fm
|
|
- 규철 범
- 7 years ago
- Views:
Transcription
1 pissn / eissn J. Fd Hyg. Saf. Vl. 32, N. 2, pp. 129~134 (2017) Jurnal f Fd Hygiene and Safety Available nline at 국내유통중인생닭및닭가공품에서병원성대장균의분리및특성 조용선 1 * 이다연 1 김희언 1 이명기 2 이주영 1 1 한국식품연구원식품분석센터, 2 한국식품연구원전통식품연구센터 Prevalence and Characterizatin f Diarrheagenic Escherichia cli Islated frm Raw Chicken and Chilled Chicken in Krea Yng-Sun Ch 1 *, Da-Yen Lee 1, Hee-En Kim 1, Myung-Ki Lee 2, and J-Yung Lee 1 1 Fd Analysis Center, Krea Fd Research Institute, Gyenggi, Krea 2 Traditinal Fd Research Grup, Krea Fd Research Institute, Gyenggi, Krea (Received January 13, 2017/Revised January 28, 2017/Accepted February 15, 2017) ABSTRACT - Diarrheagenic Escherichia cli is nw recgnized as an imprtant cause f diarrhea, hemrrhagic clitis and hemlytic-uremic syndrme (HUS) wrldwide. E. cli were islated frm 80 f 356 (22.5%) chicken and chilled chicken prducts in Krea. Fifteen virulence genes specific fr pathgenic E. cli, including Shiga txin-prducing E. cli (STEC), enterpathgenic E. cli (EPEC), entertxigenic E. cli (ETEC), enterinvasive E. cli (EIEC) and enteraggregative E. cli (EAEC), were examined by multiplex PCR. STEC virulence markers were detected fr eaea (20.0%), escv (21.3%), stx1 (3.8%), ent (2.5%), EHEC-hly (1.3%), stx2 (1.3%), EAEC virulence marker (asta) was detected in 32.5%. ETEC and EIEC were nt detected. STEC sertypes O152, O1, O116, O26, O25, O119 and O153 were fund in chicken samples. This suggests the imprtance f diarrheagenic Escherichia cli cntrl in raw chicken and chilled chicken fd fr fd safety. Key wrds : Diarrheagenic Escherichia cli, Prevalence, Chicken, Multiplex PCR, STEC O-sergrup 병원성대장균 (Pathgenic Escherichia cli) 는전세계적으로식중독을발생시키는중요한병원균으로알려져있다. 인간에게감염되면심한설사증상을일으키며특히개발도상국에서유아사망률이높아공중보건의문제로대두되고있다 1). 병원성대장균은병원성을일으키는독성원인에따라구분이된다 : 시가독소생성대장균 (Shiga txinprducing E. cli: STEC), 장독소형대장균 (Entertxigenic E. cli: ETEC), 장병원성대장균 (Enterpathgenic E. cli: EPEC), 장출혈성대장균 (Enterhemrrhagic E. cli: EHEC), enterinvasive E. cli (EIEC), 장부착성대장균 (enteraggregative E. cli: EAEC) 2,3). STEC는 stx1 또는 stx2 유전자변이에의해 shiga txin 을생성하며, 장부착유전자인 eae를수반하기도한다. 때로는 enterhemlysin (EHEC-hly) 유전자에의해서추가적인독성을지니기도한다 4). STEC는급성대장염이나용 *Crrespndence t: Yng-Sun Ch, Krea Fd Research Institute, 516 Baekhyen-dng Bundang-gu, Sengnam-si Gyenggid 13539, Krea Tel: , Fax: ysch@kfri.re.kr 혈성요독성증후군을일으키며 (HUS) 소아에게급성신부전증을발생시킨다. STEC 중 EHEC는 30개국이상에서사람에게식중독이발병한보고가있으며, 한국에서도 2012년 1,844명에게 31건이발생하였으며 2015년에는 2,138 명에게 38건이발병하여꾸준히증가하고있다 5). ETEC는여행자설사와소아설사로주로개발도상국가의설사질환의원인균으로, 설사의중요한원인은 heat-labile (LT) 과 heat-stable (ST) entertxins으로발병한다 6). EPEC는 HeLa 세포나 HEp-2세포에부착성을나타낸다. 이러한성상은 fimbria가 HEp-2 세포에달라붙는성질로다른 E. cli와감별되며 adherence (EAF) plasmid에의해생성되고장점막상피세포에달라붙는 Attaching-and-Effacing (AE) 부착인자는염색체유전자 (eaea) 에의해조절된다 7). 주로분변에의해서전이되며개발도상국에서는유아의혈변의주요한원인이며선진국에서도유아의설사를빈번하게일으킨다. EIEC는 Shigella와유사하며심한경우수양성 8) 설사와이질을유발하며전이는오염된식품이나물을통해서유발된다. EAEC는전형적인부착패턴을보이며 9) 장독소형 ETEC의내열성독소 (Heat-stable txin: ST) 와유사한특성을가지는 Enteraggregative Escherichia cli 129
2 130 Yng-Sun Ch, Da-Yen Lee, Hee-En Kim, Myung-Ki Lee, and J-Yung Lee heat-stable entertxin 1 (EAST1) 을확인보고하였다. 후속연구에서 38개의아미노산으로구성된 EAST1가 EAEC뿐만아니라장독소형 ETEC, EPEC에서도발견됨으로써식중독을일으키는대장균의주요한병원성인자로주목받고있다 10). 대장균의혈청형은 50,000종이상으로많으나, 전세계적으로는 O26, O103, O111, O145, O157: H7의 O 혈청형으로부터유래된 STEC에의한식중독사고는매우빈번하게발생한다고보고되고있으며, 공중보건학적으로중요한병원성균주로고려된다. 국내연구에는식 11) 육에서분리된대장균에대한병원성특성대한연구결과는있으나, 생닭및가공조리된식품에서분리된대장균에대한병원성특성에대한연구는미흡한실정이다. 또한우리나라병원성대장균식중독의경우환자에서의규명비율은높은반면에식품에서원인규명비율은낮은것이문제점으로지적되고있다 12). 따라서본연구는유통중인생닭및가열조리된닭가공품에서병원성대장균의오염도를조사하고병원성유전자및혈청형을분석하여병원성대장균의특성을파악하고자하였다. 이러한결과는병원성대장균에의한식중독발생의원인파악의 기초자료로활용될수있다고생각된다. Cllectin f samples Materials and Methds 생닭 (N = 132) 및가열조리된닭가공품 (N = 224) 를슈퍼마켓이나대형유통매장에유통중인시료를구입하였다. 구입된시료는교차오염을방지하기위해멸균백에담아냉장운반하였으며구입후 4시간이내시험을실시하였다. Strain islatin and identificatin 대장균은 Bacterilgical Analytical Manual 및식품공 13) 전시험방법으로분리하였다. 