- 1 -

Size: px
Start display at page:

Download "- 1 -"

Transcription

1

2 - 1 -

3 ( 단위 : 건수 ) 특허 논문 구분 출원등록 SCI 비 SCI 기술실시 ( 이전 ) 상품화 ( 시제품 ) 기타 1차년도목표 달성 목표 차년도 달성 차년도목표 달성 계 목표 달성 (5) l l l l - 2 -

4 l l l l l l l l - 3 -

5 l l l l l 따라서본연구를통하여시료내존재하는병원성대장균의신속검출을위한 PCR 키트개발을성공적으로달성하였음. l l l l l l l l l l l l l - 4 -

6 SUMMARY ( ) 1. multiplex PCR and real-time PCR detection kits for emetic and enterotoxigenic B. cereus l Bacillus cereus comprises the largest group of endospore-forming bacteria and can cause emetic and diarrheal food poisoning. It is widespread in nature and therefore, considered a major foodborne pathogen. There is a growing demand for fast, accurate, reliable and economic detection of potentially toxigenic B. cereus. A multiplex PCR assay for the rapid detection of enterotoxic and emetic strains in Bacillus cereus was developed and evaluated among B. cereus emetic and enterotoxic reference strains, B. cereus group members and non-target strains. l A total of 496 B. cereus strains isolated from various sources (food, environmental, clinical) were assessed by a multiplex PCR for the presence of enterotoxin genes. The prevalence rate of nhea, entfm, hblc, and cytk enterotoxin genes among all B. cereus strains was 92.33%, 77.21%, 59.47%, and 47.58%, respectively. Enterotoxigenic profiles were determined in emetic toxin- (8 patterns) and enterotoxin-producing strains (12 patterns). The results provide important information on toxin prevalence and toxigenic profiles of B. cereus from various sources. Our findings revealed that B. cereus must be considered a serious health hazard and Bacillus thuringiensis should be considered of a greater potential concern to food safety among all B. cereus group members. Also, there is need for intensive and continuous monitoring of products embracing both emetic-toxin and enterotoxin genes. l Design and verification of the 1st, 2nd and 3rd primer sets for PCR kits. All primer sets were designed specifically to target genes for B. cereus group (groel), diarrheal (cytk, nhea, hblc, entfm) and emetic strains (CER or ces) and the specificity, sensitivity and detection limits of the primer sets-based PCR approaches were confirmed on pure culture and inoculated foods. The minimum detection limits of PCR approaches using the 1st, 2nd and 3rd primer sets were respectively 20, 2, and 0.2 pg of DNA per reaction tube in pure culture and also respectively 10 3, 10 3 and 10 3 cfu/g in food samples in artificial contamination of seven different food matrices with distinct bacterial counts and improved approximately 10 1 cfu/g after 7 h enrichment. The sizes of PCR product using the 2nd or 3rd primer sets were 488, 376, 163, 106, and 70 bp, or 255, 163, 127, 97 and 81 bp for entfm, nhea, hbld, cytk and ces respectively

7 l Development and validation of multiplex PCR and real-time PCR kits. A highly sensitive pentaplex real-time PCR high resolution melt curve assay using the 3rd primer set was developed for simultaneous detection of 4 major enterotoxin and 1 emetic genes. The average melting temperatures (T m ) of PCR products were 72.20, 74.23, 76.55, and for ces, cytk, nhea, entfm and hbld, respectively. The inclusivity and exclusivity of the multiplex assay were evaluated using 71 bacterial strains including 17 emetic B. cereus reference strains, 9 enterotoxic B. cereus reference strains, 4 B. cereus group members, 23 wild B. cereus strains, 18 non-target strains, and was further tested on artificially inoculated foods. The DNA intercalating dye SYTO9 used in this study generated higher resolution melt curve peaks than SYBR Green dye for the target strains and genes in which the peaks were sharp and easily distinguishable from each other. The developed kits were validated by the same modified method based on the AOAC validation protocol in three independent laboratories from different cities. The validation results presented that the multiplex real-time kit was better than the multiplex PCR kit and the conventional culture method in sensitivity and specificity in pure cultures of B. cereus, artificially inoculated foods and naturally contaminated foods. Taken together, the developed multiplex PCR and multiplex real-time PCR kits can be the rapid and reliable tools for the simultaneous monitoring of both emetic and enterotoxic strains of B. cereus present in food and food-related samples. l To the best of our knowledge, this is the first time that an assay for simultaneous detection of B. cereus group, emetic and enterotoxic strains with such a wide range of detection target genes in food and environmental samples has been described

8 2. multiplex PCR detection kits for 5 pathotypes of pathogenic E. coli l Escherichia coli is the predominant facultative organism in the human gastrointestinal tract. Strains of pathogenic E. coli (PEC), which have acquired virulence factors, have the ability to cause foodborne and waterborne disease in human. Of the strains that cause diarrheal diseases, five pathotypes are recognized. But PEC strains display a heterogeneous range of phenotypic properties making it difficult to find a common agar to selectively and differentially recover these pathogens. Different molecular methods are used for identification of PEC, and these methods are based on genes related to the pathogenicity of each category. The prevent study was undertaken to establish a rapid PCR system for identification of the main five prevalent categories of PEC and a real-time PCR assay incorporating an internal amplification control (IAC). l To develop a PCR for PEC detection, we analyzed genetic information of virulence genes and established system of Conventional PCR and Real-time PCR which based genetic marker. And we developed and evaluated an IAC which could effectively eliminate false-negative results. Multiplex PCR kits, Real-time PCR kits and IAC kits for PEC were developed and validation testing was conducted using food samples spiked with PEC. l Therefore in this study, we developed Multiplex Conventional PCR and Real-time PCR for PEC detection. We established primer set and primer/probe set for the identification of PEC virulence genes (eaea, ipah, aggr, LT, STd, STp, stx1, stx2, bfp, lacy and 16s rrna) and developed IAC kit by using the Sequence of Viral Hemorrhagic Septicemia Virus enabling the distinction of true negative results from false negative results caused by PCR malfunction. The effectiveness of developed PCR kits were verified with detection of pathogenic E. coli, other foodborne pathogens and food samples artificial inoculation. Throughout this study it was successfully achieved the development of PCR kits for the rapid detection of pathogenic E. coli present in the sample. l The PCR kits for pathogenic E. coli can be used for rapid and an efficient detecting of PEC containing food samples. These kits are a useful tool to clarify the source and routes of Pathogenic E. coli

9 - 8 -

10 - 9 -

11 제 1 장연구개발과제의개요 1) 1) 농림수산식품기술기획평가원 본문작성요령 에따라본문의순서는장, 절, 1, 가, (1), ( 가 ), 1, 가등으로함

12 - 11 -

13 - 12 -

14 β 독소명칭유전자 / 단백질비고 용혈성독소 (HBL) 비용혈성장독소 (NHE) hblcda nheabc 독소는 1 개의오페론에있는 3 개의유전자에서코딩된 3 개의단백질로구성 세포독소 K (Cytotoxin K, CytK) CytK1,2 단일단백질

15 대장균은 Escherichia 속중대표적인균종으로장의정상적인생리기능을유지하는데주요한역할을하고있음. 그러나건강한분변의대장균과달리유유아의전염성설사증이나급성장염을일으키는특정혈청형의대장균이있어, 병원성대장균으로칭함. 사람이나동물의대장상주균과는달리외래성대장균으로식품및음용수에오염되어식중독을유발시킴. 병원성대장균의발생건수는국내식중독발생건수중최다를차지하므로, 식품내의대장균의검출및제어는가장시급한문제라할수있음 ( 표 1.2). 표 국내병원성대장균발생현황 ( 식품의약품안전청 )

16 - 15 -

17 - 16 -

18 표 1.3 병원성대장균의특성및혈청형 특 성 병원성대장균 ETEC EPEC EIEC EHEC 톡신 (toxin) 이열성및베로톡신베로톡신내열성톡신 - (Verocytotoxin) (Verocytotoxin) (LT/ST) 장관침입성 설 사 수양성 수양성및점액및혈액성혈액성 수양성 / 혈액성 용혈성요독증 열 주요감염장관 소장 소장 대장 대장 O6:H16, O8:H9 O20:H26 O26:H-, O28:H- O124:H30 O4:H- O26:H11 주요혈청형 O11:H27 O55:H6 O136:H- O91:H19 O20:H- O86:H27 O143:H- O111:H- O25:H42 29종이상 O111:H2 37종이상 O159:H- 12종이상 O157:H7 26종이상 감염량 많은량 많은량 적은량 적은량

19 1. 전통적배지법및생화학적테스트 1 차배양 2 차배양선택배지균동정 2. 면역항체법 1 일 1~2 일 1~2 일 1 차배양 2 차배양분석 18~24 시간 18~24 시간 10 분 ~2 시간 3. Real-time PCR 법 1.5~2 일 배양 DNA 추출 분석 1.5 시간 2 시간 7.5~11.5 시간

20 - 19 -

21 - 20 -

22 Company Kit Name Recognition 3M Microbiology Products Petrifilm E. coli Count Plate w AOAC Official Method w AFNOR w FDA-BAM 8th ed., Rev. A w Health Protection Branch- CANADA MFHPB-34 w NMKL w USDA-FSIS: Pathogen/HACCP Final Rule ColiComplete w AOAC Official Method BioControl Systems Inc. ColiTrak w AOAC Official Method ColiTrak + w AOAC Official Method SimPlate coliform/e. coli w EMMAS BioMerieux VIDAS E. coli O157 (ECO) Test w/ O157:H7 ID Agar w Performance Tested Method; Certificate no VIDAS Immunoconcentration System w Performance Tested Method; Certificate no Droege's Wholesale Food Service RapidChekTM for E.coli O157 (including H7) Lateral Flow Assay w Performance Tested Method; Certificate no Dynal Biotech Dynal Anti-E. coli O157 w AFNOR Cert. no. DYN 16/ FDA-BAM, DIN 10167, w Health Canada, w NMKL Official Method of Japan IGEN International PATHIGEN E. coli O157 Test w PerformanceTested Method; Certificate no Matrix MicroScience Ltd PATHATRIX E. coli O157 Test System w Performance Tested; Certificate no Molecular Circuitry Detex System MC-18 for E. coli O157 including H7 w Performance Tested Method; Certificate no Neogen Corporation ISO-Grid + SD39 Agar w AOAC Official Method Alert for E. coli O157 w AOAC Official Method Neogen Corp. REVEAL 8 for E. coli O157 w AOAC Official Method REVEAL for E. coli O157 w AOAC Official Method

23 - 22 -

24 1 지식재산권 : 특허출원 4 건, 등록 1 건 목표초과달성함 : 특허출원 9 건, 등록 4 건 2 기술이전 2 건 목표달성함 : 기술이전 2 건 3 제품화 2 건목표달성함 : 제품화 2 건 ( 시제품 5 건 ) 4 학술성과 : 논문 10 편 (SCI 5 편, 비 SCI 5 편 ) 목표초과달성함 : 논문 14 편 (SCI 10 편, 비 SCI 4 편 ) 5 기타 ( 당초목표에없음 ) 인력양성 3 건, 학술발표 6 건, 홍보전시 1 건

25 제 2 장국내외기술개발현황

26 - 25 -

27 제조회사 BioControl System (Belleveus, WA) Neogen (Lansing, MI) BioMerieus (Marcyl, Etoile, France) Tecra (France Forest, NSW, Australia) Igen (Gaithersburg, MD) Molecular Circuitry Organon Teknika (Boxtel, Netherlands) GeneTrack (Hopkinton, MA) DuPont Qualicon (Wilmington, DE) Bio-Rad TaKaRa 적용기술 Lateral-flow, ELISA Lateral-flow Fluorescent immunoassay Dipstick, ELISA Electrochemiluminescent immunoassay Electroimmonoassay ELISA ELISA PCR PCR, PCR-Hybridization PCR

