42(2)-9(p ).fm
|
|
- 보나 교
- 6 years ago
- Views:
Transcription
1 The Krean Jurnal f Micrbilgy, Vl. 42, N. 2, June 2006, p Cpyright 2006, The Micrbilgical Sciety f Krea Bacillus amylliquefaciens MJ-1 chitsanase j p 1 *Á w 1 *Áy Ÿ 2 Á 3 Áx 1 **Á ** w w w œ l w w p w y ƒ š chitsan ligsaccharides z w» w», m z t chitsan w w ³ w. w ³ xkw, yw w w w, Bacillus amylliquefaciens MJ-1 w. B. amylliquefaciens MJ-1 l chitsanase sww 1,049 bp DNA r j w, chitsanase 825» 274 š, 30.9 kda. j w chitsanase hmlgy search, glucside hydrlase family 46 w chitsanase. B. amylliquefaciens MJ-1 chitsanase E. cli BLR (DE3) w, 1 mm IPTG chitsanase x wš w z, ph w p w. z y 60 C, 80 C 75% y ùkü ü ƒ z. wr, ph 5.0, ph 5~7 80% y w. Key wrds ý Bacillus amylliquefaciens MJ-1, chitsanase, gene expressin Chitsan q, š w Ë w chitin k py, chitsan w chitsan ligsaccharides ü, w³z, w z, x g l w, w y ƒ š» t,» t, y t w š (4, 7, 12, 20, 21). Chitsan ligsaccharides w chitsan - e ww yw chitsanase w z. yw w œ w s w y j», chitsanase w w z l w chitsanase w z w š (5, 14). ¾ l w chitsanaseƒ š(3, 8, 10, 15, 22, 24, 25), j (6, 9, 16, 26), z chitsan» w chitsan ligsaccharides w. chitsanase 10~50 kda j»ƒ w, ph 4.0~8.0, 30~60 C š š (8, 10, 12, 22, 25). *These authrs cntributed equally t this wrk **T whm crrespndence shuld be addressed. Dae-Kyung Kang (Tel: , Fax: , dkkang@dankk.ac.kr) Yung Hyun (Tel: , Fax: , yhyun@eddram.net) chitsan ligsaccharides ww chitsanase w» w», m z t l chitsan w Bacillus sp. MJ-1 w š, chitsanase j w p w. w, j w chitsanase ³ x k z, w ph p w. Chitsan w³ Chitsan w ƒ w» w m, š, Ë,, w l w. xk, g, 0.5% cllidal chitsan w sq (0.05% MgSO 4 Á7H 2 O, 0.03% KH 2 PO 4, 0.07% K 2 HPO 4, 0.001% FeSO 4, % ZnSO 4, % MnCl 2, 1.5% agar, ph 7.0) w z 30 C 37 C ƒƒ w. 3-5 z n y x w g chitsan w ³, w z ³ w. Cllidal chitsan Cllidal chitsan Yabuki (24) xw w. Chitsan (Sigma, USA) 20 g 2 l 2% acetic acid ƒw 6 chitsan 142
2 Vl. 42, N. 2 Bacillus amylliquefaciens MJ-1 chitsanase 143 z, 8 l ƒwš w w. 5 N NaOH w ph 5.0¾ w z, ph 9.0¾ 0.1 N NaOH w w cllidal chitsan x g. g xk» w w» w w. cllidal chitsan d»(kett Electric Lab., Japan) w w d w z w. w ³ w ³ w» w 16S rdna xkw, yw p ww. ³ 16S rdna w» w Pavlva (17) w. Genmic DNA extractin kit (Qiagen) w ³ l genmic DNA w, Table 1 primer w plymerase chain reactin (PCR) ww. 50 pmle primer, 50 ng template DNA, 10 Taq DNA plymerase buffer 5 µl, 2.5 mm dntp mixture 4 µl, Taq DNA plymerase (TaKaRa-Krea, Krea) 1 Uƒ sw PCR mixture 95 C 5 k z 95 C 1, 55~60 C 1, 72 C 1 30 cycle w PCR ww. PCR pstblue-1 (Nvagen, USA) j w, BigDye TM -terminatr sequencing kit ABI PRISM377 sequencer (Perkin-Elmer, USA)» w. w ³ xkw p x (Scanning Electrn Micrscpy) w, Shn (19) w. w, API 50CHB kit (bimerieux C, France) w 49 k w w w. Chitsanase j w ³ l genmic DNA w z,» š chitsanase z w cnserved regin šw primer (CSB-1 : 5'-CTT RTT TTC ACC ATG TTT TT-3', CSB-2 : 5'-ACR TGA ATC GGY CCG TTT A-3')w,» w PCR ww. PCR 1% agarse gel (TAE buffer) w 100V 40» ww w, QIA quick gel extractin kit (QIAGEN) w agarse gel l DNA r Table 1. Olignucletide primers fr amplificatin f 16S rdna Primer 1) Sequence (5-3 ) Target site 2) F1 AGAGTTTGATCCTGGCTCAG 27 F2 GTGCCAGCAGCCGCGG 530 F3 AAACTCAAAGGAATTGACGG 926 R1 TCTACGCATTCCACCGCTAC 685 R2 GGGTTGCGCTCGTTG 1,100 R3 AAGGAGGTGATCCAGCC 1,525 1) F1, F2 and F3: frward primers; R1, R2 and R3: reverse primers. 2) Accrding t the numbering f the Escherichia cli 16S rdna. w. w DNA r pgem-t easy vectr j w z, DNA» ww. Chitsanase full sequence» w DNA walking speedup premix kit (Seegene, Krea) w. DNA walking kit w» chitsanase» 5' 3' w sw pgem-t vectr ƒƒ j w. ƒ j DNA» w chitsanase full sequence y w,» GenBank w (GenBank accessin number DQ683023).»»» g w, GenBank database (Natinal Center fr Bitechnlgy Infrmatin, USA) BLAST algrithm w» w. multiple sequence alignment Clustal W v w w. Recmbinant chitsanase x j w chitsanase E. cli x j» w N- His-tag pet21b x l w. Frward (ME-1 : 5'-AAA GGA TCC GAT GAA GGC AAA AGT AGA TTC-3') reverse (ME-2 : 5'-AAA ACT CGA GCT TGA TTA CGA AAT CAC-3') primer w PCR ww, PCR r pet21b l w z (BamHI / XhI) w z x l j w. E. cli BLR (DE3) w z, x y ³ w. x y ³ ampicillin 50 µg/ml ƒ w Luria-Bertani (LB) O.D.(600 nm) 0.5 ¾ w z, IPTG (isprpyl-β-d-thi-galactpyranside) 1mM ƒw x w. 37 C 5 w z s yw. x w» w, cell pellet lysis buffer (50 mm Na-Pi (ph 7.0), 300 mm NaCl, 1 mm DTT) xkw z lyszyme (1 mg/ml) ƒw. Snicatr (Snics & Materials, Inc) s q w, 14,000rpm 30 w w. Ni 2+ -NTA affinity clumn (Qiagen) ladingwš 50 mm imidazle buffer w z 250 mm imidazle buffer w, 10% SDS-PAGE mw w x y w (11). w chitsanase y d» w cllidal chitsan» w w chitsanase z chitsan w d w. 1% cllidal chitsan 250 µl, 1 M ptassium phsphate (ph 6.5) 50 µl, z 1 ml 37 C w. 30 k z, 100 C 10 ƒ w g.
