hwp
|
|
- 재희 한
- 7 years ago
- Views:
Transcription
1 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) J Korean Med. 2016;37(1):62-76 pissn eissn Original Article Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 엄은식, 김영철 경희대학교대학원임상한의학과 Effect of Samhwangsasim-tang and Daehwanghwangryunsasim-tang on Palmitate-induced Lipogenesis in HepG2 cells Eun sik Um, Young Chul Kim Department of Clinical Korean Medicine, Graduate School, Kyung Hee University Objectives: The goal of this study was to investigate the anti-lipogenic effects of Samhwangsasim-tang(SHT), Daehwanghwangryunsasim-tang(DHT) aqueous extract on HepG2 cells with palmitate. Materials and Methods: HepG2 cells treated with palmitate were used in this study as hepatic steatosis model. Cells were treated with different concentrations of SHT, DHT aqueous extract for 24 hours. Cell viability and cytotoxicity were analyzed by MTT assay. Expressions of Bcl-2, Bax, Survivin, P21, TGF-β1, LXR-α, ChREBP, ACC1, SCD1 mrna were determined by Real-time PCR. Apoptosis of cells was detected by ELISA and FACS. Expression level of caspase-3 was studied by Western blot. Lipid accumulation was indicated by Oil Red O staining. Results: SHT, DHT aqueous extract had no cytotoxicity, but decreased palmitate-induced lipid accumulation in HepG2 cells. SHT aqueous extract suppressed fatty acid synthesis by inhibiting LXR-α, ChREBP, SCD1 activation and increasing TGF-β1 expression level. DHT aqueous extract also suppressed fatty acid synthesis by decreasing ChREBP expression and increasing TGF-β1 expression. Apoptosis of lipid accumulated cells was increased by enhanced activities of P21, caspase-3 and inhibited expressions of Bcl-2, Survivin. Conclusions: These results suggest that SHT and DHT have an anti-lipogenic effects on lipid accumulation of hepatic cell. Also SHT and DHT have an efficacy to increase apoptosis of adipocyte without cytotoxicity. Therefore, SHT and DHT might have potential clinical applications for treatment of hepatic steatosis. Key Words : Samhwangsasim-tang, Daehwanghwangryunsasim-tang, Hepatic steatosis, NAFLD, Lipogenesis, Apoptosis 서론지방간이란지방이간조직에과다축적되어, 간무게의 5% 이상을차지한경우를말한다 1). 특히대사성질환의유병율이점차증가함에따라, 만성간질환에서비알코올성지방간질환 (Non-alcoholic fatty liver disease, NAFLD) 의비중이커지고있다 2). NAFLD는알코올성간질환과유사한조직학적손상을보이는질환으로, 단순한간지방증 (hepatosteatosis) 부터 3) 비알코올성지방간염 (Non-alcoholic steatohepatitis, NASH) 을거친간섬유화, 간경변에이르기까지다양한간손상을유발한 Received:27 November 2015 Revised:16 March 2016 Accepted:24 March 2016 Correspondence to: 김영철 (Young Chul Kim) 서울시동대문구경희대로 23 경희의료원한방병원한방내과 Tel: , Fax: , flare0722@khu.ac.kr 62
2 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (63) 다 4). 선진국의경우비만인구가늘면서 NAFLD 의유병률은 14~27% 까지나타나고있으며 5), 우리나라역시식습관이서구화되고생활환경이바뀜에따라비알코올성지방간의유병률이증가하고있는추세이다 6). 이렇게 NAFLD 의중요도가높아지면서그발생기전과치료및관리에관한연구도다양하게이루어지고있지만 7,8), 확실하게효과가입증된약물은아직보고되지않고있으며, 치료지침도기존간보호약제사용이나생활습관개선등으로질환의진행을예방하는정도에머물러있는상황이다 9). NAFLD 와관련하여한의학적인연구도활발하게진행되고있는데, 세포및동물실험을통해한약재의치료효과와기전을밝히고있다 10,11,12). 본연구에사용한삼황사심탕은고혈압, 동맥경화증에다용하는대표처방으로, 앞선연구에서비만동물모델의대사질환에효과가있다는것이확인되었으며 13), 구성약재인황금과황련은지질대사관련동물실험에서도뛰어난조절효과가있다고보고되었다 14). 대황황련사심탕역시구성약재인황금, 황련, 대황의항고지혈증효과가밝혀져있어 15), 두약제모두대사증후군을관리하면서 NAFLD 치료및예방에접근하는약물로서가치가있다. 저자는삼황사심탕과대황황련사심탕이비만및대사질환에미치는영향을바탕으로, 복합성분의한 약추출물이비알코올성지방간세포모델에작용하는분자생물학적기전을살펴보고자하였다. 효과검증을위해 MTT assay, Realtime-PCR, ELISA, FACS, Western Blotting, Oil Red O staining 등을시행하였고, 유의성있는결과를얻었기에보고하는바이다. 실험 1. 재료 1) 약재본실험에서사용한약재는대한약전및대한약전외한약규격집에근거하여경희대학교부속한방병원에서구입하여사용하였으며, 내용및용량은아래 Prescription 과같다. 2) 검액의조제삼황사심탕 ( 이하 SHT) 4 첩 (112 g) 과대황황련사심탕 ( 이하 DHT) 5 첩 (80 g) 을환류추출기에넣고, 3 차증류수 1000ml 를더하여 2 시간동안가열추출한후여과하였다. 추출액을여과하여감압농축한후, 동결건조기로건조하여삼황사심탕물추출물 24 g( 수율 21.4%) 과대황황련사심탕물추출물 g( 수율 26.6%) 을얻었다. Prescription of Samhwangsasimtang(SHT), Daehwanghwangryeonsasimtang(DHT) Herbs of DHT Herbs of SHT Scientific name Volume(g) 대황 RheiRhizoma 40 황련 CoptidisRhizoma 20 황금 Scutellariae Radix 20 total amount 80 Scientific name Volume(g) 대황 RheiRhizoma 48 생지황 Rehmanniae Radix 32 황련황금 CoptidisRhizoma Scutellariae Radix total amount