28 그림 2.1 USDA 에서 O157:H7 의검출의사용되는크롬아가 (Rainbow agar) Target Product Method Company Escherichia coli GENE-TRAK Probe Neogen E. coli O157:H7 BAX PCR a Qualicon Probelia PCR BioControl a PCR, Polymerase Chain Reaction

29 - 28 -

30 - 29 -

31 최근 PCR 을이용한병원성대장균의검출방법이식품공전에정식으로등재되었음 ( 표 2.3) 표 2.3 식품공전에등재된 VT toxin 검출 method

32 - 31 -

33 제 3 장연구개발수행내용및결과 < 요약 > Ÿ 바실러스세레우스에서구토형및설사형독소유전자들, non-ribosomal peptide synthetase (NRPS/CER primers), cereulide (ces), haemolysin BL (hbldca), enterotoxin FM (entfm), non-haemolytic entrotoxin (nheabc), 및 cytotoxin K (cytk) 을목표대상으로하는제1 프라이머세트를개발함 ( 표 3.1). Ÿ 제1 프라이머세트의 multiplex PCR 조건을최적화함 : [95ºC 10min, (94ºC 1min, 54ºC 1min, 72ºC 1min) 35 cycles, 72ºC 5min] ( 표 3.3) Ÿ 제1 프라이머세트의민감도및특이도를구토및설사형표준균주들에서검증함. 비목표세균들에서 PCR 결과는음성으로나왔으므로이들프라이들의특이도는매우높은것으로증명됨. groel은모든바실러스세레우스균주들에서, CER(NRPS) 은구토형균주들에서만양성으로나타났으나, 설사형 / 장독소형유전자들은설사형및구토형균주들양쪽에혼재하였음. Ÿ 한국에서분리한야생형균주로서구토형 B. cereus 71균주와설사형 B. cereus 425균주등 496 균주들에대한 PCR 검출시험결과, B. cereus group 마커인 groel은모든균주들에서양성이였으며 (100%). 구토형독소관련유전자 (NRPS(CER) 및 ces) 는구토형균주들에서만발견되었으나, 설사형장독소유전자들인 hbld, nhea, entfm 및 cytk의검출율은각각 59.4%, 92.3%, 77.2% 및 47.5% 로써매우다양한유전자프로파일을나타냈음. Ÿ 바실러스세레우스순수배양액및인위접종한식품시료에서 multiplex PCR의검출한계를측정함. 순수배양액시료의 genomic DNA에대한 PCR 검출한계는 2 pg/reaction tube 이었으며, 인위접종한시료에서는약 10 3 cfu/g 시료이었음. Ÿ 농식품 ( 쌀과김밥 ) 및환경 ( 토양과소분변 ) 시료들 ( 각 36개총 144개 ) 에대한 PCR 기법의바실러스세레우스오염도검출율은전통적방법인배지배양법과비교하여유사하거나경우에따라약간낮은것으로나타남. 바실러스세레우스의검출빈도는쌀, 김밥, 토양및분변에서각각 63.8%, 38.9%, 84.6% 및 69.2% 였음. Ÿ 결론적으로제1 프라이머세트의동시검출 multiplex PCR은전통적배지배양법보다더나은검출율을보이지는않았으나, PCR 기법은신속성, 경제성, 효율성등많은장점을가지므로, 목표유전자및세균들에대한민감도및특이도등에서보다우수한 primer set의개발이필요함 ( 제2절의제2 및제3 프라이머세트개발 )

34 가. multiplex PCR primer 디자인 Target gene sequence Product length Design source AGCTATGATTCGTGAAGGT groel AAGTAATAACGCCGTCGT AGGCCCAGCTACATACAACG entfm CCACTGCAGTCAAAACCAGC CGCAACGACAAATCAATGAA hblc ATTGCTTCACGAGCTGCTTT GCGTACCAAATCACCCGTTC CER TGCAGGTGGCACACTTGTTA GGAGGGGCAAACAGAAGTGAA nhea CGAAGAGCTGCTTCTCTCGT TGCTAGTAGTGCTGTAACTC cytk CGTTGTTTCCAACCCAGT 236 AB AY AY AY DQ DQ

35 ºC ºC ºC ºC ºC No. Pre-denaturation Thermal cycles Final extension 1 94ºC 2min (94ºC 40sec, 52ºC 40sec, 72ºC 1min) 35 72ºC 5min 2 94ºC 2min (94ºC 40sec, 52ºC 1min, 72ºC 1min) 35 72ºC 5min 3 94ºC 2min (94ºC 40sec, 54ºC 40sec, 72ºC 1min) 35 72ºC 5min 4 94ºC 2min (94ºC 40sec, 54ºC 1min, 72ºC 1min) 35 72ºC 5min 5 95ºC 5min (94ºC 1min, 56ºC 1min, 72ºC 1min) 35 72ºC 5min 6 95ºC 10min (94ºC 30sec, 54ºC 1min, 72ºC 1min) 35 72ºC 5min 7 95ºC 10min (94ºC 30sec, 54ºC 1min, 72ºC 1min) 35 72ºC 5min 8 95ºC 10min (94ºC 1min, 54ºC 1min, 72ºC 1min) 35 72ºC 5min

36 Component Volume Tris-HCl MgCl 2 KCl 10 mm 1.5 mm 40 mm dntp mixture 250 µm Taq polymerase (Takara Taq TM, Otsu, Japan) cytk primers (forward/reverse) nhea primers (forward/reverse) CER primers (forward/reverse) hblc primers (forward/reverse) entfm primers (forward/reverse) groel primers (forward/reverse) DNA template 1 U 30 pm each 30 pm each 20 pm each 20 pm each 15 pm each 20 pm each ng Total volume 25 µl

37 Emetic reference strains Enterotoxic reference strains B. cereus group members Non-target bacteria B. cereus F4810/72 B. cereus ATCC13061 B. thuringiensis KCTC1508 Escherichia coli KCCM32396 B. cereus JNHE36 B. cereus ATCC12480 B. thuringiensis 824 B. cereus JNHE78 B. cereus KCTC1013 B. cereus KUGH164 B. cereus KCTC1014 B. cereus KNIHuls1 B. cereus KCTC1092 B. cereus KNIHuls3 B. cereus KCTC1094 B. cereus KNIHuls4 B. cereus KCTC1526 B. cereus KNIHuls5 B. mycoides KCTC 3453 B. weihenstephanensis KACC12001 B. pseudomycoides KACC12098 Escherichia coli O157:H7 ATCC Salmonella typhimurium ATCC14028 Listeria monocytogenes ATCC19119 Listeria monocytogenes ATCC19115 Staphylococcus aureus ATCC12500 Staphylococcus aureus ATCC27729 Clustridium perfringens KCTC5101 B. cereus KNIHuls7 B. subtilis KCCM11316 B. cereus KNIHuls8 B. subtilis KCTC3135 B. cereus KFDA250 Pseudomonas putida KCCM35479 Escherichia coli ATCC

38 - 37 -

39 Strain Type Multiplex PCR assay CER groel Cyt K entfm hblc nhea B. cereus ATCC13061 Enterotoxic B. cereus ATCC12480 Enterotoxic B. cereus KCTC1013 Enterotoxic B. cereus KCTC1014 Enterotoxic B. cereus KCTC1092 Enterotoxic B. cereus KCTC1094 Enterotoxic B. cereus KCTC1526 Enterotoxic B. cereus F4810/72 Emetic B. cereus JNHE36 Emetic B. cereus JNHE78 Emetic B. cereus KUGH164 Emetic B. cereus KNIHuls1 Emetic B. cereus KNIHuls3 Emetic B. cereus KNIHuls4 Emetic B. cereus KNIHuls5 Emetic B. cereus KNIH7uls7 Emetic B. cereus KNIHuls8 Emetic B. cereus KFDA250 Emetic

40 그림 3.1 바실러스세레우스표준균주에서구토및설사관련유전자들에대한 PCR의전기영동결과 (Gel electrophoresis results of 4 B. cereus reference strains detection by multiplex PCR approach in artificially inoculated food (kimbab). M, 100-bp DNA size marker; Lane1, B. cereus ATCC 13061; Lane 2, B. cereus KCTC 1014; Lane 3, B. cereus ATCC 12480; Lane 4, B. cereus F4810/72. 그림 3.2 Gel electrophoresis of multiplex PCR assay products for two B. cereus group members). Lane 1, B. weinhenstephanensis KACC 12001; Lane 2, B. pseudomycoides KACC 12098; Lane 3, 100-bp ladder

41 그림 3.3 Gel electrophoresis of multiplex PCR assay products for non-target strains. Lane 1, E. coli O157:H7 ATCC 43895; Lane 2, B. subtilis KCCM 11316; Lane 3, L. monocytogenes ATCC 19119; Lane 4, S. typhimurium ATCC 14028; Lane 5, S. aureus ATC C27729; Lane 6, E. coli KCCM 32396; Lane 7, 100 bp ladder. (Non-target 세균들에서는 PCR이수행되지않으므로 primers의특이도가우수함을나타냄.) 그림 3.4 Gel electrophoresis of 6 enterotoxic reference strains and 1 non-target strain. M, 100-bp ladder; Lane 1, B. cereus KCTC 1013; Lane 2, B. cereus KCTC 1014; Lane 3, B. cereus KCTC 1092; Lane 4, B. cereus ATCC 12480; Lane 5, B. cereus KCTC 1526; Lane 6, B. cereus KCTC 1508; Lane 7, Pseudomonas putida KCCM 35479; Lane 8, no template control (NTC). ( 목표세균들인장독소생성균주들 (lane #1~#6) 에서 PCR 밴드가나타나므로 primers의특이도가우수함을보여줌 )

42 - 41 -

43 그림 3.5 Toxic gene patterns and their prevalence among 496 wild B. cereus strains

44 - 43 -

45 - 44 -

46 Strain Type Concentration of DNA in PCR reaction tube 2 ng 200 pg 20 pg 2 pg 200 fg B. cereus ATCC13061 Enterotoxic B. cereus ATCC12480 Enterotoxic B. cereus KCTC1013 Enterotoxic B. cereus KCTC1094 Enterotoxic B. cereus F4810/72 Emetic : presence of amplified product/ -: absence of amplified product

47 - 46 -

48 Inoculated bacterial strain Food F4810/72 ATCC ml inoculum 1 ml inoculum 0.1 ml inoculum 1 ml inoculum Kimbab Milk Rice Baby cereal Sunflower oil Tteok Pasta

49 Toxin genes Kimbab Rice soil Feces (n = 12) (n = 23) (n = 11) (n = 9) cytk 4 (33.3%) 12 (52.2%) 6 (54.5%) 6 (66.7%) nhea 11 (91.7%) 20 (86.9%) 11 (100%) 8 (88.9%) hblc 7 (58.3%) 16 (69.6%) 7 (63.6%) 5 (55.6%) entfm 9 (75.0%) 18 (78.3%) 7 (63.6%) 5 (55.6%) CER ND 2 ( 8.7%) ND ND ND: not detected