3 144 Chan-S Park et al. Kr. J. Micrbil (13,000 rpm, 10분)하였으며, 상등액에 존재하는 환원당을 DNS (dinitrsalicylic acid)법(13)으로 정량하여 효소 활성을 측정하였 다. Chitsanase 활성단위(unit)는 상기 서술한 조건에서 분당 1 µmle의 환원당(D-glucsamine)을 생성하는 효소의 양으로 정의 하였다. 재조합 의 최적 온도 및 chitsanase ph 효소 반응의 최적 온도를 조사하기 위해, 50 mm ptassium phsphate 완충용액(pH 6.5)에서 1% cllidal chitsan 용액을 기질로 사용하여 20 C에서 80 C까지 10 C 구간별로 반응시킨 후, 상기 서술한 효소활성 측정법으로 효소 활성을 비교하였다. 효소의 최적 ph를 조사하기 위해서는, 정제된 효소액을 아래의 각 ph 별 완충용액에 넣고 반응시킨 후, 활성을 비교하였다. 사 용한 완충용액으로서, ph 사이는 50 mm glycine-hcl buffer, ph 5.0~6.0 사이는 50 mm sdium acetate buffer, ph 7.0~8.0 사이는 50 mm ptassium phsphate buffer, ph 9.0~ 10.0 사이는 50 mm Tris-HCl buffer, ph 11.0~12.0 사이는 50 mm glycine-naoh buffer를 각각 사용하였다. 재조합 Scanning electrn micrscpy (SEM) micrgraph ( 15,000) f B. amylliquefaciens MJ-1. Fig. 1. DNA walking kit (Seegene, Krea)을 이용하여 chitsanase 유전 자의 전체 염기서열을 클로닝하였다(Fig. 2). 클로닝한 chitsanase 유전자의 크기는 825 bp로서 274 개의 아미노산으로 구성되어 의 온도 및 안정성 chitsanase ph 효소의 온도 안정성을 검토하기 위해, 50 mm ptassium phsphate buffer (ph 6.5)에 효소액을 첨가하여 20 C에서 80 C 까지의 각 온도에서 30분간 처리한 후, 효소의 잔존 활성을 측 정하였다. 효소의 ph 안정성을 조사하기 위해서는, ph 2.0에서 ph 12.0까지의 각 완충액에 정제된 효소액을 첨가하여 4 C에서 24시간동안 보관한 후, 잔존 활성을 측정하였다. 결과 및 고찰 Chitsan 분해균주의 분리 및 동정 전통 발효식품인 메주로부터 chitsan 분해능이 우수한 미생물 인 MJ-1 균주를 분리하였다. 전자현미경(XL30-CP, Philips)으로 관찰한 결과 (Fig. 1), Gram 양성의 간균이었으며 포자를 형성하 였다. 또한, 호기성이고 catalase test에서는 양성으로 나타나 Bacillus 속의 세균으로 추정할 수 있었다. 분리한 MJ-1 균주를 보다 정확하게 동정하기 위하여 API 50CHB kit (bimerieux C, France)를 이용하여 49개의 탄소원에 대한 이용성을 조사한 결과, 98.9%의 확률로 Bacillus amylliquefaciens와 일치하였다 (Table 2). 또한, 16S rdna 서열을 분석한 결과에서도 Bacillus amylliquefaciens와 99% 일치하였으므로 (data nt shwn), 본 균주를 B. amylliquefaciens MJ-1으로 명명하였다. B. amylliquefaciens 의 클로닝 MJ-1 균주로부터 chitsanase 유전자 Chitsanase 유전자 염기서열의 상동성 비교를 통해 얻어진 cnserved regin primer를 이용하여 PCR을 수행한 결과, 636 bp 크기의 키토산 분해효소의 부분 염기서열을 얻을 수 있었다 (data nt shwn). PCR에 의해 얻어진 부분 염기서열을 토대로, Nucletide and deduced amin acid sequences f the chitsanase frm B. amylliquefaciens MJ-1. Cding regin starts at psitin 143 and ends at psitin 967. The putative Shine-Dalgarn (SD) sequences fr ribsme-binding site are underlined. Fig. 2.