시료 25 g에 225 ml f 14) mtsb brth (Difc, Detrit, MI., USA) 증균배지를가해서 stmacher (400 Circulatr, Seward, Lndn, UK) 로 260 rpm, 1 min 균질화한후배양하였다. 배양액은 37 C에서 18~24 h 배양한후 end agar (Merck, Darmstadt, Germany) 와 CHROM agar STEC (CHROMagar, Paris, France) 에 37 C에서 18 h 배양하였다. 배양후전형적인집락을선별 Table 1. Olignucletide primers used fr detectin f the virulence genes 1) Pathgen grup Target gene Primer bp eaea eae-f: TCAATGCAGTTCCGTTATCAGTT eae-r: GTAAAGTCCGTTACCCCAACCTG 482 STEC, EPEC escv MP3-escV-F: ATTCTGGCTCTCTTCTTCTTTATGGCTG MP3-escV-R: CGTCCCCTTTTACAAACTTCATCGC 544 ent ent-f: TGGGCTAAAAGAAGACACACTG ent-r: CAAGCATCCTGATTATCTCACC 629 EHEC-hly hlyehec-f: TTCTGGGAAACAGTGACGCACATA hlyehec-r: TCACCGATCTTCTCATCCCAATG 688 EHEC stx1 MP4-stx1A-F: CGATGTTACGGTTTGTTACTGTGACAGC MP4-stx1A-R: AATGCCACGCTTCCCAGAATTG 244 stx2 MP3-stx2A-F:GTTTTGACCATCTTCGTCTGATTATTGAG MP3-stx2A- R: AGCGTAAGGCTTCTGCTGTGAC 324 EIEC ipah inve ipah-f: GAAAACCCTCCTGGTCCATCAGG ipah-r: GCCGGTCAGCCACCCTCTGAGAGTAC MP2-invE-F: CGATAGATGGCGAGAAATTATATCCCG MP2-invE-R: CGATCAAGAATCCCTAACAGAAGAATCAC aggr MP2-aggR-F: ACGCAGAGTTGCCTGATAAAG MP2-aggR-R: AATACAGAATCGTCAGCATCAGC 400 EAEC pic MP2-pic-F: AGCCGTTTCCGCAGAAGCC MP2-pic-R: AAATGTCAGTGAACCGACGATTGG 1111 asta MP2-astA-F: TGCCATCAACACAGTATATCCG MP2-astA-R: ACGGCTTTGTAGTCCTTCCAT 102 ETEC elt estib MP2-LT-F: GAACAGGAGGTTTCTGCGTTAGGTG MP2-LT-R: CTTTCAATGGCTTTTTTTTGGGAGTC MP2-STI-F: TGTCTTTTTCACCTTTCGCTC MP2-STI-R: CGGTACAAGCAGGATTACAACAC s rrna uida MP2-uidA-F: ATGCCAGTCCAGCGTTTTTGC MP2-uidA-R:AAAGTGTGGGTCAATAATCAGGAAGTG 1487
3 Prevalence and Characterizatin f Diarrheagenic Escherichia cli Islated frm Raw Chicken and Chilled Chicken in Krea 131 하여 Vitek 2 (Bimeriux, Marcy L'Etile, France) 를이용하여생화학시험후동정하였다. PCR assays fr detectin f diarrheagenic E. cli 분리한대장균에대해서독성유전자존재를분석하였다. 독성유전자는 1) uida, inve, escv, aggr, stx1, 2) eaea, elt, ipah, stx2, estib, 3) pic, EHEC-hly, ent, asta 로 tgradient PCR (Bimetra, Gettingen, Germany) multiplex PCR을이용하였다. Primer는 Bineer (Chengwn, Chungbuk, Krea) 에서구입하였고 sequence는 Table 1과같다. 1) PCR은총반응액 20 µl으로 accupwer multiplex PCR pre mix (Bineer, Daejn, Krea) 에 1U의 taq plymerase 250 µm, 각각 dntps, 10 mm Tris-HCl, 1.5 mm MgCl 2, 2-10 pml의 primer로하였으며단일집락을 PCR template로사용하였다. PCR 반응은 98 C에서 30초반응후에 98 C 에서 30초, 63 C에서 60초, 72 C에서 90초, 35 cycle 반응 후 72 C에서 10분연장시켰다. 반응산물은 2% Seakem agarse gel (Takara, Kyt, Japan) 에서 100 V, 25분전기영동후 ethidium brmide (1 µg/ml) 염색후확인하였다. Sertyping f shiga txin-prducing E. cli STEC를분석하기위해 E. cli Antigen grup O sera (Denka Seiken, Tky, Japan) 을사용하였고분석방법은 O antigen의응집반응을 slide에서확인하였다. 기타시험방법은제조사의메뉴얼에따라분석하였다. Shiga txin-prducing E. cli (STEC) 의혈청학적검사를위해 O26, O157, O145, O111, O121, O103, O91의혈청형에대해 rfb (-specific plysaccharide), wzx (-unit flippase), wbsd (amintransferase) 의 -항원유전자에특이 적으로결합하는 primer를사용하였다 (Table 2). PCR 15,16) 반응액은 1 U Taq plymerase, 250 µm 각 dntps, 10 mm Tris-HCl, 30 mm KCl, 1.5 mm MgCl 2 가포함된 reactin buffer (AccuPwer PCR Pre mix, Bineer Daejn, Krea) 에 10 pml의 primer에순수분리된단일 clny를 template 로총반응액을 20 µl로하였다. PCR 반응조건은 predenaturatin 94 C에서 5분후, 35cycles의 94 C에서 30초, 55 C에서 75초, 68 C에서 75초로반응하였고최종 extensin 은 68 C에서 7분반응시켰다. 증폭된 DNA는 2% agarse gel (Takara, Kyt, Japan) 을 100 V로 30분간전기영동후 ethidium brmide (1 µg/ml) 에염색하여 UV transilluminatr 로확인하였다. Results and Discussin Prevalence f E. cli islates 생닭과조리된닭가공품 356시료에서대장균 80균주 (22.5%) 가분리되었다. 생닭에서는 132시료중 79(59.8%) 개의대장균이분리되었으며가열조리된닭가공품에서는 224시료중 1(0.4%) 개에서만대장균이검출되었다. Zha 등에의하면 retail market에서수집한닭에서의대장균 17) 검출은 38.7% 였으며, supermarket에서수집한시료에서는 20.9% 가검출되었으며, Chi 등 10) 에의하면 29.6% 의대장균이검출되었다. 본연구결과생닭에서의대장균검출률은 59.8% 로선행연구보다높게검출되었다. 대장균의경우유통과정중다양한경로의해교차오염이될수있으므로완전포장되어유통되지않고, 구매자의요구에따라포장판매가되거나절단이되는경우는대장균이교차오염에의해검출될수있다. 이러한이유로논 Table 2. Olignucletide primer used varius E. cli sergrups Pathgen Target gene (bp) Primer (5'-3') Reference O26 wzx (152) O157 rfbe (259) O145 wzx (374) O111 rfb (406) O121 wzx (587) O103 wzx (1,117) O91 wbsd (940) GCG CTG CAA TTG CTT ATG TA TTT CCC CGC AAT TTA TTC AG CGG ACA TCC ATG TGA TAT GG TTG CCT ATG TAC AGC TAA TCC TGC TCG ACT TTT ACC ATC AAC AAC CAA CAC CAT ACA CCT TGT CTT TAG AGA AAT TAT CAA GTT AGT TCC ATA GTT ATG AAC ATC TTG TTT AGC TCA TTA GCG GTA GCG AAA GG TTC TGC ATC ACC AGT CCA GA TTC ATC ACA AGT TTC ACA AG CGT AAT CAC CTT GAT TTT CT GAT GAA TCA ACC TTA TCG AG CTG CTT ATG TAT AGG AAT TGG Paddck et al. [16] Paddck et al. [16]