50 - 49 -

51 제 2 절 B. cereus 구토 / 설사형동시검출 multiplex real-time PCR kit 개발 < 요약 > Ÿ Ÿ Ÿ 바실러스세레우스구토및설사형독소유전자동시검출용 multiplex conventional PCR kit 및 multiplex real-time PCR kit를개발하기위하여구토독소유전자 (ces) 및설사독소 / 장독소유전자들 (hbl, nhe, entfm, cytk) 을타깃으로하는제2 및제3 프라이머세트들을새로디자인하고, 각프라이머세트를사용하는 multiplex PCR 및 multiplex real-time PCR의반응조건및프라이머농도등을경험적으로최적화하였으며, 48개표준균주, 인위접종된시료, 식품및환경시료등에서 PCR kit의민감도, 특이도및검출한계를측정하였음. multiplex PCR 의 premix 는 AccuPower TM Multiplex PCR PreMix (SYBR Green), multiplex real-time PCR 의 premix 는 MeltDoctor TM HRM Master Mix (SYTO 9) 를주로사용하였음. Ÿ 제 2 프라이머세트의염기서열은표 3.14 에나열하였음. - entfm, nhea, hbld, cytk 및 ces 프라이머에대한 PCR 산물크기는각각 488, 376, 163, 106, 및 70 bp 이며, T m 값은각각 72.6, 75.5, 76.2, 77.9, 및 81.1 이고, 프라이머최적농도는각각 200, 200, 100, 200 및 100 nm 임. - multiplex PCR 의최적반응조건은 [95 C 10 분, (95 C 15 초, 56 C 30 초, 72 C 30 초 ) x 35 회반복, 72 C 3 분 ] 임. - PCR 검출한계는순수배양액의 DNA 시료에서약 2 pg/reaction tube 이였으며, 인위접종시료에서약 10 2 cfu/g 시료이었음. - 제 2 프라이머세트에대한 multiplex PCR 의 DNA 밴드및 singleplex real-time PCR 의분명한 melting peak 결과와달리, multiplex real-time PCR 의 melting peak 결과는서로명확하게구별되지않았음. Ÿ 제 3 프라이머세트의염기서열은표 3.22 에나열하였음. - entfm, nhea, hbld, cytk 및 ces 프라이머에대한 PCR 산물의크기는각각 255, 163, 127, 97 및 81 bp 이며, Tm 값은각각 78.4, 76.6, 81.9, 74.3 및 72.2 이고, 프라이머최적농도는각각 50, 100, 100, 150 및 50 nm 임. - PCR 의검출한계는순수배양액의 DNA 시료에서약 200 fg/tube 이었으며, 인위접종시료에서증균전약 10 2 cfu/g 이였으며, 7 시간증균후약 10 1 cfu/g 이였음. - real-time PCR 최적반응조건은 [95 C 10 분, (95 C 15 초, 58 C 1 분 ) x 35 회반복 ] 이며, melting curve 단계는 60 C 에서 95 C 까지매초마다 0.1 C 씩점진적증가반응임. - 제 3 프라이머세트에대한 multiplex PCR 의 DNA 밴드및 singleplex 및 multiplex real-time PCR 의 melting peak 결과는서로명확하게구별되었음 Ÿ 결론적으로, multiplex conventional PCR kit 의제작에는제 2 프라이머세트를, multiplex real-time PCR kit 의제작에는제 3 프라이머세트를사용하였음

52 - 51 -

53 Emetic reference strains Bacillus cereus F4810/72 Bacillus cereus JNHE 36 Bacillus cereus JNHE 80 Bacillus cereus KUGH27 Bacillus cereus JNHE 82 Bacillus cereus JNHE 88 Bacillus cereus KUGH 12 Bacillus cereus KNIH 20 Bacillus cereus JNHE 54 Bacillus cereus JNHE 13 Bacillus cereus JNHE 95 Bacillus cereus JNHE 23 Bacillus cereus JNHE 61 Bacillus cereus JNHE 60 Bacillus cereus JNHE 15 Bacillus cereus JNHE 7 Bacillus cereus KUGH 164 Enterotoxic reference strains Bacillus cereus ATCC Bacillus cereus ATCC Bacillus cereus KCTC 1013 Bacillus cereus KCTC 1014 Bacillus cereus KCTC 1092 Bacillus cereus KCTC 1094 Bacillus cereus KCTC 1526 Bacillus cereus ATCC Bacillus cereus ATCC B. cereus group Non-target strains Bacillus thuringiensis KCTC 1508 B. mycoides KCTC 3453 B. pseudomycoides KACC B. weihenstephanensis KACC Escherichia coli KCCM32396 Escherichia coli O157:H7 ATCC Salmonella enteritidis ATCC14028 Listeria monocytogenes ATCC Listeria monocytogenes ATCC19115 Streptococcus salivarius ATCC Staphylococcus aureus ATCC27729 Enterococcus faecalis ATCC B. subtilis KCCM3135 Escherichia coli B0499 Escherichia coli B0455 Pseudomonas putida KCCM35479 Escherichia coli ATCC3565 Micrococcus luteus KCCM11211 Streptococcus pyogenes KCCM Vibrio parahaemolyticus ATCC Campylobacter jejuni ATCC Yersinia enterocolitica ATCC

54 - 53 -

55 Target gene entfm nhea hbld cytk ces Sequence F: 5 GGAACTGGATACGTAAGC 3 R: 5 TAGTGAATGAATCCACTGC 3 F: 5 TGAAATTGTAAATGCTGCAG 3 R: 5 ATGTACTTCAACGTTTGTAACG 3 F: 5 GCATGGTCAATTGGTGGT 3 R: 5 CACCAGCTGCTGTTCCTA 3 F: 5 AAATGTTTAGCATTATCCGC 3 R: 5 TTTGCCCGATATCTGTTACAAC 3 F: 5 ATGAATCAACGATTATGCG 3 R: 5 GTCGGATTCGATACAATTTC 3 Product length 488 bp 376 bp 163 bp 106 bp 70 bp Design source AY789084; AY897207; EF453661; EF453653; EF Y19005; DQ019312; DQ885236; DQ153261; DQ U63928; AJ007794; AY820178; AY820179; AY822582; AY AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AY691650; DQ360825; DQ345790; JN222922; AY691650; DQ238109; DQ459072; JN112795; JN

56 Pre-denaturation Thermal cycles Final extension 95ºC 10min (95ºC 15sec, 48ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 50ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 52ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 54ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 56ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 58ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 60ºC 30sec, 72ºC 30sec) 35 72ºC 3min

57 μ

58 - 57 -

59 - 58 -

60 - 59 -

61 - 60 -

62 - 61 -

63 그림 3.6 구토및설사관련특정유전자 5 종류에대한 2nd set of primers 에대한 PCR 결과. Photograph of the specific products of the genes on agarose gel after electrophoresis (2nd set of primers). Lane1, cytk(106 bp); Lane 2, nhea (376 bp); Lane 3, hbld (163 bp); Lane 4, entfm (488 bp); Lane 5, 100-bp ladder, Lane 6, ces (70 bp)

64 그림 3.7 Multiplex PCR results of 8 B. cereus reference strains. Lane1, 100-bp ladder; Lane 2, F4810/72; Lane 3, ATCC12480; Lane 4, ATCC13061; Lane 5, KCTC1013; Lane 6, ATCC27348; Lane 7, KCTC1092; Lane 8, KCTC1094; Lane 9, KCTC1014; Lane 10, 100-bp ladder

65 Strain Type Concentration of DNA in PCR reaction tube 2 ng 200 pg 20 pg 2 pg 200 fg B. cereus ATCC13061 Enterotoxic B. cereus ATCC12480 Enterotoxic B. cereus KCTC1013 Enterotoxic B. cereus KCTC1094 Enterotoxic B. cereus F4810/72 Emetic

66 그림 3.8 Gel electrophoresis results of multiplex PCR using 2nd set of primers in 10-fold serial dilutions of artificially B. cereus F4810/72 inoculated food (rice). Lane 1 & 11: size marker; Lane 2, cfu/g; Lane 3, cfu/g, Lane 4, cfu/g; Lane 5, cfu/g; Lane 6, cfu/g; Lane 7, cfu/g (LOD); Lane 8, cfu/g; Lane 9, Non-target strain (B. subtilis KCCM3135); Lane 10, No template control (NTC)

67 - 66 -

68 - 67 -

69 - 68 -

70 - 69 -

71 Genes Melting temperatures (Tm) of different reference strains Mean cytk nhea entfm ces hbld Genes Melting temperatures (T m ) of different reference strains Mean cytk nhea entfm ces hbld

72 - 71 -

73 그림 3.9 Melting curves of different genes in singleplex real time PCR (2nd set of primers) using (A) StepOne PCR machine: cytk: Tm C, nhea: Tm C, entfm: Tm C, ces: Tm 72.57, hbld: Tm C; (B) Rotor Gene 6000 real time PCR machine: cytk: Tm C, nhea: Tm C, entfm: Tm C, ces: Tm 72.57, hbld: Tm C

74 그림 3.10 Amplification plot for cytk gene. Reference strains show their amplification in PCR analysis and that there is no amplification for non-target strains (2nd set of primers)

75 MgSO 4 μ Component Volume (μ Roche 2X master mix 12.5 ddh 2 O 3.5 Primer mix 1 (100 nm hbld/ces) 1 Primer mix 2 (200 nm nhea, cytk, entfm) 1 Q-solution (Qiagen) 2 MgSO 4 3 dntp 1 Template DNA 1 Total volume 25 μ

76 그림 3.11 Melting curve analysis of multiplex PCR real time assay. This analysis was detected using Roche master mix with the addition of extra components (2nd set of primers)

77 - 76 -

78 재디자인된 3rd set of primers-using multiplex real-time PCR 의최적화를위하여순수 배양액 (pure culture), 인위적오염식품 ( 아기시리얼, 김밥, 저온살균우유, 파스타, 쌀, 떡, 해바라기오일 ) 시료를통하여 3rd set of primers 의특이성및민감성을평가하였음

79 Target gene ces1 ces2 ces3 ces4 ces5 ces6 ces7 ces8 ces9 ces10 cytk1 cytk2 Sequence 5 AACATCACCACCAATGAGCA 3 5 AATCAATTGGCGGATCAAAA 3 5 TTGATTGGTGCACAATGGTC 3 5 TTGCTCATTGGTGGTGATGT 3 5 TGCACAATGGTCCATCACTT 3 5 TTGCTCATTGGTGGTGATGT 3 5 TGGAATGACCACCAAGTTCA 3 5 GGCTAAAATTTGGCGTGATG 3 5 CATTCTCACTCGGCAAACAC 3 5 TGAACTTGGTGGTCATTCCA 3 5 TCGCATTAATGGAATGACCA 3 5 TGGCTAAAATTTGGCGTGAT 3 5 ATCGCGGCTGATTTTATTTG 3 5 TTTCAAGAACCGCAATCAGA 3 5 ACAATCGCTTTTAGCCCAAG 3 5 ATTTTTGTCGGACTGGATGC 3 5 ATGCAACCATCAATGGCATA 3 5 TGACTTGGATCCACATCGAG 3 5 GGGAGCCAACAACAATGTCT 3 5 CATGCAAATGGTGTAACGATG 3 5 CGT TGT TTC CAA CCC AGT TT 3 5 TAT ACA AAA CAC GCC GAC GA 3 5 TTT CCA ACC CAG TTT GCA GT 3 5 TAT ACA AAA CAC GCC GAC GA 3 Product length Product Tm 69 bp C 71 bp C 63 bp C 80 bp C 73 bp C 90 bp C 84 bp C 83 bp C 86 bp C 97 bp C 76 bp C 71 bp C AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AY691650; DQ345790; AY691650; DQ459072; JN AJ277962; JN222929; JN222924; AJ318875; AJ AJ277962; JN222929; JN222924; AJ318875; AJ Design source DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ019311; JN222928; CP000001; AJ318877; DQ019311; JN222928; CP000001; AJ318877;