4 Vl. 42, N. 2 Bacillus amylliquefaciens MJ-1 chitsanase 145 Table 2. Characteristics f the islated strain, MJ-1 Characteristics Result Characteristics Result Mrphlgical characterizatin Manitl + Shape Rd Srbitl + Gram stain + 1) α Methyl-D-mannside - Mbility + α Methyl-D-glucside + Spre frmatin + N-acetyl glucsamine + Physilgical characterizatin Amygdalin + Catalase + Arbutine + VP-reactin + Esculine + Ph 5.7 agar + Salicine + Utilizatin f prpinate - Cellbise + Utilizatin f citarte + Maltse + Egg-ylk lecthinase - Lactse - Decmpsitin f casein + Melibse - Starch hydrlysis + Sucrse + Carbhydrate degradatin 2) Trehalse + Glycerl + Inuline - Erythritl + Melezitse - D-Arabinse - D-Raffinse - L-Arabinse + Starch - Ribse + Glycgen - D-Xylse - Xylitl - L-Xylse - β Gentibise + Adnitl - D-Turannse - β Metyl-D-xylside - D-Lyxse - Galactse - D-Tagatse - D-Glucse + D-Fucse - D-Fructse + L-Fucse - D-Mannse + D-Arabitl - L-Srbse - L-Arabitl - Rhmnse - Glucnate + Dulcitl - 2-Ke-glucnate - Insitl - 5-Ket-glucnate - + : Psitive result, - : Negative result API 50CHB kit was used. 1) 2), 30.9 kda. w, g 9 bp ribsme-binding site AAGG wš. B. amylliquefaciens MJ-1 chitsanase k d BLASTP,» chitsanase z ùkü (Fig. 3)., Bacillus subtilis chitsanase precusr (18) 87%, Bacillus sp. thermstable chitsanase (26) 68% ùkü š, Streptmyces sp. N174 chitsanase (2) 39%, Bacillus ehimensis EAG1 chitsanase (1) 25% ùkü. p, glycside hydrlase family 46 chitsanase œm ùkù E-[DNQ]-x(8)-Yx(7)-D-x[RD]-[GP]-x-[TS]-x(3)-[AIVFLY]-G-x(5)-D (23) š, w catalytic activity v Glu-22 Asp- 40 (Streptmyces sp. strain N174 chitsanase ) (2), j w B. amylliquefaciens MJ-1 chitsanase glucside hydrlase family 46 w chitsanase. B. amylliquefaciens MJ-1 chitsanase x B. amylliquefaciens MJ-1 l j w chitsanase E. cli BLR (DE3) wš, 1 mm IPTG chitsanase x 10% SDS-PAGE y w (Fig. 4, lane 3). ù, x w chitsanase inclusin bdy ( 80%) ( 20%) z ƒƒ x. w chitsanase w» w x y s q wš, Ni 2+ -NTA clumn ladingw z 50 mm imidazle buffer w, 250 mm imidazle buffer elutinw w chitsanase w. w z 10% SDS-PAGE w, 30 kda
5 146 Chan-S Park et al. Kr. J. Micrbil Fig. 3. Amin acid sequence cmparisn f chitsanases frm B. amylliquefaciens MJ-1 (BAC_MJ-1), B. subtilis 168 (BAC_SUB), Streptmyces sp. N174 (STR_N174) and B. ehimensis EAG1 (BAC_EHI). Sequence alignment was dne using the CLUSTAL W prgram. Identical residues in all sequences are indicated by asterisks. Gaps are indicated by bars. The amin acid residues that seem t be essential fr the chitsanase activity are shwn n a black backgrund (2). chitsanaseƒ y w (Fig. 4, lane 4). Bradfrd w, w z z p w. Ni 2+ -NTA clumn ladingw» z y 0.4 unit/mg, Ni 2+ - NTA clumn z y 120 unit/mg ùkû. w chitsanase ph w p Ni 2+ -NTA clumn w chitsanase 50 mm ptassium phsphate (ph 6.5) 4C 24 n w z, ph w z p w. w chitsanase z y e w» w, 20 C 80 C¾ ƒ z y d w, z y 60 C ùkû (Fig. 5A)., B. subtilis chitsanase(18), Jang (6) Kim (9) šw Bacillus sp. chitsanase Yn (27) šw thermstable chitsanase w. z 80 C 75% z y ùkü. wr, z w» w, 20 C 80 C Fig. 4. SDS-PAGE analysis f chitsanase prtein frm the recmbinant E. cli. Lane 1, prestained prtein marker; Lane 2, E. cli cell lysate befre IPTG inductin; Lane 3, E. cli cell lysate after IPTG inductin; Lane 4, purified chitsanase using Ni 2+ -NTA clumn. ¾ ƒ z 30 wš þ ƒ k z, 37 C z y d w. Fig. 5
6 Vl. 42, N. 2 Bacillus amylliquefaciens MJ-1 chitsanase 147 (A) ùkù, 50 C 30 ¾ z y 90% ù 60 C y, 80 C 30 ew y 50% ¾ w.», Yn (27) šw Bacillus sp. š chitsanase û r ù, Rivas (18) šw B. subtilis chitsanase z, Jang (6) šw B. cereus chitsanase z r., mw y w B. amylliquefaciens MJ-1 chitsanase ü z w. z y e ph w w» w, z ph 2.0~12.0¾ ƒ ƒwš 37 C» k z, z y d w. Fig. 5 (B) ph 5.0 z y ƒ w ùkû, ph 7.0 y w., Kim (9) šw Bacillus sp. chitsanase ph w. wr, ph z w» w, ph 2.0 ph 12.0¾ phƒ Fig. 5. Enzyme prperties f the purified recmbinant chitsanase. (A) temperature effect ( ø ) and thermstability ( ù ), (B) ph effect ( ý ) and ph stability ( þ ). w z ywwš 4 C 24 w z, z y d w. Fig. 5 (B), ph 5 ~7 80% y w. mw y w chitsanase m z t w ³ l w z ü ü p ùkü. z y w, chitsan z» p, z w chitsan ligsaccharide, z y e» w w ƒ w. š x 1. Akiyama, K., T. Fujita, K. Kurshima, T. Sakane, A. Ykta, and R. Takata Purificatin and gene clning f a chitsanase frm Bacillus ehimensis EAG1. J. Bisci. Bieng. 87, Bucher, I., T. Fukamiz, Y. Hnda, G.E. Willick, W.A. Neugebauer, and R. Brzezinski Site-directed mutagenesis f evlutinary cnserved carbxylic amin acids in the chitsanase frm Streptmyces sp. N174 reveals tw residues essential fr catalysis. J. Bil. Chem. 270(52), Chi, Y.J., E.J. Kim, Z. Pia, Y.C. Yun, and Y.C. Shin Purificatin and characterizatin f chitsanase frm Bacillus sp. strain KCTC 0377BP and its applicatin fr the prductin f chitsan ligsaccharides. Appl. Envirn. Micrbil. 70(8), Hiran, S., M. Hayashi, K. Miura, H. Tsuchida, and T. Nishida Chitsan and its derivatives as activatrs f plant tissues and seeds. Plym. Sci. Technl. 88, Hrwitz, S.T., S. Rseman, and H.T. Blunenthal The preparatin f glucsamine ligsaccharide I. separatin. J. Am. Chem. Sc. 79, Jang, H.-K., J.-H. Yi, J.-T. Kim, K.-E. Lee, and S.