3 (64) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) 3) 재료 Palmitic acid, Oil Red O, 3-[4,5-dimethylthiazol -2-yl]-2,5-diphenyltetrazolium bromide(mtt), Trizma base, Ammonium persulfate(aps), N,N,N',N tetramethylethylenediamine(temed), Phenylmethanesulfonyl fluoride(pmsf) 는 Sigma Aldrich (St.Louis, MO, USA) 에서구매하였다. 단백질분석을위해필요한재료중, Pageruler Plus Prestained Protein Ladder, Pierce BCA Protein Assay Kit, Supersignal West Femto Maximum Sensitivity Substrate 는 Thermo Fisher Scientific (Waltham, MA, USA) 에서구입하였고, 10 cell lysis buffer 는 Cell Signaling Technology(Beverly, MA, USA) 에서 Western Blotting Detection Reagent 는 GE Healthcare(Little Chalfont, UK) 에서구매하였다. 단백질 detecting 을위한 Enhanced Chemiluminescence Kit 는 Santa Cruz Biotechnology(CA, USA) 에서, 단백질발현을분석하기위한 Davinch -Chemi Chemiluminescence Imaging System 은 Davinch-K Co. Ltd(Seoul, Korea) 에서구입한것을사용하였다. 세포배양을하기위한 Dulbecco's Phosphate Buffered Saline(DPBS), Dulbecco's modification of Eagle's medium(dmem) 은 Welgene Inc.( 대구, Korea) 에서구입하였고, Penicillin streptomycin, Trypsin-EDTA, no Glucose 는 Gibco Invitrogen (Grand Island, NY, USA) 에서, Fetal Bovine Serum(FBS) 은 Atlas Biologicals(Fort Coliins, CO, USA) 에서구매하였다. 2. 방법 1) 세포배양인간간암세포주 (Human hepatocellular carcinoma cell line) HepG2 cell 은한국세포주은행으로부터구매해사용하였다. HepG2 cell 은 FBS 10%, penicillin 10 μu/ml, streptomycin 100 μg/ml 를첨가한 DMEM 을사용하여, 5% CO 2, 37 환경에서배양하였다. 2) 지방산준비 Palmitic acid 준비과정은 Choi 등의실험 16) 을참고하였다. NaOH 0.01 M 에 PA 20 mm 을섞고, 70 에서 30 분유지시켜현탁액을만든다음, 10% fatty acid free BSA solution 과 1:3 비율로혼합하여 37 로 conjugation 시켰다. 이렇게제작한 FA stock solution 5 mm 을 Glucose DMEM 5.5 mm, 0.5% FBS 와 1:4 비율로섞어 FA working solution 1 mm 을만들었다. 3) MTT assay Cell viability 를확인하기위해 MTT assay 를시행하였다. 먼저 HepG2 cell 을 24well cell culture plates 에 cells/well 만큼나누어 colony 를만들고, 48 시간동안배양하였다. 그다음 24 시간동안 5.5 mm Glucose DMEM, 0.5% FBS 으로 fasting 시킨후약재를처리하고 PMS/MTS solution 을이용하여 490 nm 에서흡광도를측정하였다. 4) Real-time PCR Total RNA 는세포배양후 total RNA 는 Trizol reagent 를이용하여제작사의지시에따라분리하였다 (Invitrogen). 이렇게얻어진 total RNA 1 μg 을 random hexamers 를이용한 reverse-transcription system(promega, Madison, WI, USA) 으로 cdna 로변환하였다. 실험에사용된 primer 종류와 sequences 는 table1. 과같다. Real-timePCR 은 Applied Biosystem 사 (CA, USA) 의 StepOnePlusReal_time PCR System 을이용하여제작사가권고하는방법에따라시행하였으며, House keeping gene 인 β-actin 을기준으로상대적인유전자의발현값을정량적으로표현하였다. 2 x SYBR Green PCR Master Mix 10 μl, cdna 1 μl, primer(sense) 1 μl, primer(anti-sense) 1 μl, Distilled water 7 μl 를혼합하여전체부피를총 20 μl 로조절하였고, 초기변성 (denaturation) 은첫 cycle 만 9 5 에서 3 분간, 나머지 40 cycle 까지는 95 에서 10 초간, 풀림 (annealing) 은 60 에서 10 초간, 연장 64
4 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (65) (extension) 은 72 에서 15 초간으로하여증폭시켰다. 5) ELISA 한약재가간암세포주의세포자멸에미치는영향을밝히기위해 Cell death detection ELISA kit(roche Molecular Biochemicals, Mannheim, Germany) 를이용하여측정하였다. HepG2 세포를 6-well plate 에분주하여 24 시간동안부착시킨후 PA 및한약재를농도별로처리하고 24 시간동안배양하였다. 배양배지를제거한후 0.2 ml 의용해완충액 (lysis buffer) 을첨가하여 30 분간방치하고 200 xg 에서 10 분간원심분리한후제조사의지시에따라 405 nm 파장에서흡광도를측정하였다. 6) FACS Annexin-V/PI assay kit 를사용하여, 약재처리에의한 HepG2 세포주의세포자멸을확인하였다. PA 및한약재를농도별로처리한 HepG2 세포주를 ice-cold PBS buffer 로 2 차례씻어내고, 500 μl binding buffer 에서재침전한뒤, FITC 결합 Annexin-V (10 mg/ml) 와 PI (50 mg/ml) 5 μl 로염색하여, 실온의어두운환경에서 5-15 분가량배양하고, FACS Calibur (Becton Dickinson Immunocytometry System, San Jose, CA, USA) 를이용하여분석하였다. FITC 에만양성반응을보이는세포는조기세포자멸, FITC 와 PI 에모두양성반응을보이는세포는후기세포자멸단계로, 이두가지단계의세포수비율의합으로세포주의세포자멸을평가하였다. 