80 Target gene cytk3 cytk4 cytk5 cytk6 cytk7 cytk8 cytk9 nhea1 nhea2 nhea3 entfm1 entfm2 entfm3 entfm4 entfm5 Sequence 5 TTG CAG TTC CGA ATG TGA AG 3 5 TAT ACA AAA CAC GCC GAC GA 3 5 CAA CAG CGA TCA TAC CAG GA 3 5 ACC GAT GGA TCA ACT TCC AG 3 5 TAA AGA AAC GGG CGC TGT TA 3 5 CTG GCG CTA GTG CAA CAT TA 3 5 GCT TTA ACA GAA CCG CCA AG 3 5 CGC CCG TTT CTT TAA CGT AG 3 5 AAG CCT GGA CGA AGT TGG TA 3 5 TCC TGG TAT GAT CGC TGT TG 3 5 CGC TCG GAT CAT CGA TAA AA 3 5 TTC AAC ACC TGC TGC TTA CG 3 5 TAA AGA AAC GRG CGC TGT TA 3 5 CTG GYG CTA GTG CAA CAT TA 3 5 TGAAATTGTAAATGCTGCA 3 5 GCCTCTGMTTCAGTTTGTGA 3 5 TGAAATTGTAAATGCTGCA 3 5 ATTTGWGTCGCCTCTGMTTC 3 5 TGAAATTGTAAATGCTGCA 3 5 TGTAATTTGWGTCGCCTCTG 3 5 GGAACTGGATACGTAAGC 3 5 GCTGGGCCTGTACGTACTTT 3 5 GGAACTGGATACGTAAGC 3 5 TTGTAGTTGGTTGTTGTGTTTSG 3 5 GGAACTGGATACGTAAGC 3 5 CCRTTTGTTACKCCACCGATT 3 5 GGAACTGGATACGTAAGC 3 5 CAACCATTTTCAGCRCCAGT 3 5 GGAACTGGATACGTAAGC 3 5 CGGCCGTTATGGTTAATTT 3 Product length Product Tm 58 bp 77.2 C 62 bp 72.9 C 81 bp C 93 bp C 105 bp C 155 bp C 81 bp 74.4 C 114 bp C 123 bp C 127 bp C 158 bp C 79 bp C 194 bp C 230 bp C 255 bp C Design source AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ Y19005; DQ019312; DQ885236; DQ153261; DQ Y19005; DQ019312; DQ885236; DQ153261; DQ Y19005; DQ019312; DQ885236; DQ153261; DQ AY789084; AY897207; EF453661; EF453653; EF AY789084; AY897207; EF453661; EF453653; EF AY789084; AY897207; EF453661; EF453653; EF AY789084; AY897207; EF453661; EF453653; EF AY789084; AY897207; EF453661; EF453653; EF

81 Target gene Sequence Product length Design sources: Genebank identification no. entfm5 5 GGA ACT GGA TAC GTA AGC 3 5 CGG CCG TTA TGG TTA ATT T bp AY789084; AY897207; EF453661; EF453653; EF hbld 5 GCA TGG TCA ATT GGT GGT 3 5 CAC CAG CTG CTG TTC CTA bp U63928; AJ007794; AY820178; AY820179; AY822582; AY nhea3 5 TGA AAT TGT AAA TGC TGC A 3 5 TGT AAT TTG WGT CGC CTC TG bp Y19005; DQ019312; DQ885236; DQ153261; DQ ces10 5 GGG AGC CAA CAA CAA TGT CT 3 5 CAT GCA AAT GGT GTA ACG ATG 3 97 bp AY691650; DQ360825; DQ345790; JN222922; AY691650; DQ238109; DQ459072; JN112795; JN cytk9 5 TAA AGA AAC GRG CGC TGT TA 3 5 CTG GYG CTA GTG CAA CAT TA 3 81 bp AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ

82 반응온도반응시간 Cycle 수 95 C 10 min 1 cycle 95 C 15 sec 58 C 1 min 35 cycles Final step (melting curve step) from 60 C to 95 C, with gradual temperature increments of 0.1 C/s

83 그림 3.12 Singleplex melt curve of primers of 3rd set of primers. cytk: Tm 74.4 C, nhea: Tm C, entfm: Tm C, ces: Tm 72.37, hbld: Tm C

84 Genes Melting temperatures (Tm) of different reference strains ( ) Mean T M ( ) ces cytk nhea entfm hbld

85 Primer name Optimum concentrations (nm) ces10 50 cytk9 150 nhea3 100 entfm5 50 hbld 100 그림 3.13 Optimization of primers concentrations in multiplex real-time PCR melt curve analysis (3rd set of primers). A: a sample of optimization process before finding the optimum primer mixture concentration in B. cereus ATCC B: final optimized primer concentrations in B. cereus ATCC enterotoxic reference strain

86 그림 3.14 Ability of all 5 primers to work in multiplex using equal amounts of B. cereus ATCC and F4810/

87 그림 3.15 Final evaluation of the multiplex real-time PCR High Resolution Melting Curve Analysis on two reference strains

88 개발된 3rd set of primers-using multiplex real-time PCR 의효율검증을위하여순수배 양액에서의검출한계분석과실제식품및환경시료에서의오염도분석을수행하여 PCR kit 의우수함을검증하였음 Strain B. cereus ATCC13061 B. cereus ATCC12480 B. cereus KCTC1013 B. cereus KCTC1094 B. cereus F4810/72 Type Concentration of DNA in PCR reaction tube 2 ng 200 pg 20 pg 2 pg 200 fg 20 fg Enterotoxic Enterotoxic Enterotoxic Enterotoxic Emetic

89 그림 3.16 Limit of detection in artificially inoculated milk (A) and rice (B). The figure shows amplification plot of the HRM multiplex real-time PCR approach (3rd set of primers) for B. cereus F4810/72 from to cfu/ml in milk and to cfu/g of B. cereus ATCC in rice

90 - 89 -

91 w w w

92 요약 1. 구토및설사형바실러스세레우스멀티플렉스피씨알동시검출키트들 (Emetic & Enterotoxic Bacillus cereus multiplex detection kit 및 multiplex real-time PCR detection kit) 의시제품을개발하였음. w 각 PCR 키트구성성분들의농도및용량을대량생산을위하여계산하고오차율을고려한값을결정하고사용자편의를고려한동결건조형키트를제작하였음. w multiplex PCR kit는다음의 3가지구성요소로이루어졌음 : (1) 0.2 ml 8-stripe PCR tubes ( 동결건조된 PCR master mix가들어있음 ), (2) primer mix tube ('P' 로표시함, 제 2 프라이머세트혼합액 ), (3) positive control tube ('C' 로표시함, B. cereus ATCC 12480( 설사형 ) 와 F4810/72( 구토형 ) 유전체혼합액 ). w multiplex real-time PCR kit는다음의 3가지구성요소로이루어졌음 : (1) real-time PCR premix tube ('2XM' 으로표시함, MeltDoctor TM HRM master mix), (2) primer mix tube ('P' 로표시함, 제3 프라이머세트혼합액 ), (3) positive control tube ('C' 로표시함, B. cereus ATCC 12480( 설사형 ) 와 F4810/72( 구토형 ) 유전체혼합액 ). 2. 개발된 PCR kit의성능을 AOAC protocol 에따라검증하고평가함 w PCR kits의실험법및 AOAC 검증을위한사용자편의프로토콜 을개발함 w AOAC 검증방법으로인위접종시료, 그리고실제식품및환경시료등을대상으로두 PCR kits와표준배지배양법을비교시험한검출결과는세가지방법중 multiplex real-time PCR kit가가장우수함을나타냄. w AOAC 검증방법에따라 3개의독립된실험실에서각각두 PCR kits의검증을수행하여개발된 PCR kits의우수한성능을검증하였음. 3. 개발된 PCR kits는다음과같은장점이있음 : (1) 신속함 : 시험소요시간이짧음 (1~3 시간 ( 증균전 ) 또는 1일이내 ( 증균후 ), (2) 높은민감도 : 식품그램당약 10 3 CFU/g ( 증균전 ), 10 1 CFU/g ( 증균후 ), (3) 높은특이도 : 전통적배지법과비교하여위양성및위음성을최소화할수있음, (4) 명확성 : 균동정을위한추가확인시험이필요없음, (5) 경제성 : 추가시험이불필요하고, 할일이적으므로더경제적임, (6) 독성유전자프로파일작성 : B. cereus 검출뿐만아니라독성유전자프로파일을작성하여의학적, 전염병학적, 및환경적연구에적용가능, (7) 기록과문서화용이함 : 전통적배지방법보다 PCR 방법에서얻어진결과들은더쉽게문서화할수있고향후분석을위하여장기간보관할수있음

93 - 92 -

94 - 93 -

95 그림 3.17 개발된각 PCR kits 시제품의외형 (Outer view of multiplex PCR and multiplex real-time PCR kits produced by Kogenebiotech.)

96 w w w 그림 3.18 개발된 multiplex PCR detection kit 시제품키트의모든내용물 (All components of the multiplex PCR detection kit produced by Kogenebiotech.)

97 w w w 그림 3.19 개발된 multiplex real-time PCR detection kit 시제품키트의내용물 (All components of the multiplex real-time PCR detection kit)

98 - 97 -

99 그림 3.21 multiplex PCR detection kit 에대한사용자편의차트식실험법 (User friendly Protocol for the multiplex PCR detection kit using an easy to understand flowchart.)

100 그림 3.22 multiplex real-time PCR detection kit 에대한사용자편의차트식실험법 (User friendly Protocol for multiplex real-time PCR detection kit using an easy to understand flowchart.)

101 그림 3.23 키트검증을위해사용한 3 종류의식품시료들사진. (The 3 food types used in the study for the AOAC validation of the multiplex PCR and multiplex real-time PCR detection kits.)

102

103 그림 3.24 개발된키트들에대한 AOAC 에기초한검증을위한사용자편의프로토콜의요약 (Brief, user friendly protocol for the AOAC based validation of multiplex PCR and multiplex real-time PCR kits.)

104 AOAC 검증을위한 사용자편의프로토콜 1. 먼저, 각식품품목 ( 예, 밥, 우유또는파스타 ) 당 24 개시료 (lots) 를준비한다. 2. 각식품시료 24 개중각두개씩음성및양성대조군으로준비한다. 음성대조군은세 균을접종하지않은것이며, 양성대조군은세균의순수배양액을직접사용한다 개시료들중 10 개씩두가지레벨로해당세균에의해인위접종한다. 두가지세 트의접종균수표시는다음과같다 : high level inoculum 및 low level inoculum. 4. 각세트의시료는각세균을무작위로접종한후, 접종한세균과음식물을잘섞어준 다. 5. 멸균 stomacher bags 에시료밥또는파스타 400 그램또는우유 400 밀리리터를 25 g 또는 25 ml 씩각각나눈후, 균질화하기위하여 stomacher 에서 2 분간혼합한다. 6. 그후, 이들시료를 DNA 추출또는 MYP 선택배지배양법등의실험에사용한다. 7. 각키트의프로토콜에따라 multiplex PCR kit, multiplex real-time PCR kit 를통해얻 은결과들그리고 conventional culture method 로부터얻은결과들을 AOAC formulas 에따라분석을수행하여서로의결과를비교분석한다

105

106 그림 3.25 식품시료에서 DNA 추출법을위한사용자편의프로토콜의요약 (Brief, user friendly protocol for the DNA extraction from food samples using Mo Bio Powerfood Microbial DNA Isolation Kit.)