-G. Chi Purificatin, characterizatin, and gene clning f chitsanase frm Bacillus cereus H-1. Kr. J. Micrbil. Bitechnl. 31(3), The Japanese Sciety fr chitin and chitsan Applicatin f chitin and chitsan. p Kibdang Publisher, Tky, Japan. 8. J, Y.-Y., K.-J. J, Y.-L. Jin, W.-J. Jung, J.-H. Kuk, K.-Y. Kim, T.- H. Kim, and R.-D. Park Characterizatin f endchitsanases-prducing Bacillus cereus P16. J. Micrbil. Bitechnl. 13, Kim, P.-I., T. -H. Kang, K.-J. Chung, I.-S. Kim, and K.-C. Chung Purificatin f a cnstitutive chitsanase prduced by Bacillus sp. MET 1299 with clning and expressin f the gene. FEMS Micrbil. Lett. 240, Kurakake, M., S. Yu, K. Nakagawa, M. Sugihara, and T. Kmaki Prperties f chitsanase frm Bacillus cereus S1. Curr. Micrbil. 40, Laemmli, U.K Cleavage f structural prtein during the assembly f the head f bacteriphage T4. Nature. 227, Matsuda, Y., Y. Idia, T. Shingi, K. Kakutani, T. Nnmura, and H. Tyda In vitr suppressin f mycelial grwth f Fusarium xysprum by extracellular chitsanase f Sphingbacterium multivrum and clning f the chitsanase gene csnsm1. J. Gen. Plant Pathl. 67, Miller, L Use f dinitrsalicylic acid reagent fr determinatin f reducing sugar. Anal. Chem. 31,
7 148 Chan-S Park et al. Kr. J. Micrbil 14. Pantalene, D., M. Yalpani, and M. Scllar Unusual susceptibility f chitsan t enzyme hydrlysis. Carbhydr. Res. 237, Park, R.-D., Y.-Y. J, H.-C. Lee, C.-S. Ch, and D.-H. J Endchitsanase prduced by Bacillus sp. P21 as a ptential surce fr the prductin f chitligsaccharides. Kr. J. Appl. Micrbil. Bitechnl. 26(4), Park, Y.-M., H.-L. Chang, T.-L. Hur, and S.-Y. Ghim Mlecular clning f chitsanase gene and quantitative prductin f chitsan ligmer. Kr. J. Micrbil. Bitechnl. 32(1), Pavlva, S.I., A.O. Kilic, S.S. Kilic, J.-S. S, M.E. Nader-Macias, J.A. Simes, and L. Ta Genetic diversity f vaginal lactbacillus frm wmen in different cuntries based n 16S rrna gene sequences. J. Appl. Micrbil. 92, Rivas, L.A., V. Parr, M. Mren-Paz, and R.P. Mellad The Bacillus subtilis 168 csn gene encdes a chitsanase with similar prperties t a Streptmyces enzyme. Micrbil-SGM. 146, Shn, J. H., J.H. Lee, H.Yi, J. Chun, K.S. Bae, T.Y. Ahn, and S.J. Kim Krdia algicida gen. nv., sp. nv., an algicidal bacterium islated frm red tide. Int. J. Syst. Evl. Micrbil. 54, Smashekar, D., and R. Jseph Chitsanase-prperties and applicatins: a review. Biresurce Technl. 55, Sugan, N., K. Yshida, M. Hashimt, K. Enmt, and S. Hiran Hyperchlestrlemic activity f partially hydrlyzed chitsan. Advances in chitin and chitsan. p In C. J. Brine. P. A. Standfrd and J. P. Zikakis(eds). Elsevier. 22. Tanabe, T., K. Mrinaga, T. Fukamiz, and M. Mitsutmi Nvel chitsanase frm Streptmyces griseus HUT6037. Bisci. Bitechnl. Bichem. 67, Tremblay, H., J. Blanchard, and R. Brzezinski A cmmn mlecular signature unifies the chitsanases belnging t families 46 and 80 f glycside hydrlases. Can. J. Micrbil. 46(10), Yabuki, M., M. Hiran, A. And, T. Fujii, and Y. Amemiya Islatin and characterizatin f a chitsan degrading bacterium and frmatin f chitsanase by the islate. Tech. Bull. Fac. Hrt. Chiba Univ. 39, Yi, J.-H., H.-K. Jang, S.-J. Lee, K.-E. Lee, and S.-E. Chi Purificatin and prperties f chitsanase frm chitinlytic β-prtebacterium KNU3. J. Micrbil. Bitechnl. 14(2), Yn, H.-G., H.-Y. Kim, Y.-H. Lim, H.-K. Kim, D.-H. Shin, B.-S. Hng, and H.-Y, Ch Thermstabe chitsanase frm Bacillus sp. strain CK4: Clning and expressin f the gene and characterizatin f the enzyme. Appl. Envirn. Micrbil. 66(9), Yn, H.-G., H.-Y. Kim, H.-K. Kim, B.-S. Hng, D.-H. Shin, and H.-Y. Ch Thermstable chitsanase frm Bacillus sp. strain CK4: its purificatin, characterizatin, and reactin patterns. Bisci. Bitechnl. Bichem. 65(4), Zhu, X.-F., X.-Y. Wu, and Y. Dai Fermentatin cnditin and prperties f chitsanase frm Acinetbacter sp. C-17. Bisci. Bitechnl. Bichem. 67, (Received May 22, 2006/Accepted June 13, 2006) ABSTRACT : Mlecular Clning and Characterizatin f Chitsanase Gene frm Bacillus amylliquefaciens MJ-1 Chan-S Park 1, Hae-Geun Oh 1, Sn-Kwang Hng 2, Byung Chul Park 3, Yung Hyun 1 *, and Dae-Kyung Kang* (Department f Animal Resurce and Science, Dankk University, Chenan , Krea, 1 Bi-Resurces Institute, EASY BIO System, Inc, Chenan , Krea, 2 Department f Bilgical Sciences, Myngji University, Yngin , Krea, 3 NUTRABIO, Yksam-dng, Seul , Krea) In rder t develp chitsanase fr the prductin f chitsan ligsaccharides, a chitsanase-prducing bacterium was islated frm the traditinal fermented sybean, Meju, and identified as Bacillus amylliquefaciens MJ-1. The clned chitsanase gene, 825 bp in size, encded a single peptide f 274 amin acids with a estimated mlecular mass f 30.9 kda. The deduced amin acid sequence shwed significant hmlgy with micrbial chitsanases. The recmbinant chitsanase was expressed in Escherichia cli upn inductin with isprpyl-d-thigalactpyranside, and purified using Ni 2+ -NTA agarse clumn chrmatgraphy. The maximal activity f the recmbinant chitsamase is at ph 5.0 and 60 C. The recmbinant chitsanase is stable between ph 5.0 and ph 7.0 at 37 C fr 30 min, and mre than 75% f the activity still remain at 80 C fr 30 min incubatin.