7) Western Blotting 100 mm cell culture dish 에 cells/well 만큼나누어 colony 를만들고 48 시간배양한후 5.5 mm Glucose DMEM, 0.5% FBS 으로 24 시간 fasting 시켰다. PA 와 SHT, DHT 등을처리한뒤 24 시간후에 1 cell lysis buffer+1mm PMSF 를사용하여단백질을추출하였고, 정량을위해제조사의권고에따라 Pierce BCA Protein Assay Kit 를이용 하였다. Sample buffer 를 100mM DTT, 30% glycerol, 0.3% bromophenol blue, 187 mm Tris-HCL ph6.8 등에희석해 95 환경에서 5 분간유지시킨후 10~12% SDS-polyacrylamide gel 에서전기영동하였다. 전기적으로 gel 상의단백질을 nitrocellulose membrane 으로이동시키고 1 시간동안상온에서 5% nonfat dry milk 로 blocking 하였다. 4 에서 overnight 하여 Cleaved Caspase-3, β-actin 의항체와반응하게만들고, TBS-T 를이용해 1:1000 으로희석하였다. 그다음 TBS-T 로 1:2500 희석되고 horseradish peroxidase 가결합된 2 차항체로반응하도록상온에서 1 시간기다린후, 재차 TBS-T 로 1 시간동안세척하였다. 단백질들은 Enhanced Chemiluminescence Kit 를사용해 detecting 하였고, 발현된단백질들을분석하기위해 Davinch-Chemi Chemiluminescence Imaging System 을이용하였다. 결과 band 의 intensity 는농도계로측정하였다. 8) Oil Red O staining HepG2 cell 의중성지방생성량을확인하기위해, intracytoplasmic lipids 를측정하는데적합한 Oil Red O 17) 를활용하여염색을하였다. 6well culture plates 에 cells/well 만큼나누어 colony 를만들고 48 시간배양한다음, 24 시간동안 5.5 mm Glucose DMEM, 0.5% FBS 으로 fasting 시켰다. PA 와 SHT, DHT 등을처리한다음에는 24 시간이지난후 DPBS 로 2 회세척하고 10% formalin 으로 10 분간고정하였으며, 60% isopropanol 과증류수로세척하는과정까지거친뒤 plates 를완전히말려 isopropanol 에용해시킨 Oil Red O dye 를처리하였다. 20 분동안 obiltal shaker 에넣고 incubation 한다음증류수를이용하여여러번세척하였고, 염색정도확인을위해 200 배율위상차현미경으로관찰하였다. 3. 통계분석실험을통해얻어진결과는 Excel 과 Prism program 의 one-way ANOVA, Bonferroni s post 65
5 (66) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) hoc test, Student's t-test 를이용해대조군과실험군의데이터차이를비교하였다. 통계적유의성은 P 값 (P<0.05, P<0.01) 을기준으로하여평가하였다. 결과 1. PA 와 SHT, DHT 추출물이세포활성도에미치는영향 0, 100, 200, 300 μm 농도의 PA 를 HepG2 세포주에투여하여 24 시간배양한결과, 농도의존적으로세포수가감소하였다. 0, 100, 200, 300 μm 농도의 SHT, DHT 추출물을 HepG2 세포주에투여하여 24 시간배양하였을때는세포의활성도에저하가없었으므로, 실험에사용하는약재추출물에는세포독성이없음을알수있다 (Figure 1. A). 또한 PA 와 SHT, DHT 추출물을같이처리한경우 PA 만처리했을때보다세포활성도가증가하였다 (Figure 1. B). 2. SHT, DHT 추출물이 Apoptosis 관련 mrna (Bcl-2, Bax, Survivin, P21) 에미치는영향 HepG2 세포주에 PA 와 SHT, DHT 추출물을투여하고 24 시간이지난후 Bcl-2, Bax, Survivin, P21 mrna 발현을관찰하였다. PA 300 μm 만처리한군을기준으로하여상대적인변화를확인하였다. Bcl-2 mrna 발현의경우 SHT 추출물 300 μ g/ml 투여군에서유의하게감소하였으며, DHT 추출물투여군의경우유의한차이는나타나지않았다 (Figure 2.A). Bax mrna 는 SHT 추출물 300 μg/ml 투여군에서유의한감소가관찰되었으며, DHT 추출물투여군은뚜렷한변화가없었다 (Figure 2.B). Survivin mrna 의경우 PA 300 μm 투여군도 control 군보다는감소함을알수있었고, SHT 추출물 150, 300 μg/ml 투여군에서는상대적으로더욱유의하게줄어든것을확인하였다. DHT 추출물투여군에선 300 μg/ml 농도에서 Survivin mrna 발현이유의하게감소하였다 (Figure 2.C). Fig. 1. Cell viability assay. After treatment of Palmiticacid(PA) and SHT, DHT extract on HepG2 cells, MTT assay was performed. PA was treated as 100, 200, 300 μm for 24h. PA lowered viability of HepG2 cells. On the other hand, SHT, DHT extract(100, 200, 300 μg/ml) showed no toxicity to HepG2 cells(a). SHT, DHT extract increased viability of HepG2 cells treated with PA(B). Statistical significance was determined by one-way ANOVA test, # p<0.05, ## p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to control. 66
6 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (67) Fig. 2. Bcl-2, Bax, Survivin, P21 mrna Expression Level. PCR was performed with 1 μl of cdna in 20 μl reaction mixtures that comprised 10 ml of Power SYBR Green PCR Master Mix, 2 μl of primers, and 7 μl of PCR-grade water. The reactions were performed with a denaturation step at 95 C for 10 min, 40 cycles of 95 C for 15 s, and 60 C for 1 min. The crossing point of the target genes with β-actin was calculated using the formula 2 (targetgene ß actin), and the relative amounts were quantified. HepG2 cells were treated with 300 μm of PA and 0, 150, 300 μg/ml of SHT, DHT extract for 24 hours. Relative mrna levels of Bcl-2(A), Bax(B), Survivin(C), P21(D) are represented on each bar graph. Statistical significance was determined by one-way ANOVA test.also Bonferroni s test and Student's t-test were used to compare each set of data, # p<0.05, ## p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to PA-treated group. 67