107

108

109 w w w 실험재료및방법에서설명한 AOAC protocol에따라본연구에서개발된 multiplex conventional PCR kit 및 multiplex real-time PCR kit의검증시험을수행하였음. 3개의독립된실험실들에서독립적으로검증시험을수행한결과, 개발된 multiplex real-time PCR 키트의성능이제일우수한것을검증됨. 두 PCR kits에서얻은결과를 conventional culture method에서얻은결과와비교분석하여새로개발된 PCR 방법들의상업적스케일의제품키트들의효율을검증하였음

110

111

112 Sample Inoculated samples (1~10) Negative control Positive control Rice Low Rice High MYP PCR rtpcr MYP PCR rtpcr Pasta Low Pasta High MYP PCR rtpcr MYP PCR rtpcr Milk Low Milk High MYP PCR rtpcr MYP PCR rtpcr

113 그림 3.26 B. cereus F4810/72에대한식품시료 ( 밥 ) 에서의 AOAC 검증결과. AOAC validation results for rice inoculated with B. cereus F4810/72. A) amplification plot for positive control, negative controls and inoculated samples (high inoculum, F4810/72 reference strain) using the multiplex real-time PCR HRM detection kit; B) MYP agar results for low level inoculum (3 positives); C) multiplex PCR detection kit results: Lane 1: ladder, Lane 2-11: high level inoculated samples, Lane 12: positive control, Lane 13: negative control, Lane A-J low level inoculated samples in laboratory number 1 (Kangwon National University)

114 그림 3.27 B. cereus ATCC 12480에대한식품시료 ( 파스타 ) 에서의 AOAC 검증결과. AOAC validation results for pasta inoculated with B. cereus ATCC in laboratory number 1 (Kangwon National University). A) results of MYP agar conventional method in high (9 positives) and low (6 positives) level inoculum; B) multiplex PCR detection kit results: Lane 1-10: inoculated samples; Lane 11: positive control; Lane 12: ladder; C) multiplex real-time PCR detection kit results in StepOneTM machine

115 Food sample Pasta (ATCC 12480) Rice (F4810/72) Milk (KCTC 1013) positives negatives positives negatives positives negatives MYP 6 b 4 3 a 7 2 a 8 Low inoculum PCR 4 a 6 8 b 2 5 b 5 rtpcr 7 b 3 7 b 3 5 b 5 MYP 9 a 1 10 a 0 10 a 0 High inoculum PCR 8 a 2 10 a 0 10 a 0 rtpcr 8 a 2 10 a 0 10 a 0 *Numbers labeled with different letters for each inoculation level of every individual food represent a significant difference

116

117 Food sample Pasta (ATCC 12480) Rice (F4810/72) Milk (KCTC 1013) positives negatives positives negatives positives negatives MYP 8 a 2 10 b 0 10 a 0 Low inoculum PCR 10 b 0 6 a 4 10 a 0 rtpcr 9 ab 1 10 b 0 10 a 0 MYP 10 a 0 10 a 0 10 a 0 High inoculum PCR 10 a 0 10 a 0 10 a 0 rtpcr 10 a 0 10 a 0 10 a 0 * 모든식품의각접종레벨에서세가지검출방법에대한수치들에다른알파벳으로표시되면이수치는 서로통계적으로유효한차이를나타냄. (Numbers labeled with different letters for each inoculation level of every individual food represent a significant difference.)

118 그림 3.28 제2실험실에서수행된 multiplex PCR detection kit에대한 AOAC 검증실험결과들. multiplex PCR detection kit AOAC validation results for pasta inoculated with B. cereus ATCC in low and high inoculum levels in laboratory number 2 (Agricultural Research Center)

119 그림 3.29 제 2 실험실에수행된 AOAC 검증실험결과들. (AOAC validation results for pasta inoculated with B. cereus ATCC in low inoculum level using multiplex real-time PCR kit in laboratory number 2.)

120

121 Food sample Pasta (ATCC 12480) Rice (F4810/72) Milk (KCTC 1013) positives negatives positives negatives positives negatives MYP 10 a 0 10 a 0 10 a 0 Low inoculum PCR 10 a 0 10 a 0 10 a 0 rtpcr 10 a 0 10 a 0 10 a 0 MYP 10 a 0 10 a 0 10 a 0 High inoculum PCR 10 a 0 10 a 0 10 a 0 rtpcr 10 a 0 10 a 0 10 a 0 * 모든식품의각접종레벨에서세가지검출방법에대한수치들에다른알파벳으로표시되면이수치는 서로통계적으로유효한차이를나타냄. (Numbers labeled with different letters for each inoculation level of every individual food represent a significant difference.)

122 그림 3.30 제 3 실험실에서수행된 multiplex PCR detection kit 에대한 AOAC 검증실험결 과들. AOAC validation results for pasta inoculated with B. cereus ATCC in laboratory number 3 at high and low level inoculum (Konkuk University)

123 그림 3.31 제 3 실험실에수행된 AOAC 검증실험결과들. AOAC validation results for pasta inoculated with B. cereus ATCC in low inoculum level using multiplex real-time PCR kit in laboratory number 3 (Konkuk University)

124

125

126

127 Kimbab Without enrichment Total MYP /15 PCR /15 real-time PCR /15 With enrichment Total MYP /15 PCR /15 real-time PCR /15 pork Meat Without enrichment Total MYP /15 PCR /15 real-time PCR /15 With enrichment Total MYP /15 PCR /15 real-time PCR /15 Tofu Without enrichment Total MYP /15 PCR /15 real-time PCR /15 With enrichment Total MYP /15 PCR /15 real-time PCR /15 Spinach Without enrichment Total MYP /15 PCR /15 real-time PCR /

128 With enrichment Total MYP /15 PCR /15 real-time PCR /15 Lettuce Without enrichment Total MYP /15 PCR /15 real-time PCR /15 With enrichment Total MYP /15 PCR /15 real-time PCR /15 Rice Without enrichment Total MYP /15 PCR /15 real-time PCR /15 With enrichment Total MYP /15 PCR /15 real-time PCR /15 Tomato Without enrichment Total MYP /15 PCR /15 real-time PCR /15 With enrichment Total MYP /15 PCR /15 real-time PCR /

129 그림 3.32 상추에서전통적배지법, multiplex PCR kit 및 multiplex real-time PCR kit 에의 한결과들 (Results of real-time PCR kit, mpcr kit and conventional MYP agar method on lettuce.)

130 그림 가지식품시료에서자연적오염도에대한증균전및증균후세가지다른검출방법의시험결과들. Detection rates in naturally contaminated foods for all food samples using the three different methods, with and without enrichment. ( 증균전및증균후 real-time PCR 결과들 ( 흑색 ) 이전통배지배양법 ( 녹색 ) 이나 multiplex PCR법 ( 적색 ) 보다가장민감한것으로나타남에주목하라.)

131

132 < 요약 > 5종병원성대장균검출을위한 PCR system의제작을위하여다양한병원성대장균특이유전자마커및 Primer set을 Database 화하여각각의성능을평가하였음 Primer 후보군중병원성대장균의검출의성능을평가하기위하여 BLAST 및 in silico PCR amplification 을통하여일부를 Rule-Out 하였고, 본실험실에서보유하고있는병원성대장균균주를대상으로 Primer 의성능을평가하기위하여민감도및특이도를검증하였음

133

134 Web of science Pubmed

135

136 4.3. Primer-blast primer 4.4 Schematic diagram for Conventional PCR primer screening

137 4.5 Schematic diagram for Real-time PCR primer screening

138 그림 4.6 in silico Simulation 홈페이지

139 그림 4.7 정부기관으로의각병원성대장균균주분양신청 ( 질병관리본부 ) 표 4.2 병원성대장균보유현황 질병관리본부 서울시보건환경연구원 합계 EPEC EHEC EAEC EIEC ETEC Total

140

141 그림 4.8 Enterobacteriaceae 의 DNA 및 rrna 상동성 (Spence et al., 1994)

142

143

144 EAEC EIEC EPEC ETEC 그림 4.9 기보유한병원성대장균들의각 target gene 에대한 Conventional PCR 검증 ( 일부 )

145

146

147

148

149

150

151

152

153

154

155

156

157 < 요약 > 1. 대장균검출을위한 Primer 디자인 기존 E. coli species 의검출에사용되는유전자는 uid A, 16s rrna 가사용되었으나한계점이존재하였음. 따라서대장균 species 검출을위한새로운 Primer의개발이필요함. Lactose permease 를코딩하는 Lac Y gene을대상으로 Primer 를개발하였으며개발된 Primer 는병원성대장균및기타식중독균을대상으로민감도및특이도를평가하였음. 총 63개의대장균에서양성, 50개의기타식중독균을대상으로음성결과를나타내었으며따라서대장균 species 검출을위한 lac Y primer 개발이완료되었음 종병원성검출을위한 Conventional PCR 개발 Primer 후보군의각유형별병원성대장균및비병원성대장균, 대장균이외의식중독균에대한민감도및특이도평가를실시하였음. PCR을이용한병원성대장균의용이한검출방법을위하여 Flowchart 를제작하였고이를통해대장균의병원성유무를쉽게판정할수있음. 또한개발된 PCR Primer 후보군의각유형별병원성대장균및비병원성대장균, 대장균이외의식중독균에대한민감도및특이도평가를실시하였음. 최종적으로선정된 Conventional PCR 세트의검출한계를평가함. 순수배양액에서검출한계는 4log cfu/ml 이며식품의인위접종후 24시간배양후에는검출한계가 1log cfu/g(ml) 이다. 이는대장균의특성상외부균의영향을적게받고빠르게증균하기때문인것으로보임. 결론적으로개발된 Conventional PCR 세트는시료에서병원성대장균을검출하기에유용한것으로평가됨

158

159 β

160

161

162

163

164

165

166

167

168

169 그림 5.4 Multiplex Conventional PCR 을이용한병원성대장균검출모식도

170

171

172

173 그림 종병원성대장균검출을위한 Multiplex Conventional PCR 결과 Lane M : 100 bp DNA ladder, 1 : EAEC, 2 : EIEC, 3 : EPEC or EHEC, 4 : EPEC+EAEC+EIEC, 5 : ETEC(LT), 6 : ETEC(STh, STp), 7 : ETEC(LT, STh, STp) 8 : EHEC(stx1), 9 : EHEC(stx2), 10 : EHEC(stx1, stx2), 11: EPEC(bfp), 12 : EHEC + EPEC, 13 : Escherichia coli ATCC 25922, 14 : Shigella flexneri ATCC Pre-denaturation step X 35 Denaturation Annealing Extension Final extension 95 /5min 95 /30s 60 /30s 72 /1min 72 /5min

174

175

176

177

178

179

180

181

182 < 요약 > 1. Internal Amplification Control(IAC) 개발 식품, 임상및환경시료에서 DNA를추출후 PCR을실시하였을시시료내존재하는 PCR inhibitor 로위음성결과를나타낼수있음. IAC는 PCR의위음성결과를배제하여정확한결과를얻을수있게함. 본연구팀은 Viral hemorrhagic septicemia virus(vhsv) 의 DNA sequence 를이용하였으며 VHSV는사람및식품시료에서검출된적이없어적합함. IAC는 10 4 copies/ul 의 Template 농도, 75nM Primer 농도및 250nM Probe 농도가최종적으로결정됨. 개발된 IAC의 Sequence는 Cloning을통하여 IAC 생산및활용이용이하도록하였음 종병원성검출을위한 Real-time PCR 개발 Primer 및 Probe 후보군의각유형별병원성대장균및비병원성대장균, 대장균이외의식중독균에대한민감도및특이도평가를실시하였음. 최종적으로선정된 Real-time PCR 검출을위한 Primer/probe 는 IAC와동시에사용되면서검출한계를평가함. 순수배양액에서검출한계는 4log cfu/ml 이며식품의인위접종후 24시간배양후에는검출한계가 1log cfu/g(ml) 이다. 이는대장균의특성상외부균의영향을적게받고빠르게증균하기때문인것으로보임. 결론적으로개발된 IAC와 Real-time PCR 세트는시료에서병원성대장균을검출하기에유용한것으로평가됨