4 132 Yng-Sun Ch, Da-Yen Lee, Hee-En Kim, Myung-Ki Lee, and J-Yung Lee Table 3. Prevalence f virulence gene factrs amng 80 E. cli islated frm chicken fds Pathgrup Target gene Samples cntaminated N. % STEC, EPEC eaea escv ent Typical EPEC bfpb EHEC EHEC-hly stx stx EIEC ipah inve EAEC aggr pic asta ETEC elt estia estib E. cli uida Table 4. Prevalence f diarrheagenic E. cli in chicken fds Pathgrup Sample cntaminated N. % STEC, EPEC Typical EPEC EHEC EIEC EAEC ETEC EHC+EAEC STEC+EAEC Ttal 문에따라대장균검출률의차이가있는것으로생각된다. 그러나대장균은위생지표세균으로생닭의경우는충분히가열조리해야안전하게섭취할수있을것으로생각된다. Virulence genes and sertyping f E. cli islates 시료에서분리한대장균 80균주에대해서병원성유전자를분석한결과 asta 유전자가 26균주 (32.5%) 에서검출되었으며, escv 유전자는 17균주 (21.3%) eaea 유전자는 16 균주 (20.0%) 검출되었다. 특히식품에서문제가되는장출혈성대장균유전자 stx1는 3균주 (3.8%) 와 stx2, EHEChly는각 1균주 (1.3%) 로검출되었다 (Table 3). 병원성유전자를토대로 STEC, EPEC, EHEC, EIEC r EAEC의병원성대장균으로분류한결과대장균 80균주 Table 5. O sertyping f islated EHEC Sample Pathgrup Virulence genes Sertype f PCR Sertype f O antigen chicken EHEC stx1 ND* O152 chicken EHEC stx1 ND* O1 chicken EHEC EHEC-hly ND* O166 chicken STEC/EPEC escv O26 O26 chicken STEC/EPEC eaea ND* O25 chicken STEC/EPEC escv ND* O119 chicken STEC/EAEC eaea, asta ND* O153 ND*: Nt detected 에서병원성대장균45균주 (56.3%) 분리되었다 (Table 4). 이중 nly EAEC는 20균주 (25.0%) 로가장많이분리되었으며, 본연구에서식육에서 asta의유전자가많이분리된시험결과는 Chi 등의결과와유사하였다. 10) 병원성대장균 STEC, EPEC는 11균주 (13.8%) 가검출되었다. 공존하고있는 STEC균주는 atypical EPEC에존재하는모든독성인자를보유하기때문에 STEC와 EPEC 를구분하는것은불가능하다 1). 식품에서위해성이높은 EHEC는 2균주 (2.5%) 가검출되었으며, typical EPEC, EIEC and ETEC의병원성대장균은검출되지않았다. 6균주 (7.5%) 는두개의병원성 grup (STEC and EAEC) 이동시에검출되었다. Badri 등에의하면 EAEC 식품에서병 9) 원성유발에대한연구는미흡하나, EAEC는저분자량의특히 heat-stable plasmid encded entertxin (EAST 1) 을유발한다고알려져있다 10). 본연구에서도생닭에서 EAEC 의검출율이 25.0% 로가장높다. 따라서생닭에서의 EAEC 오염원에대한추가적인연구가필요하여, 닭을조리시에는대장균이완전히사멸할수있도록하여안전하게섭취하여야한다. Virulence genes and sertyping f islated enterhemrrhagic E. cli (EHEC) STEC, EHEC로분리된병원성대장균 25균주를 PCR을이용해서 7종의혈청형에대해서분석한결과 escv 유전자를보유하고있는 1 균주에서 O26 혈청형이확인되었다. PCR을이용해서확인되지않은병원성대장균을 antisera 로분석한결과 stx1 유전자를보유한 EHEC에서는 O152, O1 혈청형이확인되었으며 EHEC-hly 유전자를보유한 EHEC에서는 O116 혈청형이확인되었다 (Table 5). 그밖에 STEC에서는 O26, O25, O119, O153의혈청형이각 1 개씩확인되었으며, O26으로분리된시료는 PCR과동일한결과가나타났다. 그외다른병원성대장균 (O157, O145, O111, O121, O103, O91) 은확인되지않았다. 분석한 25 균주중 7균주만혈청형을알수있었다. 그밖의다른균주는 O sertyping이불가능했으며이는 Kim 등 18)
5 Prevalence and Characterizatin f Diarrheagenic Escherichia cli Islated frm Raw Chicken and Chilled Chicken in Krea 133 과유사하게 sertyping이불가능한균주들이분리되었다. Patn 등에의하면본결과와유사하게 stx 유전자를가 19) 지고있어도사람에게위해가되는 O26, O103, O111, O145 and O157 혈청형이아닐수도있으며 stx 유전자를가지고있지않는 O26, O103, O111, O145 and O157 의혈청형도존재할수도있다. 또한, 위해도가높은균주는 stx 유전자를가지고있으면서 O26, O103, O111, O145 and O157 혈청형을가져야한다고보고하고있다. 따라서본시험에서생닭의분리한대장균중병원성대장균검출률은 56.3% 로높았으나그중위해성이높은균주는 1균주 (0.7%) 였다. 조리한닭의경우는대장균의검출률이 0.4% 로시중유통중인조리된닭의경우는안전하게조리가열되고있음을알수있었다. 그러나생닭에위해성이높은대장균이존재하므로생닭은가공조리시교차오염이발생하지않도록조리도구, 조리환경에대한철저한관리가필요하다고생각된다. Acknwledgement 이논문은 2016 년도미래창조과학부재원으로한국식품연구원의지원 (E ) 을받아수행된연구성과입니다. 국문요약 병원성대장균군은전세계적으로식중독을발생하는중요한병원균으로알려져있다. 국내유통중인생닭과조리된닭가공품 356시료에서대장균 80균주 (22.5%) 를분리하여병원성유전자 multiplex PCR를이용하여분석한결과 asta 유전자가 26균주 (32.5%) 에서검출되었으며, escv 유전자는 17균주 (21.3%) eaea 유전자는 16균주 (20.0%) 검출되었다. 특히식품에서문제가되는장출혈성대장균유전자 stx 1는 3균주 (3.8%) 와 stx 2, EHEC-hly는각 1균주 (1.3%) 에서검출되었다. 병원성유전자를토대로 STEC, EPEC, EHEC, EIEC r EAEC의병원성대장균으로분류한결과 45균주 (56.3%) 가검출되었으며 typical EPEC, EIEC and ETEC의병원성대장균은검출되지않았다. STEC 병원성대장균은 O152, O1, O116, O26, O25, O119, O153 혈청형이분리되었다. 