7 (68) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) P21 mrna 는 PA 300 μm 투여군에서발현이유의하게상승하였고, SHT 추출물 150, 300 μg/ml 투여군에서도상대적으로유의한발현량증가를보였다. DHT 추출물 300 μg/ml 투여군에서역시유의하게발현량이증가함을알수있었다 (Figure 2.D). 3. SHT, DHT 추출물이 apoptosis 에미치는영향 (ELISA) HepG2 세포주에 PA 300 μm, SHT, DHT 추출물 0, 150, 300 μg/ml 를처리하고 24 시간동안배양한후세포자멸에미치는효과를관찰하였다. Cell death detection ELISA kit 를이용하여 405 nm 파장에서흡광도를측정하였다. PA 를처리한세포주에서세포자멸이유의하게늘어남을볼수있었고, SHT, DHT 추출물을투여한경우는모두농도의존적으로세포자멸이증가하는것을확인하였다 (Figure 3. A,B). 4. SHT, DHT 추출물이 apoptosis 에미치는영향 (FACS) PA 300 μm, SHT, DHT 추출물 0, 150, 300 μ g/ml 를처리한 HepG2 세포주를 PBS buffer 로씻 control PA300μM A PA+SHT150μg/ml PA+SHT300μg/ml control PA300μM B PA+DHT150μg/ml PA+DHT300μg/ml Fig. 3. SHT, DHT Extract Induced Apoptosis in HepG2 Cells. Apoptotic cells were detected by cell death detection ELISA kit(a)(b). Bar gragh shows relative gradient of apoptosis in SHT, DHT-treated groups compared to PA-treated group. Statistical significance was determined by one-way ANOVA test, # p<0.05, ## p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to PA-treated group. Fig. 4. FACS Histograms of Apoptosis Assays by Annexin V-FITC/PI Staining Method in HepG2 Cells. HepG2 cells were treated with 300 μm of PA and 0, 150, 300 μg/ml of SHT, DHT extract for 24 hours. The sums of proportion of early and late stage apoptotic cells are represented on each graph. 68
8 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (69) 어내고 binding buffer 로재침전시킨뒤, FITC 결합 Annexin-V 와 PI 5 μl 로염색하여, 실온의어두운환경에서 5-15 분가량배양하고, FACS Calibur 를이용하여세포수를비교하여분석하였다. 조기세포사멸단계 (UR) 와후기세포사멸단계 (LR) 의세포수비율의합을구하여약물이 apoptosis 에미치는영향을평가하였다. SHT 추출물투여군에선 300 μg/ml 농도에서세포자멸이급격히증가하는결과를보였고 (Figure 4. A), DHT 추출물투여군에선농도의존적으로세포자멸이증가하는것으로나타났다 (Figure 4. B). 5. SHT, DHT 추출물이 Caspase-3 에미치는영향 (Western Blotting) SHT, DHT 추출물이지방축적을유도한 HepG2 세포주의세포자멸에어떠한영향을주는지확실히알아보기위하여, cleaved Caspase-3 에대한 Western Blotting 을진행하였다. SHT, DHT 추출물을처리하였을때농도의존적으로 cleaved Caspase-3 의발현이증가하였다 (Figure 5. A, B). HepG2 세포주에 PA 와 SHT, DHT 추출물을처리하고 24 시간이지난후 mrna 발현의변화를확인하였다. TGF-β1 mrna 발현은 SHT, DHT 추출물투여군에서모두유의한증가를보였다 (Figure 6. A). LXR-α mrna 의경우 SHT 추출물 300 μg/ml 투여군에서유의한발현량감소를보였으며, 다른실험군에선유의한변화가관찰되지않았다 (Figure 6. B). ChREBP mrna 는 SHT 추출물 150, 300 μg/ml, DHT 추출물 300 μg/ml 투여군에서유의한발현의감소가관찰되었다 (Figure 6. C). ACC1 mrna 발현은일부 PA 300 μm 투여군에서증가가관찰되었다. SHT, DHT 추출물투여군에서는특별한변화를발견할수없었다 (Figure 6. D). SCD1 mrna 는 PA 300 μm 투여군에서상대적인발현량증가가있었고, SHT 추출물 300 μg/ml 투여군에서발현량이유의하게감소하였다. DHT 추출물은 150 μg/ml 를처리하였을때유의하게 SCD1 mrna 발현량이증가하였다가 300 μg/ml 를투여한경우는다시감소하는경향을보였다 (Figure 6. E). 7. SHT, DHT 추출물이세포지방축적에미치는영향 Fig. 5. The Cleaved Form of Caspase-3 Expression Level. SHT, DHT extract both showed concentration dependent increase of expression level of caspase SHT, DHT 추출물이 lipogenesis 관련 mrna(tgf-β1, LXR-α, ChREBP, ACC1, SCD1) 에미치는영향 SHT 와 DHT 의간세포내지방축적감소효과를확인하기위하여 HepG2 cell 에 PA 300 μm 을처리한후, SHT, DHT 추출물을각각 150, 300 μg/ml 처리하였다. Oil Red O staining 을통해 PA 가 HepG2 cell 의지방축적을유도한것을확인할수있었으며, 이렇게발생한지방은 SHT, DHT 추출물을함께처리한경우농도의존적으로감소하였다 (Figure 7. A, B). 앞선결과와종합해보면, SHT, DHT 추출물이세포의활성은저해하지않지만지방증을감소시키는효과가있음을추측할수있다. 69
