특이산물생성을억제하는것에는한계가있으며, 기주식물의전장유전체서열정보나분석방법이아직완전하지않음을의미한다고도할수있다. 예로써전장유전체조립시생물정보연구자들은대장균을포함한미생물염기서열을모두제거한다고하는데 (personal communication), 이것이본실험에어떤영향을주었는지는아직논의되어야할소지가많다고하겠다. 이런상황에서비특이산물생성을피하기위해서는 Taq DNA polymerase 정제시 DNA 오염이되지않은반응액을사용하던지 (Lawyer 등, 1993) 또는단백질프라이머종류를바꾸는것도한방법이지만, 당장은 RNA 주형준비시 DNase 처리를통한기주 DNA 제거가많은도움이될것으로판단된다. 요약 국내의토마토에서발생하는주요바이러스는 Tomato chlorosis virus (ToCV), Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Tomato mosaic virus (ToMV) 이다. 이들바이러스를진단하기위해프라이머세트와반응액을포함하는역전사중합반응 (RT- PCR) 법의조건을조사하였다. 공시한바이러스에특이적인염기서열로부터모두 46개프라이머세트를설계하고, 이를이용해주형을넣지않은 RT-PCR에서비특이반응을조사하였다. 이들가운데 16개조합을건전한토마토 RNA에적용한결과프라이머세트와 RT-PCR 반응액간의친화성이비특이반응감소에영향을주었다. cdna 합성과관련된인자와 RT-PCR 반응액사이의조합을근거로 ToCV 진단을위한두종류의반응액을선발하였다. ToCV 진단시수립된조건을나머지바이러스진단에적용했을때, 특이성이높은프라이머세트 C029 (ToCV), C072 (TSWV), C070 (CMV), C048 (PepMoV), C065 (ToMV) 를선발할수있었다. 이들프라이머세트는공시한바이러스를특이적으로진단하는데유용할것으로판단된다. Conflicts of Interest No potential conflict of interest relevant to this article was reported.

9 Research in Plant Disease Vol. 23 No Acknowledgement This research was supported by Agri-Bio industry Technology Development Program, Ministry of Agricµlture, Food and Rural Affairs ( WT011). References Aboul-Ata, A. E., Mazyad, H., El-Attar, A. K., Soliman, A. M., Anfoka, G., Zeidan, M., Gorovits, R., Sobol, I. and Czosnek, H Diagnosis and control of cereal viruses in the Middle East. Adv. Virus Res. 81: Boonham, N., Kreuze, J., Winter, S., van der Vlugt, R., Bergervoet, J., Tomlinson, J. and Mumford, R Methods in virus diagnostics: from ELISA to next generation sequencing. Virus Res. 186: Chen, S., Gu, H., Wang, X., Chen, J. and Zhu, W Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting tomato using 18S rrna as an internal control. Acta Biochim. Biophys. Sin. (Shanghai) 43: Chen, S., Zheng, X., Cao, H., Jiang, L., Liu, F. and Sun, X A simple and efficient method for extraction of Taq DNA polymerase. Electron. J. Biotechnol. 18: Cho, J. D., Kim, J. S., Kim, J. Y., Kim, J. H., Lee, S. H., Choi, G. S., Kim, H. R. and Chung, B. N Occurrence and symptoms of Tomato spotted wilt virus on vegetables in Korea. Res. Plant Dis. 11: (In Korean) Hassani-Mehraban, A. Westenberg, M., Verhoeven, J. T., van de Vossenberg, B. T., Kormelink, R. and Roenhorst, J. W Generic RT-PCR tests for detection and identification of tospoviruses. J. Virol. Methods 233: Hu, J. S., Li, H. P., Barry, K., Wang, M. and Jordan, R Comparison of dot blot, ELISA, and RT-PCR assays for detection of two cucumber mosaic virus isolates infecting banana in Hawaii. Plant Dis. 79: Ji, J., Oh, T. K., Lee, H. J., Kim, S. H., Rajangam, U., Kim, S. C., Kim, Y. S. and Choi, C. W Molecular characterization of tomato infecting Tobacco leaf curl geminivirus isolated from Jeju island. Res. Plant Dis. 24: 238. (Abstract) Jeong, J. J., Ju, H. J. and Noh, J A review of detection methods for the plant viruses. Res. Plant Dis. 20: (In Korean) Kataya, A. R. A., Stavridou, E., Farhan, K. and Livieratos, I Nucleotide sequence analysis and detection of a Greek isolate of Tomato chlorosis virus. Plant Pathol. 57: Kil, E. J., Lee, Y. J., Cho, S., Auh, C. K., Kim, D., Lee, K. Y., Kim, M. K., Choi, H. S., Kim, C. S. and Lee, S Identification of natural weed hosts of Tomato chlorosis virus in Korea by RT-PCR with root tissues. Eur. J. Plant Pathol. 142: Kim, J. S., Lee, S. H., Choi, H. S., Kim, M. K., Kwak, H. R., Nam, M., Kim, J. S., Choi, G. S., Cho, J. D., Cho, I. S. and Chung, B. N Occurrence of virus diseases on major crops in Res. Plant Dis. 17: (In Korean) Kim, M. K., Kwak, H. R., Han, J. H., Ko, S. J., Lee, S. H., Park, J. W., Jonson, M. G., Kim, K. H., Kim, J. S., Choi, H. S. and Cha, B. J Isolation and characterization of Pepper mottle virus infecting tomato in Korea. Plant Pathol. J. 24: Kumar, S., Udaya, S. A. C., Nayaka, S. C., Lund, O. S. and Prakash, H. S Detection of Tobacco mosaic virus and Tomato mosaic virus in pepper and tomato by multiplex RT-PCR. Lett. Appl. Microbiol. 53: Koressaar, T. and Remm, M Enhancements and modifications of primer design program Primer3. Bioinformatics 23: Lawyer, F. C., Stoffel, S., Saiki, R. K., Chang, S. Y., Landre, P. A., Abramson, R. D. and Gelfand, D. H High-level expression, purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5 to 3 exonuclease activity. PCR Methods Appl. 2: Lee, J. S., Cho, W. K., Lee, S. H., Choi, H. S. and Kim, K. H Development of RT-PCR based method for detecting five nonreported quarantine plant viruses infecting the family Cucurbitaceae or Solanaceae. Plant Pathol. J. 27: Mumford, R. A., Barker, I. and Wood, K. R The detection of tomato spotted wilt virus using the polymerase chain reaction. J. Virol. Methods 46: Okuda, M. and Hanada, K RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsrna template. J. Virol. Methods 96: Park, M. R. and Kim, K. H RT-PCR detection of three nonreported fruit tree viruses useful for quarantine purpose in Korea. Plant Pathol. J. 20: Tomato Genome Consortium The tomato genome sequence provides insights into fleshy fruit evolution. Nature 485: Thottathil, G. P., Jayasekaran, K. and Othman, A. S Sequencing crop genomes: a gateway to improve tropical agriculture. Trop. Life Sci. Res. 27: Usta, M., Sipahioglu, H. M. and Polat, B Studies on parameters influencing the performance of reverse transcriptase polymerase chain reaction (RT-PCR) in detecting Prunus necrotic ringspot virus (PNRSV). Phytopathol. Mediterr. 44: Webster, C. G., Wylie, S. J. and Jones, M. G. K Diagnosis of plant viral pathogens. Curr. Sci. 86:

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S 식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding

More information

01-15(3)-12(최장경).fm

01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

16-15(3)-07(최장경).fm

16-15(3)-07(최장경).fm Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio

식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018)   3 Detection and Identification of a Mixed Infectio 식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea *

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미,

66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미, 농업생명과학연구 49(4) pp.65-72 Journal of Agriculture & Life Science 49(4) pp.65-72 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.65 Tomato ringspot virus 검역진단시스템개발 이시원

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

½Éº´È¿ Ãâ·Â

½Éº´È¿ Ãâ·Â Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

13장문현(541~556)ok

13장문현(541~556)ok A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

(조인숙)-o.fm

(조인숙)-o.fm 식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

PJTROHMPCJPS.hwp

PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

Jkcs022(89-113).hwp

Jkcs022(89-113).hwp 대한배뇨장애 및 요실금 학회지 J. Korean Continence Society 2004;8:89-113 Bristol Female Lower Urinary Tract Symptom 설문지의 한국어 번역 및 번역본의 언어 타당도 Seung-June Oh*, Hyung Geun Park*, Sung Hyun Paick, Won Hee Park and Myung-Soo

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, ) Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).

212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014). 식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI:   * Suggestions of Ways Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2 (Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability 27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제

More information

SMARTer 시리즈

SMARTer 시리즈 SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu

식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017)   Analysis of the Cause of the Twig Blight on Mu 식물병연구 Note Open Access Res. Plant Dis. 23(3) : 283-287 (2017) https://doi.org/10.5423/rpd.2017.23.3.283 Analysis of the Cause of the Twig Blight on Mulberry Based on the Weather Conditions * *Corresponding

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

Æ÷Àå82š

Æ÷Àå82š Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose

More information

2. 박주민.hwp

2. 박주민.hwp 仁 荷 大 學 校 法 學 硏 究 第 15 輯 第 1 號 2012년 3월 31일, 149~184쪽 Inha Law Review The Institute of Legal Studies Inha University Vol.15, No.1, March 2012 인터넷을 통한 선거운동과 공직선거법 * 박 주 민 법무법인(유한) 한결 변호사 < 목 차 > Ⅰ. 머리말

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

(3)-388(최홍수).fm

(3)-388(최홍수).fm 식물병연구 Res. Plant Dis. 17(3) : 334 341 (2011) http://dx.doi.org/10.5423/rpd.2011.17.3.334 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology 2010 년우리나라주요작물바이러스병발생상황

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 金 台 俊 의 學 術 硏 究 와 國 故 整 理 作 業 *1) - 朝 鮮 漢 文 學 史 서술을 중심으로 崔 英 成 ** ` Ⅰ. 머리말 Ⅱ. 天 台 山 人 의 생애 개관 Ⅲ. 天 台 山 人 의 학문 역정 Ⅳ. 조선한문학사 의 위치 Ⅴ. 조선한문학사 의 방법론과 한계 요 약 1930년대 국문학자, 문학사가( 文 學 史 家 )로 활약했던, 전설적인 인물

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

20121217--2012년AQM보고서_Capss2Smoke-자체.hwp

20121217--2012년AQM보고서_Capss2Smoke-자체.hwp 11-148523-1331-1 대기모델링 정보지원 시스템을 위한 표준자료 구축 연구(Ⅱ) - CAPSS2SMOKE 프로그램 개발 기후대기연구부 대기공학연구과 Ⅱ 212 목 차 i 목 차 ii 목 차 iii 목 차 iii Abstract v Ⅰ. 서 론.., (Kim et al, 28). Clean Air Policy Support System (CAPSS).

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information