특히생닭에서병원성대장균에대한검출률이높으므로생닭을가공조리시교차오염이발생하기않도록조리도구, 조리환경에대한철저한관리가필요하다고생각된다. References 1. Kagambega, A., Martikainen, O., Lienemann, T., Siitnen, A., Trare, A. S., Barr, N. and Haukka, K.: Diarrheagenic Escherichia cli detected by 16-plex PCR in raw meat and beef intestines sld at lcal markets in Ouagadugu, Burkina Fas. Intern. J. Fd Micrbil., 153, (2012). 2. López-Sauced, C., Cerna, J. F., Villegas-Sepulveda, N., Thmpsn, R., Velazquez, F. R., Trres, J. and Tarr, P. I.: Single Multiplex Plymerase Chain Reactin T Detect Diverse Lci Assciated with Diarrheagenic Escherichia cli. Emerging Infectius Diseases, 9, (2003). 3. Natar, J. P. and Kaper, J. B.: Diarrheagenic escherichia cli. Clinical Micrbilgy Reviews, 11, (1998). 4. Schmidt, H., Beutin, L. and Karch, H.: Mlecular analysis f the plasmid-encded hemlysin f Escherichia cli O157: H7 strain EDL 933. Infectin and immunity, 63, (1995). 5. Fd and Drug Statistical Year Bk Ministry f Fd and Drug Safety. 6. Barrett, T. J., Kaper, J. B., Jerse, A. E. and Wachsmuth, I. K.: Virulence Factrs in Shiga-like Txin-Prducing Escherichia cliislated frm Humans and Cattle. J. Infectius Diseases, 165, (1992). 7. Kim, S.H., Sng, H.J., Chung, J.k., Ha, D.R., Ryu, P.Y. and Lee, J.B.: Gentypic and Phentypic Characterizatin f Enterpathgenic Escherichia cli Islated frm Diarrheal Patients in Gwangju. J. Bacterilgy and Virlgy, 36, (2006). 8. Bischff, C., Lüthy, J., Altwegg, M. and Baggi, F.: Rapid detectin f diarrheagenic E. cli by real-time PCR. J. Micrbil. Methds, 61, (2005). 9. Badri, S., Fillil, I., Carle, I., Hassar, M., Fassuane, A. and Chen, N.: Prevalence f virulence genes in Escherichia cli islated frm fd in Casablanca (Mrcc). Fd Cntrl, 20, (2009). 10. Chi, S.K., Lee, M.H., Lee, B.H., Jung, J.Y. and Chi, C.S.: Virulence factr prfiles f Escherichia cli islated frm prk and chicken meats btained frm retail markets. Krean J. Fd Sci. Animal Resur., 30, (2010). 11. Perelle, S., Dilasser, F., Grut, J. and Fach, P.: Screening fd raw materials fr the presence f the wrld s mst frequent clinical cases f Shiga txin-encding Escherichia cli O26, O103, O111, O145 and O157. Intern. J. Fd Micrbil., 113, (2007). 12. Lee, J.K., Park, I.H., Yn, K., Kim, H. J., Ch, J.I., Lee, S.H. and Hwang, I.G.: An analysis f epidemilgical investigatin reprts regarding t pathgenic E. cli utbreaks in Krea frm 2009 t J. Fd Hyg. Saf., 27, (2012). 13. Fd, U. S. Drug Administratin bacterilgical analytical manual. AOAC Internatinal, Gaithersburg; Assciatin, K. F. I.: Krean fd standards cdex. Available frm Accessed Jan.13, 2017 (2017). 15. Valadez, A. M., Debry, C., Dudley, E. and Cutter, C. N.: Multiplex PCR detectin f Shiga txin-prducing Escherichia cli strains belnging t sergrups O157, O103, O91, O113, O145, O111, and O26 experimentally inculated in beef carcass swabs, beef trim, and grund beef. J. Fd Prtectin, 74, (2011).
6 134 Yng-Sun Ch, Da-Yen Lee, Hee-En Kim, Myung-Ki Lee, and J-Yung Lee 16. Paddck, Z., Shi, X., Bai, J. and Nagaraja, T.: Applicability f a multiplex PCR t detect O26, O45, O103, O111, O121, O145, and O157 sergrups f Escherichia cli in cattle feces 1. Veterinary Micrbil., 156, (2012). 17. Zha, C., Ge, B., De Villena, J., Sudler, R., Yeh, E., Zha, S., White, D. G., Wagner, D. and Meng, J.: Prevalence f Campylbacter spp., Escherichia cli, and Salmnella servars in retail chicken, turkey, prk, and beef frm the Greater Washingtn, DC, area. Applied Envirn. Micrbil., 67, (2001). 18. Kim, E.J., Park, Y.C., Ch, J.I., Lee, J.O. and Kim, H.Y.: Prevalence and characterizatin f enterhemrrhagic Escherichia cli (EHEC) islated frm grund beefs distributed in Gyeng-In regin. Krean J. Fd Sci. Technl., 38, (2006). 19. Patn, J. C. and Patn, A. W.: Pathgenesis and diagnsis f Shiga txin-prducing Escherichia cli infectins. Clinical Micrbil. Reviews, 11, (1998).
ƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More information- 2 -
- 2 - - 3 - - 4 - ➀ - 5 - - 6 - α - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - μ - 21 - ➀ - 22 - - 23 - - 24 - α - 25 - - 26 - - 27 - μ - 28 - μ μ - 29
More information- 2 -
- 2 - α - 3 - - 4 - α - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - 번호 유효성분 차나무오일 코퍼설페이트펜타하이드레이트 폴리옥신디 - 12 - - 13 - μ - 14 - α m α α μ - 15 - μ μ - 16 - m μ - 17 - - 18 - - 19 - μ - 20 - μ μ μ - 21 - -
More informationF. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4)
FSequencing 01. DNA sequencing Phone: 1588-9788 (ext.4 4) E-mail: sequencing@bioneer.co.kr 01. 242 FAQs 247 개요 상세 설명 바이오니아는 국내 최초로 를 시작하였으며, 매년 개선된 high-throughput sequencing service를 제공하고 있습니다. Plasmid
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More information- 1 -
- 1 - ( 단위 : 건수 ) 특허 논문 구분 출원등록 SCI 비 SCI 기술실시 ( 이전 ) 상품화 ( 시제품 ) 기타 1차년도목표 1 1 1 달성 6 2 2 목표 1 0 2 2 2차년도 달성 0 4 1 2 3차년도목표 2 1 2 2 달성 3 1 3 2 계 목표 4 1 5 5 2 2 달성 9 5 10 4 3 2(5) l l l l - 2 - l l l l
More information45(2)-11(027)p fm
The Krean Jurnal f Micrbilgy, Vl. 45, N. 2, June 2009, p. 163-169 Cpyright 2009, The Micrbilgical Sciety f Krea ü ³ Klebsiella pneumniae Escherichia cliƒ w Ÿ k k (Extended-Spectrum β-lactamase, ESBL) wz
More information13.fm
pissn 1229-1153 / eissn 2465-9223 J. Fd Hyg. Saf. Vl. 32, N. 4, pp. 336~340 (2017) https://di.rg/10.13103/jfhs.2017.32.4.336 Jurnal f Fd Hygiene and Safety Available nline at http://www.fdhygiene.r.kr
More information45(3)-10(048)p fm
The Korean Journal of Microbiology, Vol. 45, No. 3, September 009, p. 86-90 Copyright 009, The Microbiological Society of Korea s Semi-quantitative RT-PCR w v H9N y» ù» 1 Á Á 3 Á 4 Á x 5 Á 5 Á 5 Á 5 Á«x
More informationfm
J. Fd Hyg. Safety Vol. 25, No. 3, pp. 220~225 (2010) Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 서울시내유통식품에서분리한대장균의항생제내성및내성유전자 유영아 * 김무상 김경식 박선희 정성국 서울시보건환경연구원 Antimicrobial
More information45(2)-6(015)p fm
The Krean Jurnal f Micrbilgy, Vl. 45, N. 2, June 2009, p. 126-132 Cpyright 2009, The Micrbilgical Sciety f Krea ü Leginella spp. w w ½ *Á xá½ Á Á Áw» p y w q ³ e s k ³,»z ùy wì ƒ š ³. 2008 6 l 8 ¾ ü 25
More information발간등록번호 11-1470550-000330-01 식품중사용원료진위판별지침서 유전자분석법활용 2013. 12. - 유전자분석법활용 - 발간사 최근부당이익을얻기위하여값싼원료를사용하거나표시사항을허위로기재하는등의불량식품 가짜식품 제조 유통사례가증가하고있는실정입니다. 특히고추양념을혼합한불량고춧가루 다진마늘에양파혼합 홍삼분말에마분말혼합등의사례가언론등을통하여보도되면서식품에대한불안감이있는실정입니다.
More information23(2)-04(최성숙).fm
J. Fd Hyg. Safety Vl. 23, N. 2, pp. 121~128 (2008) Jurnal f Fd Hygiene and Safety Available nline at http://www.fdhygiene.r.kr Real-time PCR 을이용한원유시료유래황색포도상구균의신속검출 정재혁 정순영 1 이상진 1 최성숙 * 삼육대학교약학대학, 1 삼육대학교과학기술대학동물과학부
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information42(3)-6(p ).fm
The Krean Jurnal f Micrbilgy, Vl. 42, N. 3, September 2006, p. 216-222 Cpyright 2006, The Micrbilgical Sciety f Krea β-galactsidase ³ p»á ù 2 Á 2 Á Á Áy 3 Á½ * w œw y œw l ƒm w œw œ f β-galactsidase (lactase)
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information(2)-06(신순선).fm
Res. Plant Dis. 16(2) : 158-162 (2010) Research in Plant Disease The Krean Sciety f Plant Pathlgy š «³ «Á y 1 Á Á wá * wû w yw, 1 š w Selectin f Bicntrl Agents against Phytphthra Blight f Pepper and Its
More information9(2) fm
Jurnal f Dental Hygiene Science Vl. 9, N. pp. 49~55 (009) 치면세균막내의 Fusbacterium nucleatum 과 Actinbacillus actinmycetemcmitans 의동정을위한세균배양법및 Multiplex 법의비교 ½y Á û w w e Cmparisn between Bacterial Methd and
More information03. In011.hwp
V 3+CD4+ T Selective Expansion of TCR V 3+CD4+ T Cells in Collagen-induced Arthritis in DBA/1 Mice Jae Seon Lee, Mi La Cho, Jung Eun Lee, So Youn Min, Chong Hyeon Yoon, Wan Uk Kim, Jun Ki Min, Sung Hwan
More informationDNA의추출 Table 1. Sequences of oligonucleotide primers Primers L1 consensus primer Sequence CGT CCM ARR GGA WAC TGA TC Size of amplified products
KISEP Rhinology Korean J Otolaryngol 2000;43:836-43 비 부비동반전성유두종에서인유두종바이러스및 Epstein-Barr 바이러스의검출과 p53 단백및 Proliferating Cell Nuclear Antigen 의발현 조진희 서병도 전범조 장한성 양명재 윤희로 노우영 Detection of Human Papillomavirus
More information한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석
한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in
More information이발명을지원한국가연구개발사업 과제고유번호 부처명 농촌진흥청 연구관리전문기관 연구사업명 현장협력기술개발사업 연구과제명 저항성유전자의개발및이용 기여율 주관기관 경희대학교 연구기간 ~
(19) 대한민국특허청 (KR) (12) 공개특허공보 (A) (11) 공개번호 10-2010-0103000 (43) 공개일자 2010년09월27일 (51) Int. Cl. C12N 9/10 (2006.01) C12N 15/54 (2006.01) C07K 14/415 (2006.01) A01H 1/00 (2006.01) (21) 출원번호 10-2009-0021349
More information주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 원외폐렴원인균조사및내성감시 시스템구축 주의 ( 주의내용기재 ) ( 글 14 point 고딕체 ) 제명 2 0 0 Microbiological Etiology of Community acquired pneumonia and Surveillance network of resistance 주관연구기관 : 울산대학교의과대학
More informationMicrosoft Word - 3-김민지.doc