42(3)-6(p ).fm
The Krean Jurnal f Micrbilgy, Vl. 42, N. 3, September 2006, p. 216-222 Cpyright 2006, The Micrbilgical Sciety f Krea β-galactsidase ³ p»á ù 2 Á 2 Á Á Áy 3 Á½ * w œw y œw l ƒm w œw œ f β-galactsidase (lactase)
More information45(3)-5(038)p fm
The Krean Jurnal f Micrbilgy, Vl. 45, N. 3, September 2009, p. 257-262 Cpyright 2009, The Micrbilgical Sciety f Krea ³ l Bacillus lichenifrmis WL-12 Cellulase p Á½ Á»y* w t w Bacillus lichenifrmis WL-12
More information42(3)-5(p ).fm
The Krean Jurnal f Micrbilgy, Vl. 42, N. 3, September 2006, p. 210-215 Cpyright 2006, The Micrbilgical Sciety f Krea Dipldia gssypina ATCC10936 ³ w (+)-Jasmnic acid y š yá½ Á½ {* w tœw tœw Dipldia gssypina
More information353-11(07-31).fm
Kr. J. Micrbil. Bitechnl. Vl. 35, N. 3, 226 230(2007) ƒ w ³l Interfern α-1 œ e w ¼ÁÁ½Á 1 Á * ww œw» l, 1 vl Effect f Oxygen Supply n the Prductin f Interfern α-1 by Recmbinant Escherichia cli in Fedbatch
More informationfm
w y wz 9«( 1y) 34~40, 2006 J. f the Krean Sciety fr Envirnmental Analysis V/ w y Áy yá váy * w» ( )», *» w y œw Simultaneus Remval f Dixin and Nitrgen Oxide n V/ Catalyst Jun-Yub Lee, Sung-H Hng, Sung-Pill
More information(2)-06(신순선).fm
Res. Plant Dis. 16(2) : 158-162 (2010) Research in Plant Disease The Krean Sciety f Plant Pathlgy š «³ «Á y 1 Á Á wá * wû w yw, 1 š w Selectin f Bicntrl Agents against Phytphthra Blight f Pepper and Its
More information353-12(07-39).fm
Kr. J. Micrbil. Bitechnl. Vl. 35, N. 3, 203 209(2007) Bacillus subtilis PUL-Al Biplymer yw p 1 Á 2 Á 1,2 * 1 w ww tƒœw, 2 w m y l Physicchemical Prperties f a Biplymer Flcculant Prduced frm Bacillus subtilis
More information( )-103.fm
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 6, pp. 643~647, 2009. DOI:10.4191/KCERS.2009.46.6.643 Densificatin Behavir f C/C Cmpsite Derived frm Cal Tar Pitch with Small Amunt f Idine Additin Kwang Yun
More information(1)-01(정용식).fm
Textile Science and Engineering Vl. 48, N. 1, 2011 ƒ s j p y ky w xá½ Á½» 1 Á w œ w lœw, 1 w» w (2010. 12. 10. /2011. 1. 16. k) Analysis f Stabilizatin and Carbnizatin Behavirs f Ply(acrylnitrile) Fibers
More information< DC1A4C3A5B5BFC7E22E666D>
¼ (Jeong, Jung Chae)*, ý (Kim, Yoon Soo), (Shin, Woo Young), Þ Ñ (Park, Jong Man) ò ý ƒ Ð (Korea Evaluation Institute of Industrial Technology) (Shin, Jae-Heyg) Š æ (Ministry of Knowledge Economy) 1. :
More information6.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 1, pp. 54~59, 2008. Expansin Characteristics f the Hydrated Sdium Silicate Yang Py Kng, H Yen Ch, and Dng S Suhr Department f Materials Science and Engineering,
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information( )-47.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 4, pp. 302~307, 2010. DOI:10.4191/KCERS.2010.47.4.302 Effect f V-dping n Clur and Crystallizatin f Malayaite Pigments In-Dn J and Byung-Ha Lee Department f
More informationƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
More information04.fm
w y wz 9«( 2y) 91~96, 2006 J. f the Krean Sciety fr Envirnmental Analysis üy wƒ w y k p ½» w w œw Adsrptin Prperties f the Activated Carbns fr Remving Harmful Gases in Indr Envirnments In-Ki Kim Department
More information19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information( )-40.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 3, pp. 237~243, 2010. DOI:10.4191/KCERS.2010.47.3.237 Synthesis f Sphene pink Pigment by Rice Husk Ash In-Dn J, Hyun-S Lee, and Byung-Ha Lee Department f Materials
More information10.fm
Jurnal f the Krean Ceramic Sciety Vl., N. 1, pp. 53~57, 2009. Effect f MgB Additin n Synthesis f Hexagnal Brn Nitride Dae-Jin Lee*, **, Mi-Jung Jee*, Byung-Hyun Chi*, Mi-Jai Lee*, Nam-Hee Ch**, and Mi-Sun
More information182호-02.fm
J. Fd Hyg. Safety 18(2), 61 66 (2003) Vibri parahaemlyticus w Immunglbulin ylk (IgY) p *Á½x *Á **Á z***á ****Á y* * w tœw ** w w *** û y **** w t w t w Prductin and Specificity f Imunglbulin ylk (IgY)
More information48.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 5, pp. 60~65, 007. Develpment f Black Clr Spinel Pigment fr High Temperature Kwang-H Lee, Min-S Myung, and Byung-Ha Lee Department f Ceramic Engineering, Myungji
More information( )-84.fm
Jurnal f the Krean Ceramic Sciety Vl. 7, N. 6, pp. 608~61, 010. DOI:10.191/KCERS.010.7.6.608 Synthesis and Characterizatin f Al-dped Uvarvite Green Pigments Sung-Gyu Se and Byung-Ha Lee Department f Materials
More information14.fm