183 PCR inhibitor Bile salts complex polysaccharides collagen heme Humic acid Melanin and eumelanin myoglobin polysaccharides proteinases calcium ions urea Hemoglobin, lactoferrin immunoglobin G indigo dye Source of inhibitor feces feces, plant material tissues blood soil, plant material hair, skin muscle tissue plants milk milk, bone urine blood blood denim

184

185

186 그림 6.1 pcr-topo vector 의구조 그림 6.2 IAC 의 cloning 과정

187 μ μ

188

189

190 그림 6.3 X-gal 을도포한 LB agar. Sequence 의 Vector 삽입유무확인 *Blue colony : Vector 내로 Sequence 정상적으로삽입안됨 *White colony : Vector 내로 Sequence 정상적으로삽입

191 그림 6.4 M13 Primer 를이용한 Vector 의 PCR 반응 그림 6.5 Bioedit 을이용하여 Target Sequence 의 Vector 내정상적인삽입확인

192 그림 6.6 Standard curve of internal amplification control

193

194

195

196

197

198

199 Pathotyp e Target gene Primer & probe Sequence(5-3 ) Conc (pmole) Reference EPEC eaea Forward CAT TGA TCA GGA TTT TTC TGG TG ATA Reverse CTC ATG CGG AAA TAG CCG TTA probe FAM-ATA GTC TCG CCA GTA TTC GCC ACC AAT ACC-TAMRA 0.25 Nielsen et al., 2003 Forward CCT TTT CCG CGT TCC TTG EIEC ipah Reverse CGG AAT CCG GAG GTA TTG C probe FAM-CGC CTT TCC GAT ACC GTC TCT GCA-TAMRA 0.25 Thiem et al., 2004 Forward GCC TAA AGG ATG CCC TGA TG 0.5 EAEC aggr Reverse GAC CAA TTC GGA CAA CTG CAA 0.5 probe FAM-CAT CTA CTT TTG ATA TTC CGT AT-TAMRA 0.25 Delannoy et al 2012 Forward GTG GCA TTA ATA CTG AAT TGT CAT CA stx1 Reverse GCG TAA TCC CAC GGA CTC TTC EHEC probe FAM-TGA TGA GTT TCC TTC TAT GTG TCC GGC AGA T-TAMRA 0.25 Forward GAT GTT TAT GGC GGT TTT ATT TGC Jinneman et al.,2012 stx2 Reverse TGG AAA ACT CAA TTT TAC CTT TAG CA probe FAM-TCT GTT AAT GCA ATG GCG GCG GAT T-TAMRA

200 Pathotype Target gene Primer & probe Sequence(5-3 ) Conc (p/mole) Reference Forward TTC CCA CCG GAT CAC CAA LT Reverse CAA CCT TGT GGT GCA TGA TGA Hidaka et al.,2009 probe FAM-CTT GGA GAG AAG AAC CCT-TAMRA 0.25 Forward GAA CAA CAC ATT TTA CTG CTG TGA ACT ETEC STp Reverse GCA CCA ATA CAT ATA ATA TAG AGG GAA TCA lijima al 2007 et probe FAM-TGT TGT AAT CCT GCC TGT GCT CCA TGT TAT T-TAMRA 0.25 STh Forward Reverse probe CTG GTT TTG ATT CAA ATG TTC GTG TCC TGA GGG AAA GGT GAA AAA GAC FAM-TTG ATT TCT TCA TAT TAC CTC CGG ACA TGG CA-TAMRA Hardegen et al., 2010 Forward ACC AGA CCC AGC ACC AGA TAA G lac Y Reverse CTG CTT CTT TAA GCA ACT GGC GA P a v l o v i c et al 2011 probe CY5-CAT ACA TAT TGC CCG CCA GTA CAG AC-BHQ E. coli Forward CAT GCC GCG TGT ATG AAG AA s rrna Reverse CGG GTA ACG TCA ATG AGC AAA Huijsdens et al., probe FAM-TAT TAA CTT TAC TCC CTT CCT CCC CGC TGA A-TAMRA

201

202

203

204

205

206

207

208

209

210

211 < 요약 > 개발된키트의장기보관을위해서는동결건조가실시되어야함. 키트는 20 의냉동고에서 4시간예비동결후 70 Ultra-Low freezers에서 8시간동결시켰으며동결된시약을동결건조기에서영하 56 C 온도와 5 mtorr 압력조건하에 3 시간동결건조하였음. 동결건조는시에는다양한동결건조보호제가사용되므로이들에대하여 D.W 만사용한대조군과평가를실시하였으며최종적으로 5% Trehalose 가동결건조전후 PCR 키트에서영향을가장적게미치는것으로나타나최종적으로 5% Trehalose 가첨가되어동결건조를실시함

212

213 그림 7.1 동결건조 PCR kit 의제작과정 (a), PCR kit 의준비및 label; (b), -20 에서 4 시간,-70 에서 8 시간예비동결 ; (c), 동결건조 ; (d), 동결건조된 PCR kit

214

215

216 < 요약 > 개발된키트성능의검증을위하여동일한조건하에평가및검증을실시하여야함. PCR 키트의실험법및검증을위한사용자편의프로토콜을개발하였으며검증방법으로인위접종시료및접종균을준비하고 PCR kit와배지배양법을비교, 시험하였음. 독립된 2개의실험실에서각각개발된 PCR 키트의검증을수행하여개발된 PCR 키트의우수한성능을검증하였음

217

218

219

220

221 그림 8.3 개발된키트들의 AOAC 에기초한검증을위한사용자편의프로토콜의요약

222 < 사용자편의프로토콜 > - 실험실에서는각시료 ( 예, 우유및다진쇠고기 ) 당 12개의샘플이준비된다. - 각시료의두개는음성대조군과양성대조군에사용될시료이다. - 나머지시료 10 개는인위접종을수행한다. - 2 세트의접종이수행된다 : high level inoculum (10-20 cfu/10g) 그리고 low level inoculum (1-2 cfu/10g) (Hidaka et al., 2009 ; Toshima et al., 2004) - 50g(ml) 시료는무작위로선택되어접종후균과음식물을잘섞이게흔들어준다. - 50g(ml) 의시료를 10 g(ml) 로필터백에각각나눈다. - 시료가들어있는필터백에 90ml의 Brain Heart Infusion broth를첨가하고이들시료를균질화하기위하여멸균 stomacher bags에서 1분간 homogenization 한다. - 3시간동안 37 에서배양후이들시료에 90ml의 Double Strength Tryptone Phosphate broth를첨가하고잘흔들어준뒤 20시간동안 42 에서증균배양한다. - 배양한시료중일부는멸균 loop를이용하여 EMB 배지에 streaking 하고일부는 Intron 사의 G-spin Genomic DNA Extraction Kit (for Bacteria) 를사용하여 DNA 를 추출한다. - EMB agar 배지는 B. cereus를위한 standard selective medium이다 - 추출된 DNA는 PCR 및 real-time PCR 실험에사용하고 EMB 배지에서얻어지는대장균의심집락은 Colony 를증균배양후 DNA를추출하여 PCR로확정한다. - Culture method 및 PCR/ Real-time PCR 서로의결과를비교분석한다. - 접종및비접종음식시료에서의 DNA 추출은 G-Spin Genomic DNA extraction Kit [For Bacteria] (Intron Bio) 를사용하여준비한다. - 그림 8.4는 G-spin Genomic DNA Extraction Kit의추출프로토콜을요약하여보여준다. - 이프로토콜은실험수행자들의이해를돕고 DNA 추출과정을동일하게하기위하여준비되었다

223 그림 8.4 음식시료에서 DNA 추출을위한사용자편의프로토콜의요약

224

225

226

227

228

229

230

231

232

233 제 4 장목표달성도및관련분야에의기여도

234

235 제 5 장연구개발성과및성과활용계획 가. 연구개발결과의성과및활용목표대비실적 (1) 연구성과목표 ( 단위 : 건수 ) 구분 출원 특허 등록 품종명칭등록 신품종 품종생산수입판매신고 품종보호 출원 등록 ( 예시 ) 유전자원등록 SCI 논문 비 SCI 기타 ( 학회발표 ) 1차년도 2차년도 3차년도 4차년도 5차년도 목표 달성 목표 달성 목표 달성 목표 달성 (2) 목표 달성 목표 계달성 * 연차별연구성과목표는향후연차평가등의정량적평가지표로활용됨 ** 연구성과는연구계획에따라도출된것으로예시와같이작성 (2) 연구성과활용목표 구분기술실시 ( 이전 ) 상품화정책자료교육지도언론홍보 ( 단위 : 건수 ) 기타 ( 홍보전시 ) 활용건수 목표 2 2 달성 * * 행사명칭 : 2013 제 11 회인터비즈바이오파트너링 & 투자포럼, 행사장소 : 제주도휘닉스아일 랜드, 행사일 : , 행사유형 : 제품설명회, 참여품목 : 구토, 설사독소생성바실러스세 레우스동시신속검출용멀티플랙스중합효소연쇄반응프라이머세트

236 나. 논문게재성과 게재 연도 논문명 Improvement of modified charcoal-cefoperazone-deoxycholat e agar by addition of potassium clavulanate for detecting Camylobacter spp. in chicken carcass rinse Prevalence, characterization, and antimicrobial susceptibility of Salmonella Gallinarum isolated from eggs produced in Conventional or organic farms in South Korea 생리활성 펩타이드를함유하는치 즈유청단백질가수분해물로부터기 능성건강음료개발에관한연구 : 총설 발효낙농유제품인 Kefir 다양한기 능및특성 : 총설 Comparison of 3 Selective Media for Enumeration of Bacillus cereus in Several Food Matrixes Improved multiplex PCR detection of Bacillus cereus group and its toxic strains in food and environmental samples Enterotoxigenic profiling of emetic toxin- and enterotoxin-producing Bacillus cereus, Isolated from food, environmental, and clinical samples by multiplex PCR 비살균원유로만든다양한치즈의 안전성에관한연구 : 총설 Sodium Chloride 가치즈의품질에 미치는영향과저염치즈개발기술 : 총설 저자 주저자교신저자공동저자 Jung-whan Chon Soo-kyung Lee 유성호 천정환 Jung-whan Chon Fereidoun Forghani Fereidoun Forghani 김홍석 천정환 Kun-Ho Seo Kun-Ho Seo 송광영 송광영 Kun-Ho Seo Deog-H wan Oh Deog-H wan Oh 송광영 송광영 Growth Inhibition of Cronobacter Dong-Hyeo Kun-Ho 2015 sakazakii in Experimentally n Kim Seo Hyunsook Kim Hong-Seok Kim Jung-Whan Chon, Kwang-Young Song, Ji-Yeon Hyeon,Jin-San Moon 서건호천정환 김현숙임종수 윤성식백현동 윤여창 김현숙김동현 김홍석정동관 김수기서건호 Kwang-Young Song Kun-Ho Seo 학술지명 International journal of food microbiology Poultry Science Journal of Korean Dairy Technology and Science Association Journal of Korean Dairy Technology and Science Association Journal of Food Science African Journal of Microbiology Research Jung-Beom Kim Journal of Food Science 천정환임종수 김현숙김동영 김수기서건호 김현숙김동현김홍석정동관김수기서건호 Jung-Wjan Chon Il-Byeong Kamg Journal of Korean Dairy Technology and Science Association Journal of Korean Dairy Technology and Science Association Journal of Food Vol. (No. ) 국내외구분 SCI 구분 165 국외 SCI 92 국외 SCI 31 (2) 31 (2) 79 (12) 8 (47) 79 (11) 국내비 SCI 국내비 SCI 국외 국외 국외 SCI SCI SCI 33 국내비 SCI 33 국내비 SCI 78 (9) 국외 SCI