Journal of Bacteriology and Virology 2009. Vol. 39, No. 2 p.79 95 DOI 10.4167/jbv.2009.39.2.79 Molecular Genetic Characterization of Shiga Toxin-producing E. coli Isolated from Diarrhea Patients and Cattle
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information(460 신용길).fm
식물병연구 Res. Plant Dis. 19(1) : 36 44 (2013) http://dx.doi.org/10.5423/rpd.2013.19.1.036 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 에의한카네이션괴저바이러스와카네이션둥근반점바이러스정밀진단
More information43(4)-06.fm
Krean Chem. Eng. Res., Vl. 43, N. 4, August, 2005, pp. 537-541 기포유동층반응기에서건식재생흡수제를이용한이산화탄소회수에미치는스팀및온도의영향 kkç i Ç Ç z * Çmy l v l ~rl vl 305-343 re q 71-2 *r l v 305-380 re v 103-16 (2005 3 25p r, 2005 6
More information04.fm
w y wz 9«( 2y) 91~96, 2006 J. f the Krean Sciety fr Envirnmental Analysis üy wƒ w y k p ½» w w œw Adsrptin Prperties f the Activated Carbns fr Remving Harmful Gases in Indr Envirnments In-Ki Kim Department
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information( )34.fm
Jurnal f the Krean Ceramic Sciety Vl 46, N 3, pp 75~81, 009 DOI:104191/KCERS00946375 Prus Materials frm Waste Bttle Glasses by Hydrthermal Treatment Dng-kyu Lim and Eun-Tae Kang Schl f Nan & Advanced Material
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information( )-40.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 3, pp. 237~243, 2010. DOI:10.4191/KCERS.2010.47.3.237 Synthesis f Sphene pink Pigment by Rice Husk Ash In-Dn J, Hyun-S Lee, and Byung-Ha Lee Department f Materials
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationfm
Kr. J. Micrbil. Bitechnl. Vl. 34, N. 2, 94 100 (2006) Auxin Siderphre» ³ Bacillus subtilis AH18 Á½ Á Á½ * û w w w An Auxin Prducing Plant Grwth Prmting Rhizbacterium Bacillus subtilis AH18 which has Siderphre-Prducing
More information45(3)-9(036)p fm
The Krean Jurnal f Micrbilgy, Vl. 45, N. 3, September 2009, p. 281-285 Cpyright 2009, The Micrbilgical Sciety f Krea š x w³ w l sƒ ½ 1,2 Á½ 4 *Á 3 Á ³ 5 t t w w w w y yw ü w³ x x BacT/Alert, Ogawa Löwenstein-Jensen
More informationDevelopment of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata
Development of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata . 2000. 12. 15. : : : : : : : : : - i - . :..,., 40.,,,, (, ),,,,,. Saponin, Inulin, Triterpene,,,. (C. lanceolata),
More information(079-088)Kjbt015.hwp
대한수혈학회지:제18권 제2호, 2007 다중 단일염기 시발체 확장반응을 이용한 ABO 유전자형 검사 현정원 1 장호은 2 허세란 2 송상훈 1 박경운 1,2 송정한 1,2 한규섭 1 = Abstract = 서울대학교 의과대학 검사의학교실 1, 분당서울대학교병원 진단검사의학과 2 ABO Genotyping using a Multiplex Single-base
More information22(3)-04.fm
J. Fd Hyg. Safety Vl. 22, N. 3, pp. 159~164 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available nline at http://www.fdhygiene.r.kr ù ý ô Ì»Ï Œ äâ  * ƒm w tá w Hygienic Quality f Drinking Water Served in
More informationOriginal Articles Korean Circulation J 2000;30 6 : 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic
Original Articles Korean Circulation J 2000;306:702-715 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic Variants of Thromobomodulin Gene as Risk Factors for
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information42(3)-5(p ).fm
The Krean Jurnal f Micrbilgy, Vl. 42, N. 3, September 2006, p. 210-215 Cpyright 2006, The Micrbilgical Sciety f Krea Dipldia gssypina ATCC10936 ³ w (+)-Jasmnic acid y š yá½ Á½ {* w tœw tœw Dipldia gssypina
More information발간등록번호 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도
발간등록번호 11-1543000-002003-01 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도 농림축산식품부장관귀하 본보고서를 상황버섯으로유도된 FMO3 와 Corin 에의한농약분해및혈압저하유도 ( 개발기 간 :2014. 09. ~ 2017. 09.) 과제의최종보고서로제출합니다. 2017. 11.. 주관연구기관명 : 서울시립대학교산학협력단
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information(이수헌).fm
식물병연구 Res. Plant Dis. 19(3) : 220 225 (2013) http://dx.doi.org/10.5423/rpd.2013.19.3.220 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 과 nested PCR 을이용한 Nepovirus
More information16(5)-02(57).fm
Jurnal f Krean Pwder Metallurg Institute Vl. 16, N. 5, 2009 DI: 10.4150/KPMI.2009.16.5.310 /ekœ w TiC/C w w ¼ *Áw a w œ w œw, a Snthesis f TiC/C Cmpsite Pwder b the Carbthermal Reductin Prcess Gil-Geun
More information대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Compar
대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 331-5 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Comparison of Detection of Escherichia coli O157 Between
More information48.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 5, pp. 60~65, 007. Develpment f Black Clr Spinel Pigment fr High Temperature Kwang-H Lee, Min-S Myung, and Byung-Ha Lee Department f Ceramic Engineering, Myungji
More information임상병리검사과학회지 : 제 28 권제 1 호 장관출혈성대장균 0157 : H7 가톨릭의대강남성모병원임상병리과 ljl- 져주 : ï 0 ~ Enterohaemorrhagic E. coli 0157 : H7 Park, Jeong Jun Dept. of Clini
임상병리검사과학회지 : 제 28 권제 1 호 1996. 장관출혈성대장균 0157 : H7 가톨릭의대강남성모병원임상병리과 ljl- 져주 : ï 0 ~ Enterohaemorrhagic E. coli 0157 : H7 Park, Jeong Jun Dept. of Clinical Pathology, Kangnam St. Mary s Hospital, The Catholic