9 (70) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) Fig. 6. TGF-β1, LXR-α, ChREBP, ACC1, SCD1 mrna Expression Level. HepG2 cells were treated with 300 μm of PA and 0, 150, 300 μg/ml of SHT, DHT extract for 24 hours. Relative mrna levels of TGF-β1(A), LXR-α(B), ChREBP(C), ACC1(D), SCD1(E) are represented on each bar graph. Statistical significance was determined by one-way ANOVA test.also Bonferroni s test and Student's t-test were used to compare each set of data, # p<0.05, ## p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to PA-treated group. 70
10 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (71) Fig. 7. Oil Red O staining of HepG2 Cells. PA 300 μm for 24 h induced lipid accumulation in HepG2 cells. The cells were stained with Oil Red O and observed by microscope( 200): Control group cells were treated with only 1% BSA. Lipid accumulation was decreased in PA+SHT 150 μg/ml group, and the least lipid accumulation was observed in PA+SHT 300 μg/ml group(a). Also, lipid accumulation was lowered in PA+DHT 150 μg/ml group, and the least lipid accumulation is detected in PA+DHT 300 μg/ml group(b). 고찰및결론비알코올성지방간질환 (Non-alcoholic fatty liver disease, NAFLD) 은습관적인알코올남용이없는환자에게서알코올성간질환과유사한간의조직학적손상이나타나는질환으로, 고혈압과고지혈증, 인슐린저항성이나비만등과같은대사질환과연관되어흔히발생한다 18). 최근다양한대사증후군의발생이증가하면서 NAFLD 의유병률도늘어나고있는데, 앞으로는만성간질환의가장중요한원인으로 NAFLD 가지목될가능성이높다 19). 특히인슐린저항성은초기 NAFLD 에서관찰되는주된병리적변화로 20), 비만이나인슐린저항성이있는환자의경우혈중유리지방산농도가증가하여간으로의유리지방산유입이많아지게된다 21). 또한혈중인슐린농도가늘어나간내의 lipogenic gene 들의발현이증가하게되고, 지방산합성이많이이루어진다 22). 결과적으로간지방증은지방산이간으로유입되거나간내의지방산합성이늘어나발생한다고볼수있다. 따라서약물의지방간치료효과를확인하기위해선, 실험과정에서실제지방세포축적의변화를보고, 지방산합성과관련된 gene 들의발현정도를비교하는것이중요하다. 기존연구에서삼황사심탕은비만을유도한동물모델의실험에서대사질환치료에효과가있다는것이보고되었으며 13), 비만으로늘어난체중과간중량, 혈중콜레스테롤등을유의하게감소시키는결과를보였다 23). 대황황련사심탕의구성약재인대황, 황련, 황금역시동물실험에서항고지혈효과가있다고보고되어있다 15). 특히황련과대황의경우는일부동물실험에서체중증가를억제하는결과가보고되었는데 24), 이는대사질환과깊은연관성이있는지방간에도위약물들이응용될가능성이높다는것을말한다. 본연구에서는이전의연구들을바탕으로삼황사심탕과대황황련사심탕이지방축적을억제하는효능이있을것으로생각하고, 그기전을밝히기위해적합한세포모델을설정하여실험을진행하였다. 삼황사심탕은 東醫寶鑑 의처방구성을참고하였고, 대황황련사심탕은 金匱要略 의처방구성을바탕으로실험을진행하였다. HepG2 cell 에 Palmitic acid 를처리하여지방축적을유도하고, 약물이어떤기전으로영향을주는지확인하기위하여삼황사심탕과대황황련사심탕의물추출물을 , 300 μ 71
11 (72) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) g/ml 의농도로처리하여 24 시간배양하고관찰하였다. 세포모델에대한효과를보기위하여 MTT assay, Real-time PCR, ELISA, FACS, Western Blotting, Oil Red O staining 등을시행하였다. Cell viability(mtt assay) 의결과에서 PA 투여는 HepG2 cell 의세포활성을감소시키고, 삼황사심탕과대황황련사심탕은각각단독으로투여하면세포활성을증가시킴을확인할수있었다. PA 와한약재를같이투여하면 PA 만투여하였을때보다도세포활성이증가하는경향을보였으나유의성은인정되지않았다. 다음으로, 한약추출물이지방세포의형성과자멸에어떤영향을주는지관찰하기위해 apoptosis 와 lipogenesis 관련 gene 들을대상으로 Real-time PCR 을진행하였다. Anti-apoptotic family 인 Bcl-2 와 pro-apoptotic 작용을하는 Bax 25) 두가지 mrna 의발현을관찰한결과, 삼황사심탕추출물투여군에서 Bcl-2, Bax 의발현이모두감소되는것으로나타나서유전자발현과관련된경향을확인하기어려웠다. 대황황련사심탕추출물투여군에서는유의한결과가나타나지않았다. Survivin 은세포자멸을유도하는 Caspase-3 와결합하여그활성화를방해하는단백질이다 26). 삼황사심탕과대황황련사심탕추출물투여군에서모두 Survivin 을유의하게감소시키는결과가나타났다. 또한 Cycline dependent 인산화효소의활성억제단백질인 P21 은세포주기를 G1 단계에서멈추게하여세포자멸을유도하는역할을하는데 27), 실험결과삼황사심탕과대황황련사심탕추출물투여군둘다농도의존적으로 P21 이증가함을알수있었다. 세포자멸과관련하여진행한 ELISA 및 FACS 의결과에서는, 전체적으로약물이세포자멸을유도하는방향으로결과가나타났다. ELISA 의경우, SHT, DHT 추출물투여군모두에서농도의존적으로세포자멸이증가하는것을확인하였고, FACS 에서도 SHT 추출물 300 μg/ml, DHT 추출물 150, 300 μg/ml 투여군에서세포자멸이증가하는것으로나타났다. Western blotting 으로확인한 cleaved caspase-3 28) 역시 SHT, DHT 추출물을투여했을때증가하는것으로나타났다. 이상의결과에서, PA 와한약재를동시에투여하면 apoptosis 관련유전자및단백질의발현이 PA 단독처리에비하여유의성있게증가하는것으로나타나는데, MTT assay 를통해서관찰되는세포활성이 control 군에비하여감소되지않게나타나는것은삼황사심탕과대황황련사심탕이정상세포는활성화시키면서도지방이축적된세포에대해서는세포자멸을유도하는양면적인효과를발휘하는것으로추정할수있다. 다음으로는지방전구세포의분화를막고지방축적에관여하는주요 enzyme 들을억제하는효과 29) 에주목해약물처리후의변화를확인하였다. TGFβ1 은세포내에서다양한조절역할을하는단백질로 30), 삼황사심탕과대황황련사심탕추출물투여군에서모두 TGF-β1 mrna 발현량의유의한증가가나타났다. 특히 300 μg/ml 투여시에는현저한증가를보였다. LXR-α 는인슐린에반응하여지방산을만들어내는 nuclear hormone receptor 로, ChREBP 를타겟으로 ACC1, SCD1 과같은지방산합성유전자에작용하여지방축적과정에관여한다 31). 삼황사심탕추출물투여군에서 LXR-α mrna 가유의하게감소되었고, 대황황련사심탕추출물투여군에서는약간의증가가있었지만유의성은인정되지않았다. Glucose 에의해발현되는 liver transcription factor 인 ChREBP 는 LXR 의독립적인타겟으로, 다양한지방합성유전자들을유도한다 32). 실험결과삼황사심탕, 대황황련사심탕추출물투여군에서모두유의한감소를보였고, 농도의존적으로 ChREBP mrna 의발현을억제하였다. ACC1 와 SCD1 는주요 lipogenic enzyme 들로, 활성화되면지방산과중성지방합성에관여한다 33). ACC1 은약물투여군에서유의한변화가관찰되지않았지만, SCD1 은삼황사심탕추출물 300 μg/ml 투여군에서발현량이유의하게감소하였다. 대황황 72