237 Hyunsook Kim Contaminated Powdered Infant Formula by Kefir Supernatant Characterization of Escherichia coli Producing Extended-Spectrum b-lactamase (ESBL) Isolated from Chicken Slaughterhouses in South Korea Incidence, Antimicrobial Resistance, and Molecular Characteristics of Nontyphoidal Salmonella Including Extended-Spectrum b-lactamase Producers in Retail Chicken Meat Rapid detection of viable Bacillus cereus emetic and enterotoxic strains in food by coupling propidium monoazide and multiplex PCR (PMA-mPCR) A novel pentaplex real time (RT)- PCR high resolution melt curve assay for simultaneous detection of emetic and enterotoxin producing Bacillus cereus in food Jong-Soo Lim Dasom Choi Fereidoun Forghani Fereidoun Forghani Kun-Ho Seo Kun-Ho Seo Deog-H wan Oh Deog-H wan Oh Hong-Seok Kim Kwamg-Young Song Da-Som Choi Young-Jo Kim Jung-Whan Chon Hong-Seok Kim Hyun-Jung Park Jin-San Moon Sung-Hwan Wee Jung-Whan Chon Hong-Seok Kim Dong-Hyeon Kim Jong-Soo Lim Jin-Hyeok Yim Taimour Langaee, Mohammad Eskandari, Kun-Ho Seo, Mi-Ja Chung Singh, P. Kun-Ho Seo, Protection FOODBORNE PATHOGENS 12 국외 SCI AND DISEASE Journal of Food Protection 78 국외 SCI Food control 55 국외 SCI Food control 60 국외 SCI 2015 * (Sub mit) Pathogenic Eschericia coli isolated from slaughter house environment 임진혁서건호천정환, 김동현 International journal of food microbiology - 국외 SCI 2015 * (Sub mit) Multiplex PCR method with internal amplification control distinguish Shigella spp and enteroinvasive escherichia coli in ready to eat vegetables 임진혁서건호천정환, 김홍석 International journal of food microbiology - 국외 SCI

238 다. 특허성과 출원된특허의경우 등록된특허의경우 등록연도 특허명등록인등록국등록 번호 등록연도 특허명등록인등록국 등록번호

239 라. 기술료징수현황 기징수액 당해년도징수액 향후징수액 합계 - 3,000,000 매출정율사용료 ( 매출액의3%) 3,000,000+α - - 매출정율사용료 ( 매출액의3%) ( 향후매출액의3%) 20,000,000 20,000,000-20,000,000 마. 사업화현황 사업화명 사업화내용 사업화업체개요 업체명대표자종업원수사업화형태 기매출액 당해년도 매출액 매출액 합계 바. 인력활용 / 양성성과 (1) 인력지원성과 지원총인원 지원대상 ( 학위별, 취득자 ) 성별지역별 박사석사학사기타남여수도권대전기타지역 (2) 장 단기연수지원성과 장기 (2 월이상 ) 단기 (2 월미만 ) 국내국외국내국외 (3) 산업기술인력양성성과 프로그램명프로그램내용교육기관교육개최회수총교육시간총교육인원 사. 경제사회파급효과 산업지원성과 ( 단위 : 2건 ) 고용창출성과 ( 단위 : 명 ) 기술지도 기술이전 기술평가 합계 창업 사업체확장 합계

240 그림 5.1 구토및설사형바실러스세레우스세균을동시에검출할수있는 Multiplex PCR detection kit 시제품 ( 왼쪽 ) 및사용설명서예시

241 그림 5.2 구토및설사형바실러스세레우스세균을동시에검출할수있는 Multiplex Real-time PCR kit 시제품 ( 왼쪽 ) 및사용설명서예시

242

243 그림 종병원성대장균을동시에검출할수있는 PCR 및 Real-time PCR kit, Real-time PCR 에적용할수있는 Internal amplification control kit 의시제품들

244 제 6 장연구개발과정에서수집한해외과학기술정보

245 표 2. NCBI 의 PubMed 에서 Bacillus cereus" and "Multiplex PCR" 를검색어로 [all fields] 에 서검색한결과중에서관련성이높은논문들의목록예 (selected papers) 번호 논문제목 저널명및년도 분석 ( 장단점요약 ) 1 Detection of viable enterotoxin-producing Bacillus cereus and analysis of toxigenicity from ready-to-eat foods and infant formula milk powder by multiplex PCR. J Dairy Sci 설사독소들을타겟으로한 PCR 법으로신선채소류와유아용우유에적용함. 구토독소생성세균은검출못함 2 A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species. PLoS One 탄저균검출을위한 PCR 기법으로본과제와는간접적으로연관됨 3 Rapid detection of viable Bacillus cereus emetic and enterotoxic strains in food by coupling propidium monoazide and multiplex PCR (PMA-mPCR) Food Control 2015 본연구팀의결과임. 구토및설사독소생성바실러스를동시에검출함. 특히생균만을특이적으로검출가능함 4 Enterotoxigenic profiling of emetic toxin- and enterotoxin-producing Bacillus cereus, Isolated from food, environmental, and clinical samples by multiplex PCR. J Food Sci 본연구팀의결과임. 구토및설사독소생성바실러스를동시에검출함 Multiplex PCR assay for the detection of enterotoxic Indian J 설사독소들을타겟으로한 PCR 5 Bacillus cereus group strains and its application in food Microbiol. 법으로여러식품에적용함. 구 matrices 토독소생성세균은검출못함 Comparison of multiplex PCR, enzyme immunoassay and J Microbiol 설사독소들을타겟으로한 PCR 6 cell culture methods for the detection of Methods. 법과면역법및세포배양법을 enterotoxinogenic Bacillus cereus 비교함 7 Prevalence and toxigenic profiles of Bacillus cereus isolated from dried red peppers, rice, and Sunsik in Korea. J Food Prot 한국의여러시료에서분리한바실러스에서독소유전자들의존재양상을분석함 Broad distribution of enterotoxin genes (hblcda, nheabc, Int J Food 설사독소들을타겟으로한 PCR 8 cytk, and entfm) among Bacillus thuringiensis and Bacillus Microbiol. 법으로여러식품에적용함. 구 cereus as shown by novel primers 토독소생성세균은검출못함 9 Simultaneous detection and identification of Bacillus cereus group bacteria using multiplex PCR. J Microbiol Biotechnol 바실러스세레우스그룹을동시에검출할수있는방법. 독소생성에집중하지않음 바실러스세레우스의독소생성 10 Establishment of a novel multiplex PCR assay and detection of toxigenic strains of the species in the Bacillus cereus group. J Food Prot 균주들에 multiplex PCR을적용한선구적연구임. 그러나구토및설서형독소생성세균을동 시검출못함

246 제 7 장연구시설 장비현황 * 도입 개발한연구시설 장비현황및국가과학기술종합정보시스템장비등록번호를기술

247 제 8 장연구실안전관리이행실적

248 <1 협동 > 위험등급점검주기분류기준 A 등급 분기 1 회 가연성가스, 인화성시약, 유해화학물질, 다량의폐액배출, 독극물, 생물및동물의취급, 방사성동위원소, 위험성이높은기계장비가 설치된실험실 B 등급반기 1 회일반시약, 소규모인화성시약, 불연성가스, 소량의폐수발생실험실 C 등급연 1 회이화학실험을수행하지않는전기, 설계, 컴퓨터관련실험실

249

ƯÇãû

ƯÇãû '' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence

More information

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid

More information

- 2 -

- 2 - - 2 - - 3 - - 4 - ➀ - 5 - - 6 - α - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - μ - 21 - ➀ - 22 - - 23 - - 24 - α - 25 - - 26 - - 27 - μ - 28 - μ μ - 29

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

- 2 -

- 2 - - 2 - α - 3 - - 4 - α - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - 번호 유효성분 차나무오일 코퍼설페이트펜타하이드레이트 폴리옥신디 - 12 - - 13 - μ - 14 - α m α α μ - 15 - μ μ - 16 - m μ - 17 - - 18 - - 19 - μ - 20 - μ μ μ - 21 - -

More information

F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4)

F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4) FSequencing 01. DNA sequencing Phone: 1588-9788 (ext.4 4) E-mail: sequencing@bioneer.co.kr 01. 242 FAQs 247 개요 상세 설명 바이오니아는 국내 최초로 를 시작하였으며, 매년 개선된 high-throughput sequencing service를 제공하고 있습니다. Plasmid

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.

주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다. 편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 원외폐렴원인균조사및내성감시 시스템구축 주의 ( 주의내용기재 ) ( 글 14 point 고딕체 ) 제명 2 0 0 Microbiological Etiology of Community acquired pneumonia and Surveillance network of resistance 주관연구기관 : 울산대학교의과대학

More information

untitled

untitled 국내구토형바실러스세레우스감시및독소유형 Surveillance and toxin profile of emetic toxin producing Bacillus cereus in Korea 질병관리본부국립보건연구원감염병센터장내세균과 Ⅰ. 들어가는말 Bacillus 속의박테리아는대부분의환경속에존재하고있으며, 현재약 148개의종으로분류되고있다. 이중에서 Bacillus

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

03. In011.hwp

03. In011.hwp V 3+CD4+ T Selective Expansion of TCR V 3+CD4+ T Cells in Collagen-induced Arthritis in DBA/1 Mice Jae Seon Lee, Mi La Cho, Jung Eun Lee, So Youn Min, Chong Hyeon Yoon, Wan Uk Kim, Jun Ki Min, Sung Hwan

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not

More information

(....).hwp

(....).hwp 연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying

More information

강의지침서 작성 양식

강의지침서 작성 양식 정보화사회와 법 강의지침서 1. 교과목 정보 교과목명 학점 이론 시간 실습 학점(등급제, P/NP) 비고 (예:팀티칭) 국문 정보화사회와 법 영문 Information Society and Law 3 3 등급제 구분 대학 및 기관 학부(과) 전공 성명 작성 책임교수 법학전문대학원 법학과 최우용 2. 교과목 개요 구분 교과목 개요 국문 - 정보의 디지털화와 PC,

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

발간등록번호 11-1470550-000330-01 식품중사용원료진위판별지침서 유전자분석법활용 2013. 12. - 유전자분석법활용 - 발간사 최근부당이익을얻기위하여값싼원료를사용하거나표시사항을허위로기재하는등의불량식품 가짜식품 제조 유통사례가증가하고있는실정입니다. 특히고추양념을혼합한불량고춧가루 다진마늘에양파혼합 홍삼분말에마분말혼합등의사례가언론등을통하여보도되면서식품에대한불안감이있는실정입니다.