Journal of the Korean Ceramic Society Vol. 44, No. 2, pp. 93~97, 2007. Preparation of High Purity Si Powder by SHS Chang Yun Shin, Hyun Hong Min, Ki Seok Yun, and Chang Whan Won Engineering Research Center
More informationuntitled
[ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings
More informationfm
Kr. J. Micrbil. Bitechnl. Vl. 34, N. 2, 94 100 (2006) Auxin Siderphre» ³ Bacillus subtilis AH18 Á½ Á Á½ * û w w w An Auxin Prducing Plant Grwth Prmting Rhizbacterium Bacillus subtilis AH18 which has Siderphre-Prducing
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information45(2)-11(027)p fm
The Krean Jurnal f Micrbilgy, Vl. 45, N. 2, June 2009, p. 163-169 Cpyright 2009, The Micrbilgical Sciety f Krea ü ³ Klebsiella pneumniae Escherichia cliƒ w Ÿ k k (Extended-Spectrum β-lactamase, ESBL) wz
More information139.fm
Jurnal f the Krean Ceramic Sciety Vl. 43, N. 12, pp. 839~845, 2006. Manufacture f High Density Graphite Using Cal Tar Pitch Kwang Yun Ch, Kyung Ja Kim, Dh Hyung Riu, Kwang Hyun Lim,* Jung Il Kim,* In Chel
More information304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
More information69-1(p.1-27).fm
99 A 380 B 787 : wœ z w * w w wœ» A380 B787 wœ» w. wœ» ww r. w wœ» p j y w r» w. I. II. z III. A380 B787 IV. A380 V. wœ» : x VI. z VII. I. A380 B787»ƒ z wœ w, w w p j w w ƒ r. t wœ w ƒ w w wœ» š œm wš,
More information43(5)-11.fm
Krean Chem. Eng. Res., Vl. 43, N. 5, Octber, 2005, pp. 616-620 기상공정에의한구형형상의헥사알루미네이트계형광체제조 Ç Ç içq Ç ly 143-701 ne v k 1 (2005 5 2p r, 2005 9 7p }ˆ) Preparatin f Hexaaluminate Phsphr Particles with Spherical
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More information85.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 9, pp. 502~509, 2007. Examinatin n Applicatin f High-Perfrmance Cncrete using Fine Fly Ash as Replacement Material f Silica Fume Bum-Sik Lee, Sang-Kyu Kim,
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information(154번 김사라은경).fm
Jurnal f the Krean Ceramic Sciety Vl. 48, N. 4, pp. 316~322, 2011. DOI:10.4191/KCERS.2011.48.4.316 The Effect f Vacuum Annealing f Tin Oxide Thin Films Obtained by RF Sputtering Sun-Phil Kim, Yungrae Kim*,
More information605.fm
Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **
More information9(3)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information( )-100.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 6, pp. 491~497, 2010. DOI:10.4191/KCERS.2010.47.6.491 Temperature Dependence n Elastic Cnstant f SiC Ceramics Jng In Im, Byung-W Park, H-Yng Shin, and Jng-H
More information16(5)-02(57).fm
Jurnal f Krean Pwder Metallurg Institute Vl. 16, N. 5, 2009 DI: 10.4150/KPMI.2009.16.5.310 /ekœ w TiC/C w w ¼ *Áw a w œ w œw, a Snthesis f TiC/C Cmpsite Pwder b the Carbthermal Reductin Prcess Gil-Geun
More information( )-70.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 5, pp. 401~406, 010. DOI:10.4191/KCERS.010.47.5.401 Synthesis f Pure and Prus CaOÁAl Clinker by Burning f Hydrates Du Hyuk Kim and Tae Wng Sng Department f
More information10.063~070(B04_윤성식).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 63-70 Mg-3%Al-1%Zn w ƒœ» y Á x*á **Á Á w œw *w s l I ûer ** t Effect of Thermomechanical Treatment on Microstructure and Mechanical Properties
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information17(1)-06.fm
Krean J. Crystallgraphy Vl., N. 1, pp.14~18, 006 LP-MOCVD w ZnO ù Ÿw p Á yá * w w» w» l Structural and Optical Prperties f ZnO Nanwires Synthesized by LP-MOCVD Prcess Yung-Jin Chi, Jae-Hwan Park and Jae-Gwan
More information49(6)-06.fm
Journal of the Korean Chemical Society 2005, Vol. 49, No. 6 Printed in the Republic of Korea 중학교과학교과서불꽃반응실험에서선스펙트럼관찰의문제점분석및개선연구 ½ Á Á * w w yw (2005. 10. 4 ) An Analysis and Improvement of the Line Spectrum
More informationfm
w y wz 9«( 1y) 63~68, 2006 J. f the Krean Sciety fr Envirnmental Analysis Ÿ w k y w w w p xá **Á vá *Áy y*áy ** š w ywœw, *w» ( ) y, **» w y œw Water Inhibitin and Tungsten Lading Effect f SCR ver NMO
More information50(5)-07.fm
Printed in the Republic of Korea w 3w yû x w w w Á x* w w w yw (2006. 3. 14 ) A research of the Difference in Teaching Styles and Understanding of 9 th Grade Students About Lead-iodide Precipitation Reaction
More information50(1)-09.fm
2006, Vol. 50, No. 1 Printed in the Republic of Korea 언빨래가마르는현상에대한중등학교화학전공교사들의인식조사 ½x Á» Á½ # Á x* w w yw y š w w # w w (2005. 5. 11 ) A Research of Secondary School Chemistry Major Teachers Perceptions
More information45(3)-8(046)p fm
The Krean Jurnal f Micrbilgy, Vl. 45, N. 3, September 009, p. 75-80 Cpyright 009, The Micrbilgical Sciety f Krea e w Acetbacter sp. V6 y ½ Á y Á wá»xá Áy Á Á y * w w w w m z l Acetbacter sp. V6 w bacterial