12 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (73) Table 1. Primer Sequences for PCR. Genes Primer sequence Size (bp) Bcl-2 Bax Survivin P21 TGF-β1 LXR-α ChREBP ACC1 SCD1 β-actin 5 -GATTGATGGGATCGTTGCCTTA-3 5 -CCTTGGCATGAGATGCAGGA-3 5 -GGATGCGTCCACCAAGAAG-3 5 -GCCTTGAGCACCAGTTTGC-3 5 -GGCCCAGTGTTTCTTCTGCTT-3 5 -GCAACCGGACGAATGCTTT-3 5 -CAGACCAGCATGACAGATTTC-3 5 -TTAGGGCTTCCTCTTGGAGA-3 5 -TGAACCGGCCTTTCCTGCTTCTCATG-3 5 -GCGGAAGTCAATGTACAGCTGCCGC-3 5 -GCCGAGTTTGCCTTGCTCA-3 5 -TCCGGAGGCTCACCAGTTTC CAGCTGCGGGATGAGATTGA-3 5 -AAACGCTGGTGTGTGATGGGTA-3 5 -AGTGAGGATGGCAGCTCTGGA-3 5 -TGAGATGTGGGCAGCATGAAC-3 5' CCGGGAGAATATCCTGGTTT 3' 5' GCGGTACTCACTGGCAGAGT 3' 5 -GCGAGAAGATGACCCAGATC-3 5 -GGATAGCACAGCCTGGATAG 련사심탕을 150 μg/ml 처리하였을때 SCD1 발현량의유의한증가가보이나, 300 μg/ml 투여군의경우는다시감소하는경향을보였다. 이상 lipogenesis 와관련된 real-time PCR 결과를종합해보면, 삼황사심탕추출물은 ACC1 을제외한다른 mrna 발현을농도의존적으로억제하였고, 대황황련사심탕추출물역시 TGF-β1, ChREBP 의발현을억제하는것으로확인되었다. 삼황사심탕과대황황련사심탕이지방합성에관여하는인자들은억제하고, 지방세포분화를막는 TGF-β1 은늘리는것으로보아, 간세포의지방변성을막고지방축적을억제하는효과가있다고사료된다. 이러한분자생물학적기전이세포모델의지방축적을실제로어떻게변화시키는지관찰하기위해 Oil Red O staining 을시행하였다. 삼황사심탕, 대황황련사심탕을처리한두군에서모두붉은색으로염색된지방축적이감소되는것으로나타났으며, 이는한약재처리가 LXR-α 와 ChREBP 의유전자 활성을감소시켜 PA 로인한세포내의지방산합성을억제하였기때문인것으로사료된다. 따라서삼황사심탕과대황황련사심탕은지방축적이일어난세포의세포자멸을유도하고, 간세포의지방축적과관련된신호전달과정을막아간지방증의치료에활용될수있을것으로기대된다. 하지만두약물모두간보호효과에서미흡한결과가보여, 기타간손상이나염증으로진행된질환에대해서는추가적인연구가이루어져야할것으로보인다. 또한기존의동물실험에서밝혀진중성지방억제효능을확실히검증하기위하여, 본약물의 total cholesterol, triglyceride 억제기전을좀더심도있게연구하는과정이필요할것이다. 참고문헌 1. Bellentani S, Bedogni G, Miglioli L, Tiribelli C. The epidemiology of fatty liver. European 73
13 (74) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) journal of gastroenterology & hepatology, 2004: 16(11): Marchesini G, Brizi M, Morselli-Labate AM, Bianchi G, Bugianesi E, McCullough AJ, et al. Association of nonalcoholic fatty liver disease with insulin resistance. The American journal of medicine. 1999:107(5): Chalasani N, Younossi Z, Lavine JE. Diehl A M, Brunt EM, Cusi K, et al. The diagnosis and management of non alcoholic fatty liver disease: Practice Guideline by the American Association for the Study of Liver Diseases, American College of Gastroenterology, and the American Gastroenterological Association. Hepatology. 2012:55(6): Anstee QM, Day CP. The Genetics of Nonalcoholic Fatty Liver Disease: Spotlight on PNPLA3 and TM6SF2. In Seminars in liver disease. 2015:35(3): Angulo P. GI epidemiology: nonalcoholic fatty liver disease. Alimentary pharmacology & therapeutics. 2007:25(8): Ministry of Food and Drug Safety. Influence of dietary intake on non-alcoholic fatty liver disease in Koean.Cheongwon, Korea: Ministry of Food and Drug Safety Jang E, Shin MH, Kim KS, Kim Y, Na YC, Woo HJ. Anti-lipoapoptotic effect of Artemisia capillaris extract on free fatty acids-induced HepG2 cells. BMC complementary and alternative medicine. 2014:14(1): Browning JD, Horton JD. Molecular mediators of hepatic steatosis and liver injury. Journal of Clinical Investigation. 2004:114(2): Park SH. Nonalcoholic fatty liver disease: treatment. Korean Journal of Medicine. 