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

45(3)-10(048)p fm

45(3)-10(048)p fm The Korean Journal of Microbiology, Vol. 45, No. 3, September 009, p. 86-90 Copyright 009, The Microbiological Society of Korea s Semi-quantitative RT-PCR w v H9N y» ù» 1 Á Á 3 Á 4 Á x 5 Á 5 Á 5 Á 5 Á«x

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA J Korean Soc Food Sci Nutr 한국식품영양과학회지 39(4), 595~601(2010) DOI: 10.3746/jkfn.2010.39.4.595 Multiplex Polymerase Chain Reaction(PCR) 법을이용한 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

발간등록번호

발간등록번호 발간등록번호 3. 보고서요약서 보고서요약서 - 2 - - 3 - 4. 국문요약문 - 4 - 5. 영문요약문 < SUMMARY > - 5 - 6. 영문목차 < CONTENTS > - 6 - - 7 - 7. 본문목차 목차 - 8 - - 9 - 제 1 장. 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 -

More information

06.hwp

06.hwp -Original Paper-35 41. 2009. 토양으로부터분리한토착유효미생물을이용한음식물쓰레기의자원화 이상우 함선녀 신택수 김혜경 연익준 * 김광렬 * (2008 8 21, 2009 1 23 ) Resource of Food Waste using Indigenous Bacteria Isolated from Soils Sang-Woo Lee Sun Nyeoo

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

KISEP Rhinology Korean J Otolaryngol 2000;43:391-5 소아만성부비동염의원인균분석 최영철 김태철 전은주 박용수 Microbiologic Study of Chronic Sinusitis in Children Young-Chul Choi

KISEP Rhinology Korean J Otolaryngol 2000;43:391-5 소아만성부비동염의원인균분석 최영철 김태철 전은주 박용수 Microbiologic Study of Chronic Sinusitis in Children Young-Chul Choi KISEP Rhinology Korean J Otolaryngol 2000;43:391-5 소아만성부비동염의원인균분석 최영철 김태철 전은주 박용수 Microbiologic Study of Chronic Sinusitis in Children Young-Chul Choi, MD, Tae-Chul Kim, MD, Eun-Ju Jeon, MD and Yong-Soo

More information

DNA의추출 Table 1. Sequences of oligonucleotide primers Primers L1 consensus primer Sequence CGT CCM ARR GGA WAC TGA TC Size of amplified products

DNA의추출 Table 1. Sequences of oligonucleotide primers Primers L1 consensus primer Sequence CGT CCM ARR GGA WAC TGA TC Size of amplified products KISEP Rhinology Korean J Otolaryngol 2000;43:836-43 비 부비동반전성유두종에서인유두종바이러스및 Epstein-Barr 바이러스의검출과 p53 단백및 Proliferating Cell Nuclear Antigen 의발현 조진희 서병도 전범조 장한성 양명재 윤희로 노우영 Detection of Human Papillomavirus

More information

PDFCoTemp.HWP

PDFCoTemp.HWP 국립수의과학검역원 고시 제2010-2호 축산물가공처리법 제4조제2항의 규정에 의거 축산물의가공기준및성분규격을 다음과 같이 개정 고시합니다. 2010년 4월 7일 국립수의과학검역원장 축 산 물 의가 공 기 준 및 성 분 규 격 제1조(목적) 이 고시는 축산물가공처리법(이하 법 이라 한다) 제4조제2항의 규정에 의하여 축산물의 가공기준 및 성분규격을 규정함으로써

More information

농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (

농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information

제 출 문 식품의약품안전청장 귀 하 이 보고서를 어묵류 등 6개 의무적용품목의 위해관리 지침서 개발 (한국보 건산업진흥원/천석조) 과제의 연구결과보고서로 제출합니다. 2004. 11. 주관연구기관명 : 한국보건산업진흥원 주관연구책임자 : 천 석 조 제 1세부과제명 :

제 출 문 식품의약품안전청장 귀 하 이 보고서를 어묵류 등 6개 의무적용품목의 위해관리 지침서 개발 (한국보 건산업진흥원/천석조) 과제의 연구결과보고서로 제출합니다. 2004. 11. 주관연구기관명 : 한국보건산업진흥원 주관연구책임자 : 천 석 조 제 1세부과제명 : 최종보고서 정책-식품-2004-56 어묵류 등 6개 HACCP 의무적용품목의 위해관리 지침서 개발(자료편) Development of Guidelines on the Hazard Control of Mandatory HACCP Application Food Items(Database) 한국보건산업진흥원 식 품 의 약 품 안 전 청 제 출 문 식품의약품안전청장

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

04-다시_고속철도61~80p

04-다시_고속철도61~80p Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

fm

fm J. Fd Hyg. Safety Vol. 25, No. 3, pp. 220~225 (2010) Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 서울시내유통식품에서분리한대장균의항생제내성및내성유전자 유영아 * 김무상 김경식 박선희 정성국 서울시보건환경연구원 Antimicrobial

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

(079-088)Kjbt015.hwp

(079-088)Kjbt015.hwp 대한수혈학회지:제18권 제2호, 2007 다중 단일염기 시발체 확장반응을 이용한 ABO 유전자형 검사 현정원 1 장호은 2 허세란 2 송상훈 1 박경운 1,2 송정한 1,2 한규섭 1 = Abstract = 서울대학교 의과대학 검사의학교실 1, 분당서울대학교병원 진단검사의학과 2 ABO Genotyping using a Multiplex Single-base

More information

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

ETL_project_best_practice1.ppt

ETL_project_best_practice1.ppt ETL ETL Data,., Data Warehouse DataData Warehouse ETL tool/system: ETL, ETL Process Data Warehouse Platform Database, Access Method Data Source Data Operational Data Near Real-Time Data Modeling Refresh/Replication

More information

10송동수.hwp

10송동수.hwp 종량제봉투의 불법유통 방지를 위한 폐기물관리법과 조례의 개선방안* 1) 송 동 수** 차 례 Ⅰ. 머리말 Ⅱ. 종량제봉투의 개요 Ⅲ. 종량제봉투의 불법유통사례 및 방지대책 Ⅳ. 폐기물관리법의 개선방안 Ⅴ. 지방자치단체 조례의 개선방안 Ⅵ. 결론 국문초록 1995년부터 쓰레기 종량제가 시행되면서 각 지방자치단체별로 쓰레기 종량제 봉투가 제작, 판매되기 시작하였는데,

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

감각형 증강현실을 이용한

감각형 증강현실을 이용한 대한산업공학회/한국경영과학회 2012년 춘계공동학술대회 감각형 증강현실을 이용한 전자제품의 디자인 품평 문희철, 박상진, 박형준 * 조선대학교 산업공학과 * 교신저자, hzpark@chosun.ac.kr 002660 ABSTRACT We present the recent status of our research on design evaluation of digital

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

이발명을지원한국가연구개발사업 과제고유번호 부처명 농촌진흥청 연구관리전문기관 연구사업명 현장협력기술개발사업 연구과제명 저항성유전자의개발및이용 기여율 주관기관 경희대학교 연구기간 ~

이발명을지원한국가연구개발사업 과제고유번호 부처명 농촌진흥청 연구관리전문기관 연구사업명 현장협력기술개발사업 연구과제명 저항성유전자의개발및이용 기여율 주관기관 경희대학교 연구기간 ~ (19) 대한민국특허청 (KR) (12) 공개특허공보 (A) (11) 공개번호 10-2010-0103000 (43) 공개일자 2010년09월27일 (51) Int. Cl. C12N 9/10 (2006.01) C12N 15/54 (2006.01) C07K 14/415 (2006.01) A01H 1/00 (2006.01) (21) 출원번호 10-2009-0021349

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -

More information

ca_02.hwp

ca_02.hwp SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여

More information

Original Articles Korean Circulation J 2000;30 6 : 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic

Original Articles Korean Circulation J 2000;30 6 : 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic Original Articles Korean Circulation J 2000;306:702-715 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic Variants of Thromobomodulin Gene as Risk Factors for

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

15_3oracle

15_3oracle Principal Consultant Corporate Management Team ( Oracle HRMS ) Agenda 1. Oracle Overview 2. HR Transformation 3. Oracle HRMS Initiatives 4. Oracle HRMS Model 5. Oracle HRMS System 6. Business Benefit 7.

More information

hwp

hwp 보안과제( ), 일반과제( o ) 17459-12172바약안304 의약품등안전관리 바이러스유래유전자치료제의안전성평가기반연구 Development of Biosafety Testing SOPs for Gene Therapeutic Virus Vectors 충북보건대학교산학협력단 식품의약품안전청 별지제 6 호서식 용역연구개발과제연차실적 계획서 과제번호 12172

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

Output file

Output file 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Compar

대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Compar 대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 331-5 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Comparison of Detection of Escherichia coli O157 Between

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

(2005\263\342\271\351\274\255_final.hwp)

(2005\263\342\271\351\274\255_final.hwp) 제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법

More information

(460 신용길).fm

(460 신용길).fm 식물병연구 Res. Plant Dis. 19(1) : 36 44 (2013) http://dx.doi.org/10.5423/rpd.2013.19.1.036 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 에의한카네이션괴저바이러스와카네이션둥근반점바이러스정밀진단

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

중합효소연쇄반응 (polymerase chain reaction:pcr) 에의한 HPV와 EBV의검출 Table 1. Oligonucleotide primers of PCR for HPV and EBV Nucleotide sequence Product size Huma

중합효소연쇄반응 (polymerase chain reaction:pcr) 에의한 HPV와 EBV의검출 Table 1. Oligonucleotide primers of PCR for HPV and EBV Nucleotide sequence Product size Huma KISEP Head and Neck Korean J Otolaryngol 2001;44:0611 상악암에서중합효소연쇄반응을이용한인형유두종바이러스와 EpsteinBarr Virus 의검출 조재식 임상철 정형수 임회정 김정현 The Detection of Human Papillomavirus and EpsteinBarr Virus DNA in Maxillary

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

Microsoft PowerPoint - AC3.pptx

Microsoft PowerPoint - AC3.pptx Chapter 3 Block Diagrams and Signal Flow Graphs Automatic Control Systems, 9th Edition Farid Golnaraghi, Simon Fraser University Benjamin C. Kuo, University of Illinois 1 Introduction In this chapter,

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

김도희_HT protein expression 표준 보고서_v1.5

김도희_HT protein expression 표준 보고서_v1.5 Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX

More information

(....).hwp

(....).hwp sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

Development of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata

Development of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata Development of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata . 2000. 12. 15. : : : : : : : : : - i - . :..,., 40.,,,, (, ),,,,,. Saponin, Inulin, Triterpene,,,. (C. lanceolata),

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

11¹Ú´ö±Ô

11¹Ú´ö±Ô A Review on Promotion of Storytelling Local Cultures - 265 - 2-266 - 3-267 - 4-268 - 5-269 - 6 7-270 - 7-271 - 8-272 - 9-273 - 10-274 - 11-275 - 12-276 - 13-277 - 14-278 - 15-279 - 16 7-280 - 17-281 -

More information

한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석

한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석 한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in

More information

발간등록번호 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도

발간등록번호 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도 발간등록번호 11-1543000-002003-01 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도 농림축산식품부장관귀하 본보고서를 상황버섯으로유도된 FMO3 와 Corin 에의한농약분해및혈압저하유도 ( 개발기 간 :2014. 09. ~ 2017. 09.) 과제의최종보고서로제출합니다. 2017. 11.. 주관연구기관명 : 서울시립대학교산학협력단

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

KD2002-29-02.hwp

KD2002-29-02.hwp 韓 國 敎 育 요 약 학술 논문.,......,.,,,......., (, 1999).. ...,.,.,,,.,,,,, (, 1990).,,. (,, 1999)...,...,,,.,,.,.. (, 1999),,., 학술 논문....,., (, 1998).., (Keeves, 1997)...,...,.,,.,... (, 1970). .,,,,,.,,,,...,,,,,..

More information

(이수헌).fm

(이수헌).fm 식물병연구 Res. Plant Dis. 19(3) : 220 225 (2013) http://dx.doi.org/10.5423/rpd.2013.19.3.220 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 과 nested PCR 을이용한 Nepovirus

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between

More information