More information3GA1Æ2Æ3 /4GA1Æ2Æ3 Series B-137
3GA1Æ2Æ3 /4GA1Æ2Æ3 Series B-137 4GA1 1 0 C6 E2 P 1 3GA1 1 0 C6 E2 P 1 3GA123/4GA123 Series 1 2 3 4 5 1 11 C4 C6 C8 C10 M5 06 08 E0 E00 E01 E02 E03 E2 E20 E21 E22 E23 E0N E2N E3 E1 E01J E02J E03J E21J E22J
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationKISEP Rhinology Korean J Otolaryngol 2000;43:391-5 소아만성부비동염의원인균분석 최영철 김태철 전은주 박용수 Microbiologic Study of Chronic Sinusitis in Children Young-Chul Choi
KISEP Rhinology Korean J Otolaryngol 2000;43:391-5 소아만성부비동염의원인균분석 최영철 김태철 전은주 박용수 Microbiologic Study of Chronic Sinusitis in Children Young-Chul Choi, MD, Tae-Chul Kim, MD, Eun-Ju Jeon, MD and Yong-Soo
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information353-11(07-31).fm
Kr. J. Micrbil. Bitechnl. Vl. 35, N. 3, 226 230(2007) ƒ w ³l Interfern α-1 œ e w ¼ÁÁ½Á 1 Á * ww œw» l, 1 vl Effect f Oxygen Supply n the Prductin f Interfern α-1 by Recmbinant Escherichia cli in Fedbatch
More information( )박용주97.PDF
DDA D D A 1 ) 1. D DA 1 ). D D A DDA (Doh a Developm en t Agen d a ) 194 7 GATT (Gen er a l Agr eem en t On T a r r ifs a n d T r a d e ; ) 9, 199 5 WT O. 1994 ( 1986-94 ) WT O,. D DA. WT O 2 ). GAT T
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information중합효소연쇄반응 (polymerase chain reaction:pcr) 에의한 HPV와 EBV의검출 Table 1. Oligonucleotide primers of PCR for HPV and EBV Nucleotide sequence Product size Huma
KISEP Head and Neck Korean J Otolaryngol 2001;44:0611 상악암에서중합효소연쇄반응을이용한인형유두종바이러스와 EpsteinBarr Virus 의검출 조재식 임상철 정형수 임회정 김정현 The Detection of Human Papillomavirus and EpsteinBarr Virus DNA in Maxillary
More information(1)-01(정용식).fm
Textile Science and Engineering Vl. 48, N. 1, 2011 ƒ s j p y ky w xá½ Á½» 1 Á w œ w lœw, 1 w» w (2010. 12. 10. /2011. 1. 16. k) Analysis f Stabilizatin and Carbnizatin Behavirs f Ply(acrylnitrile) Fibers
More information06.hwp
-Original Paper-35 41. 2009. 토양으로부터분리한토착유효미생물을이용한음식물쓰레기의자원화 이상우 함선녀 신택수 김혜경 연익준 * 김광렬 * (2008 8 21, 2009 1 23 ) Resource of Food Waste using Indigenous Bacteria Isolated from Soils Sang-Woo Lee Sun Nyeoo
More information02Á¶ÇýÁø
Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study
More information흡연, 알고보면 질병! 울산금연지원센터 센터장 유 철 인 교수 금연으로 치료하세요. 울산금연지원센터는? 2015년 6월 보건복지부의 지원으로 시작된 울산금연지원센터는 울산 대학교병원과 울산금연운동협의회의 문성과 신뢰성을 바탕으로 금연의 사각지대에 놓인 학교 밖 청소년,
제 8 호 (2015년 12월) 발행_울산지역암센터 / 발행인_상현 / 편집위원_이현주 유철인 남궁미 이영복 신은옥 이송희 / 울산광역시 동구 방어진순환도로 877 / TEL_052)250-8006~8 FAX_052)250-8009 울산대학교병원, 울산금연지원센터 개소 Contents 01 울산대학교병원, 울산금연지원센터 개소 02 흡연, 알고보면 질병! 금연으로
More information08-15(3)-05(이용훈).fm
Res. Plant Dis. 15(3) : 202-208 (2009) Research in Plant Disease The Krean Sciety f Plant Pathlgy y ù w (Cry1Ac1) w w ³ ûz 1,2 Á y 2 Á 2 Á 2 Á«3 Á½ š 4 Á z 1,2 * 1 w y w œw, 2 w, 3 w, 4 w y w tœw Evaluatin
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information-06-......,......
Analysis of the Current Condition of Student Childcare Training in Korea: Student Childcare Training Centers, Guidance Teachers, Student Teachers and Student Childcare Training Fees Department of Childcare
More information( )-103.fm
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 6, pp. 643~647, 2009. DOI:10.4191/KCERS.2009.46.6.643 Densificatin Behavir f C/C Cmpsite Derived frm Cal Tar Pitch with Small Amunt f Idine Additin Kwang Yun
More informationMicrosoft Word - 2-김영부.doc
Journal of Bacteriology and Virology 2007. Vol. 37, No. 2 p.69 78 설사환자에서분리한장출혈성대장균과장병원성대장균의 Enterocyte Effacement 관련 LEE 유전자의병원형특성 부산대학교의과대학미생물학교실 박도훈 문지영 김영부 * Pathotypic Characterization of Enterocyte
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information2010_3_list.xls
NO 저널명약어명처출판사 ISSN JCR IF SCI SCIE SSCI AHC Index I Medicus 언어 Animal Cells and Systems 한국동물학회 1976- 등재 1 8354 2 Annals f Dermatlgy Ann Dermatl 대한피부과학회 1013-9087 3 Archives f Pharmacal Research Arch Pharm
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information23(3)-10(김윤지).fm
J. Fd Hyg. Safety Vl. 23, N. 3, pp. 233~238 (2008) Jurnal f Fd Hygiene and Safety Available nline at http://www.fdhygiene.r.kr 국내유통간장게장제품안전성조사연구 서정은 이은정 이종경 1 오세욱 정현정 2 오명주 3 김윤지 * 한국식품연구원안전성연구단, 1 한양여자대학교
More information( )-47.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 4, pp. 302~307, 2010. DOI:10.4191/KCERS.2010.47.4.302 Effect f V-dping n Clur and Crystallizatin f Malayaite Pigments In-Dn J and Byung-Ha Lee Department f
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information10-2. 세무정보(완 - 31).hwp
한눈에 보는 해외금융계좌 신고제도 - 국세청 - Ⅰ. 제도 일반 1. 해외금융계좌 신고제도란? 거주자 및 내국법인이 해외금융기관에 개설 보유한 해외금융계좌의 잔액(보유계좌가 복수인 경우에는 각 계좌잔액을 합산함)이 신고대상연도 중에 어느 하루라도 10억원을 넘는 경우 그 계좌정보를 다음 연도 6월에 납세지 관할 세무서에 신고하는 제도입니다. - '10. 12월
More information2003report210-14.hwp
정당의 여성후보공천 확대방안에 관한 연구 한국여성개발원 연구요약 서 론 Ⅰ. Ⅰ. Ⅰ. 정당의 공직후보 공천모형과 여성후보선출과의 관계에 관한 이론적 고찰 Ⅱ. Ⅱ. 개방적 폐쇄적 유권자 당원 선출직 당기구 비선출직 당기구 당수 당내 선거인단 의회 내 코커스 당수 선출의 경우 Ⅱ. Ⅱ. Ⅱ. Ⅱ. Ⅱ.