More information16(5)-06(58).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.336 y-y w Sm-Fe w ƒ w zá *Á w»» The Effect of Excess Samarium Oxide on the PreparationG of Sm-Fe Alloy Powder by Reduction-diffusion
More information58.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 6, pp. 35~330, 007. Effect f ph n Pre Characteristics in Synthesis f High Prus AlO(OH) Gel by Hydrlysis f Al and Na Mixed Slutin Byung-Ki Park, Dng Uk Che,
More information(1)-04(오경화).fm
w œwz, 48«1y 2011 Textile Science and Engineering Vl. 48, N. 1, 2011»Ÿy w PVA v Ÿy w³p» Á y 1 w w š œw, 1 w ƒ w (2011. 1. 2. /2011. 2. 4. k) Phtactive and Antimicrbial Prperties f PVA Films Cntaining Varius
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 436-443, 2005,1"$ w Q) t p z Á 1w w œw 2 w œ yw Effects of surface properties and solution ph on the pollutants removal of
More information( )-121.fm
Jurnal f the Krean Ceramic Sciety Vl. 48, N. 1, pp. 69~73, 011. DOI:10.4191/KCERS.011.48.1.069 Structural and Crrsive Prperties f ZrO Thin Films using N O as a Reactive Gas by RF Reactive Magnetrn Sputtering
More information129.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 1, pp. 87~81, 008. Effects f Y O Additin n Densificatin and Thermal Cnductivity f AlN Ceramics During Spark Plasma Sintering Jae Hng Chae*, J Sek Park*, **,
More information16(5)-03(56).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.316 ƒ w Fe œ w Cu wy SPS (I) I. ƒ wy y Á xá½ Á½ *Á½{ a w œw, a w» gœ Production of Fe Amorphous Powders by Gas-atomization Process
More information93.fm
Journal of the Korean Ceramic Society Vol. 45, No. 10, pp. 625~630, 2008. Effect of Storage Conditions on the Setting Properties of Brushite Bone Cement Containing Granular β-tricalcium Phosphate Sun-Ae
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information07.045~051(D04_신상욱).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 45-51 f m s p» w Á xá zá Ÿ Á w m œw Image Retrieval Based on Gray Scale Histogram Refinement and Horizontal Edge Features Sang-Uk Shin,
More information44(1)-01(이기안).fm
1 w t œwz J. Kr. Inst. Surf. Eng. Vl. 44, N. 1, 011. < > Fe-%Cr-5.8%Al w š y ½ a, ya, b, œ c, ½»c,» a* a w œw, bw»» c w œw High-Temperature Oxidatin Behavir f Fe-%Cr-5.8%Al Ally Sng-Yi Kim a, Sung-Hwan
More information07.051~058(345).fm
w wz 8«3y 2008 6 pp. 51 ~ 58 m qp yp š w k sƒ Evaluation of Dynamic Modulus based on Aged Asphalt Binder y*á **Á***Á**** Lee, Kwan-HoÁCho, Kyung-RaeÁLee, Byung-SikÁSong, Yong-Seon Abstract Development
More information17.393~400(11-033).fm
Journal of the Korea Concrete Institute Vol. 23, No. 3, pp. 393~400, June, 2011 GGGGG DOI 10.4334/JKCI.2011.23.3.393 x RC { sƒ y y 1) *Á½ 1) Á 2) 1) y w œw 2) w œw Bond Strength Evaluation of RC Beams
More information12(3) 10.fm
KIGAS Vol. 12, No. 3, September, 2008 (Journal of the Korean Institute of Gas) ü LP ƒ š Database w š Á Á½z w ywœw (2008 6 10, 2008 8 12 (1 ), 2008 9 5 (2 ), 2008 9 5 k) Constructing a Database Structure
More information03.209~216(08-002).fm
[ ] w Á wz (J. Kr. Inst. Met. & Mater.) Vl. 46, N.4, pp. 209~216 (2008) 'F$S/J.P8/ ü l w p e $Pw w 1 Á 2 Áû 1 Á ³k 1 Á½ 3Á½ 1, * 2 1 w œw» l 3 ³ w œw Center fr Advanced Life Cycle Engineering, University
More information97.fm
Jurnal f the Krean Ceramic Sciety Vl., N. 10, pp. 56~567, 007. Effect f ph f Aluminum Hydrxides Gel Obtained by Hydrlysis f Al ( ) Slutin n Crystal Grwth f α-al O Platelets Dng Uk Che, Byung Ki Park*,
More information93-10.fm
w y wz 9«( 3y) 207~214, 2006 J. f the Krean Sciety fr Envirnmental Analysis š w ky gq p ½» w w œw Crrsin Prperties f Cating Mixtures fr the Desulfurizatin System under High Temperature and Acidic Envirnment
More information46.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 5, pp. 285~289, 2008. Effect f Si:C Rati n Prsity and Flexural Strength f Prus Self-Bnded Silicn Carbide Ceramics Kwang-Yung Lim, Yung-Wk Kim, Sang-Kuk W*,
More information49(6)-08.fm
Jurnal f the Krean Chemical Sciety 005, Vl. 49, N. 6 Printed in the Republic f Krea TiO 광촉매활성에서 Rutile 구조의영향 ½ Á k Áy * w yw (005. 8. 5 ) Effect f Rutile Structure n TiO Phtcatalytic Activity Seung-Min
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information82-02.fm
w y wz 8«( 2y) 00~00, 2005 J. of the Korean Society for Environmental Analysis Calix[6]arene w k š w *Á x Á Á«ƒm w yw, *w w yw Cesium Ion Selective Solid Contact Electrodes Based on Calix[6]arene Won-sik