2010: 79(5): Han CW, Lee JH. Effects of KHchunggan -tang on the nonalcoholic fatty liver disease in palmitate-induced cellular model. J Korean Oriental Med. 2011:32(1): Kim SY, Kwon JN, Lee I, Hong JW, Choi JY, Park SH, et al. Research on Anti-lipogenic Effect and Underlying Mechanism of Laminaria japonica on Experimental Cellular Model of Non-alcoholic Fatty Liver Disease. The Journal of Korean Oriental Internal Medicine. 2014: 35(2): Choi MY, Woo HJ, Kim YC, Lee JH. Effects of Gamisaenggan-tang on High Fat Diet-induced Nonalcoholic Fatty Liver Disease. Korean J. Orient. Int. Med. 2009:30(2): Lee JY, Yoon BK. Effects of Samhwangsasim -tang on obesity-related metabolic diseaseinmice. Dept. of Korean Medicine. 2014:22(1): Yoon HJ, Park YS. Effects of Scutellariabaicalensis water extract on lipid metabolism and antioxidant defense system in rats fed high fat diet. Journal of The Korean Society of Food Science and Nutrition Ro HS, Ko WK, Kim OJ, Park KK, Cho YW, Park HS. Antihyperlipidemic Activity of Scutellarisbaicalensis Georg., Coptidis japonica Makino and RheikoreanumNakai on Experimental Hyperlipidemia in Rats. Journal of Pharmaceutical Investigation. 1996:26(3): Choi SE, Jung IR, Lee YJ, Lee SJ, Lee JH, Kim Y, et al. Stimulation of lipogenesis as well as fatty acid oxidation protects against palmitate-induced INS-1 β-cell death. Endocrinology. 2011:152(3): Ramirez-Zacarias JL, Castro-Munozledo F, Kuri-Harcuch W. Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with Oil Red O. Histochemistry. 1992:97(6):
14 엄은식외 1 명 : Palmitic acid 로지방축적을유도한 HepG2 cell 에대한삼황사심탕과대황황련사심탕의효과연구 (75) 18. Samuel VT, Liu ZX, Qu X, Elder BD, Bilz S, Befroy D, et al. Mechanism of hepatic insulin resistance in non-alcoholic fatty liver disease. Journal of Biological Chemistry. 2004:279(31): Park SH, Jeon WK, Kim SH, Kim HJ, Park D I, Cho YK. Prevalence and risk factors of nonalcoholic fatty liver disease among Korean adults. Journal of gastroenterology and hepatology. 2006:21(1): Marra F, Gastaldelli A, Baroni GS, Tell G, Tiribelli C. Molecular basis and mechanisms of progression of non-alcoholic steatohepatitis. Trends in molecular medicine. 2008:14(2): Wahren J, Sato Y, Ostman J, Hagenfeldt L, Felig P. Turnover and splanchnic metabolism of free fatty acids and ketones in insulin-dependent diabetics at rest and in response to exercise. Journal of Clinical Investigation. 1984:73(5): Chen G, Liang G, Ou J, Goldstein JL, Brown MS. Central role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver. Proceedings of the National Academy of Sciences of the United States of America. 2004:101(31): Chung MH, Han SJ. Effect of composite preparation of crude drugs on experimentally induced hyperlipemia in rats-sam WhangSasim Tang and Whang Ryun Haedok Tang. Korean Journal of Pharmacognosy (Korea Republic). 1996:7(2): Oh MG, Song YS. Influence of RhizomaRhei water extract on the obese mouse model. J Oriental Rehab Med. 1997:7(2): Oltval ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programed cell death.cell. 1993:74(4): Tamm I, Wang Y, Sausville ED, Scudiero DA, Vigna N, Oltersdorf T, et al. IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs.cancer research. 1998:58(23): Levkau B, Koyama H, Raines EW, Clurman B E, Herren B, Orth K, et al. Cleavage of p21 Cip1/Waf1 and p27 Kip1 mediates apoptosis in endothelial cells through activation of Cdk2: role of a caspase cascade. Molecular cell. 1998: 1(4): Porter AG, Jänicke RU. Emerging roles of caspase-3 in apoptosis. Cell death and differentiation. 1996:6(2): Petruschke TH, Röhrig K, Hauner H. Transforming growth factor beta (TGF-beta) inhibits the differentiation of human adipocyte precursor cells in primary culture. International journal of obesity and related metabolic disorders: journal of the International Association for the Study of Obesity. 