More information11민락초신문4호
꿈을 키우는 민락 어린이 제2011-2호 민락초등학교 2011년 12월 21일 수요일 1 펴낸곳 : 민락초등학교 펴낸이 : 교 장 심상학 교 감 강옥성 교 감 김두환 교 사 김혜영 성실 근면 정직 4 8 0-8 6 1 경기도 의정부시 용현로 159번길 26 Tel. 031) 851-3813 Fax. 031) 851-3815 http://www.minrak.es.kr
More information<3130BAB9BDC428BCF6C1A4292E687770>
檀 國 大 學 校 第 二 十 八 回 학 술 발 표 第 二 十 九 回 특 별 전 경기도 파주 出 土 성주이씨( 星 州 李 氏 ) 형보( 衡 輔 )의 부인 해평윤씨( 海 平 尹 氏 1660~1701) 服 飾 학술발표:2010. 11. 5(금) 13:00 ~ 17:30 단국대학교 인문관 소극장(210호) 특 별 전:2010. 11. 5(금) ~ 2010. 11.
More information<343920C1F8C0CDB7C42DC7D1B1B9C0CE20BFECBDC4BEC6B5BFC0B8B7CEBACEC5CD2E687770>
한국산학기술학회논문지 Vol. 10, No. 7, pp. 1766-1772, 2009 강경희 1,3, 남진식 2, 진익렬 3* 1 건양대학교치위생학과, 2 수원여자대학식품영양과, 3 경북대학교대학원미생물학과 Expression of Acid Stress-Induced Proteins of Streptococcus mutans Isolated from Korean
More information국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2 014 p. ; cm. -- ( 연구보고 ; 14-25) 참고문헌 수록
A Study on Creation of Input Calculation Table for Cities and Counties of Gangwon Province 국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2
More informationuntitled
Korean J Clin Microbiol Vol. 13, No. 2, June, 2010 DOI: 10.5145/KJCM.2010.13.2.85 A Case of Verotoxin-producing Escherichia coli O157:H7 with Hemorrhagic Colitis in an Infant, Diagnosed by Multiplex PCR
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information02.33~37.fm
KOREAN JOURNAL OF PACKAGING SCIENCE & TECHNOLOGY Vl. 17, N. 33~37 (011) q t s ü CO d w ½y» 1 Á 1 Áx Á 1, 1 ûw tw mœw Cntrl f Micrbial Shelf Life f Perishable Fd by Real-Time Mnitring f CO Cncentratin f
More information거제시회 2010년 3월 4일 거창읍 여회가 경남 울산 재향군인회 정기총 회 시 봉사활동대상 단체표창을 수상하였으며, 2010년 5월 7일 출되었고, 2009년 2월 23일 제46차 정기총회에서 제22대 으로 중 건계정 농수로 우회 방지를 위한 해우교 를 설치, 준공하
포항시회 12 경남 울산시회 학생수 745,508)을 대상으로 6 25 전쟁 바로 알리기 캠페인을 전 개하여 전후세대에 대한 6 25 전쟁의 참상을 이해토록 하였다. 통합2대~4대 우채호( 宇 採 壕 ) 2007년 8월 10일부터 8월 12일까지 2박 3일간 무의촌 하계 의료봉 2007년 2월 총회에서 한창화 을 선임하였으며, 2009년 포항 시 읍 면 동
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information<C3CA3520B0FAC7D0B1B3BBE7BFEB202E687770>
1. 만화경 만들기 59 2. 물 속에서의 마술 71 3. 비누 탐험 84 4. 꽃보다 아름다운 결정 97 5. 거꾸로 올라가는 물 110 6. 내가 만든 기압계 123 7. 저녁 노을은 맑은 날씨? 136 8. 못생겨도 나는 꽃! 150 9. 단풍잎 색깔 추리 162 10. 고마워요! 지렁이 174 1. 날아라 열기구 188 2. 나 누구게? 198 3.
More information- 1 - - 2 - - 3 - 1 1 1. 연구목적 2. 연구필요성 - 4 - - 5 - - 6 - - 7 - 2-8 - 3 1. 브루셀라증 - 9 - (2006 5 12 ) ( ) (%) : (2007) (2007 112008 1 ) - 10 - 2. 큐열 9. (2009, ) (2007 112008 1 ) - 11 - 3. 장출혈성대장균감염증 - 12
More information105È£4fš
의 자선단체들이 사랑과 자비를 베푼 덕택에 국제 사회에서 훠모사가 존경받는 위치에 섰으며 국가간 에 상호우애를 다지는 데 큰 기여를 했다고 치하했 다. 칭하이 무상사 국제협회는 구호물자를 터키 지 터키 지진 피해자들을 위한 구호물자 전달식 진 피해자들에게 전달하는데 협조해 준 중국 항공의 훠모사 항공화물 센터 매니저인 제임스 류 씨, 골든 파운데이션 여행사의
More information( )-70.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 5, pp. 401~406, 010. DOI:10.4191/KCERS.010.47.5.401 Synthesis f Pure and Prus CaOÁAl Clinker by Burning f Hydrates Du Hyuk Kim and Tae Wng Sng Department f
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More information