1994:18(8): Nam IK, Yoo J. Downregulation of SGK1 Expression is Critical for TGF-β-induced Apoptosis in Mouse Hepatocytes Cells. Journal of life science. 2012:22(11): Cha JY, Repa JJ. The liver X receptor (LXR) and hepatic lipogenesis The carbohydrate -response element-binding protein is a target gene of LXR. Journal of Biological Chemistry. 2007:282(1): Berlanga A, Guiu-Jurado E, Porras JA, Auguet T. Molecular pathways in non-alcoholic fatty liver disease. Clinical and experimental gastroenterology. 2014:7: Repa JJ, Liang G, Ou J, Bashmakov Y, 75
15 (76) 대한한의학회지제 37 권제 1 호 (2016 년 3 월 ) Lobaccaro JMA, Shimomura I. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRα and LXRβ. Genes & development. 2000: 14(22):
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More informationPierce-Plus-Alpha.pdf
Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationNo Slide Title
Antioxidant effect of Estrogen on Bovine aortic endothelial cells 가톨릭대학교의과대학서울성모병원산부인과김미란 Journal of Steroid Biochemistry and Molecular Biology 117 (2009) 74-80 Background Objectives Materials & Methods
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationMay 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr
May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information歯14.양돈규.hwp
: The Korean Journal of Counseling and Psychotherapy 2003. Vol. 15, No. 3, 615-631. 1 2 3 1,410.,, ( ),., ( 69%),.,, ( ), ( ).,,.., ( ).,. :,,. :, (390-711) 21-1, : 043-649-1362 E-mail : ydk9498@hanmail.net
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information-
World Top 10 by 2030 CONTENTS CONTENTS 02 03 PRESIDENT S MESSAGE 04 05 VISION GOALS VISION GOALS STRATEGIES 06 07 HISTORY 2007 2008 2009 2010 2011 08 09 UNIST POWER 10 11 MPI USTC UNIST UCI UTD U-M GT
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More information077~088 해계 유침과 전침이
loperamide 77 DOI : 10.3831/KPI.2009.12.4.077 loperamide Received : 09. 10. 21 Accepted : 09. 11. 04 The Effect of Acupuncture and Electro-acupuncture at ST41 on Intestinal Hypomotility Induced with Loperamide
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationePapyrus PDF Document
2008 년대한간학회학술연구기금당선과제발표 복부비만을가진한국인의내장지방세포에서 Adipokine 발현이비알코올지방간질환의진행정도에미치는영향 성균관대학교의과대학강북삼성병원내과 The effects of Adipokine expression in visceral fat tissue on Nonalcoholic liver disease progression in
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
More information化學科
Department of Life Sciences 1 2 3 학과명 전공분야 생명과학세미나 1, 2 생명과학세미나 3, 4 생명과학최신동향 1, 2 과목명학점 ( 시간 ) 코드이수구분 각 1(1) 각 1(1) 각 1(1) LIS901, 902 LIS903, 904 LIS911, 912 기초공통기초공통기초공통 생명과학과 생화학 생화학 1, 2( 영강 ) 고급생화학
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information<B0E6C8F1B4EBB3BBB0FAC0D3BBF3B0ADC1C E687770>
개원의와함께하는임상강좌 2011 역류성식도질환제대로이해하기 Division of Gastroenterology, Department of Internal Medicine, Kyung Hee University College of Medicine, Seoul, Korea Jae-Young Jang, M.D., PhD. 개원의와함께하는임상강좌 2011 109 최신치료
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More information분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김
목 분 기 보 고 서...1 대표이사 등의 확인...2 I. 회사의 개요...3 1. 회사의 개요...3 2. 회사의 연혁...4 3. 자본금 변동사항...7 4. 주식의 총수 등...9 5. 의결권 현황...10 6. 배당에 관한 사항 등...10 II. 사업의 내용...12 III. 재무에 관한 사항...30 IV. 감사인의 감사의견 등...34 V. 이사의
More information당뇨병 치료제 개발 연구 (무병장수를 위한 신약개발연구) Jin Hee Ahn 2008. 09. 26 한국화학연구원 KBS YTN TJB MBC 대덕 특구 기술 사업화 연구원부문 대상 2007년 12월 14일 당뇨병 치료제 개발 연구 (무병장수를 위한 신약개발연구) 생체기능조절물질개발사업단 신약연구단 화학연구원 신약연구단 글로벌 신약 글로벌 신약 전임상 후보물질의
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information