More information18(3)-10(33).fm
Journal of Korean Powder Metallurgy Institute Vol 18 No 3 011 DOI: 10150/KPMI01118383 e x 5Mg(OH) MgSO 3H O x w MgO NH OH w a báv y aá½xk aá½ aá½ cá½ bá½ a * aw» l bš w œw ck Effect of MgO and NH OH on
More information(153번 김철영).fm
Jurnal f the Krean Ceramic Sciety Vl. 48, N. 4, pp. 269~277, 2011. DOI:10.4191/KCERS.2011.48.4.269 Effect f Varius Oxides n Crystallizatin f Lithium Silicate Glasses Chul Min Kim, Hyung Bng Lim, Yug Su
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information11(5)-12(09-10)p fm
w wz J. Kor. Soc. Cloth. Ind. 11«5y, 2009 Vol. 11, No. 5, pp.799-807(2009) w w * k ƒm w pg p w, ƒm w q w A Qualitative Research on Pursuing Image and Appearance Management Behavior of Brides Eun-Joo Bae
More information82.fm
Journal of the Korean Ceramic Society Vol. 44, No. 9, pp. 524~528, 2007. Determination of Critical Chloride Content of Ordinary Portland Cement Concrete by Linear Polarization Technique Hong-Sam Kim, Hai-Moon
More information44.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 5, pp. 263~267, 2008. Piezelectric Prperties and Phase Transitin behavirs f (Bi 1/2 ) 1 x Ca x Ceramics Yng-Hyun Lee*, **, Jeng-H Ch**, Byung-Ik Kim**, and
More information22(3)-04.fm
J. Fd Hyg. Safety Vl. 22, N. 3, pp. 159~164 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available nline at http://www.fdhygiene.r.kr ù ý ô Ì»Ï Œ äâ  * ƒm w tá w Hygienic Quality f Drinking Water Served in
More information(163번 이희수).fm
Journal of the Korean Ceramic Society Vol. 48, No. 4, pp. 323~327, 2011. DOI:10.4191/KCERS.2011.48.4.323 Electrical Properties and Temperature Stability of Dysprosium and Erbium Co-doped Barium Titanate
More information416.fm
Journal of the Korean Housing Association Vol. 20, No. 4, 2009 œ qp œ y An Analysis of Change on the Apartment Unit Plans and the Interior Spaces Related to Women * Choi, ByungSook ** Park, JungA "CTUSBDU
More information7.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 1, pp. 60~64, 008. Sintering Behavir and Mechanical Prperty f B 4 C Ceramics Fabricated by Spark Plasma Sintering Kyung Hun Kim*,, Jae Hng Chae*, J Sek Park
More information< D B9DABBF3C8AF29BABCB5E52E666D>
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 5, pp. 58~533, 009. DOI:10.4191/KCERS.009.46.5.58 Effects f β-sic Particle Seeds n Mrphlgy and Size f High Purity β-sic Pwder Synthesized using Sl-Gel Prcess
More information35.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 4, pp. 208~213, 2008. Develpment f Helical Antenna using Micrwave ZST Ceramics Jng-Bae Lee, Yungjin Yk, H-Yng Sin, Hyung-Sun Kim*, Jng-In Im Simulatin Center,
More information41(6)-09(김창일).fm
269 Ar v Na 0.5 K 0.5 NbO 3 t ½ t,, ½ w,, ½ w»œw Surface Reaction of Na 0.5 K 0.5 NbO 3 Thin Films in Inductively Coupled Ar Plasma w t œwz J. Kor. Inst. Surf. Eng. Vol. 41, No. 6, 2008. < > Dong-Pyo Kim,
More information18.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 2, pp. 132~137, 2008. Pre Structure Mdificatin and Characterizatin f Prus Crdierite with Chemical Vapr Infiltratin (CVI) SiC Whisker Ik Whan Kim, Jun Gyu Kim,
More informationfm
[ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties
More information18(3)-06(09).fm
Jurnal f Krean Pwder Metallurgy Institute DOI: 10.4150/KPMI.2011.18.3.256 Cu, Zn, Sn, Se yw p e w xá yá Á xá½³y* û w œw Effects f Ball Milling Cnditin n Sintering f Cu, Zn, Sn and Se Mixed Pwders Jng-Hen
More information53.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 6, pp. 297~32, 27. Square Wave Vltammetry in Cathde Ray Tube Glass Melt Cntaining Different Plyvalent Ins Ki-Dng Kim, Hy-Kwang Kim, and Yung-H Kim Faculty f
More information( )★56.fm
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 4, pp. 379~384, 009. DOI:10.4191/KCERS.009.46.4.379 Preparatin and Characterizatin f Black Clr Zircnia by Impregnatin Methd Used by Graphite Kwang-H Lee, Jng-Pil
More information한 fm
Jurnal f the Krean Magnetics Sciety, Vlume 19, Number 6, December 2009 DOI: 10.4283/JKMS.2009.19.6.209 œe w w r p(bam) x» e ph w Áû k w œw, z w¼1, 200-701 (2009 10 7, 2009 11 20, 2009 11 21 y ) M-type
More information( )42.fm
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 3, pp. 8~87, 009. DOI:10.4191/KCERS.009.46.3.8 Optimizatin f Rd-shaped γ-lialo Particle Reinfrced MCFC Matrices by Aqueus Tape Casting Hyun-Jng Chi, Mi-Yung
More information특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) B09B 1/00 (2006.01) C09K 17/00 (2006.01) E02D 31/00 (2006.01) (21) 출원번호 10-2011-0016170 (22) 출원일자 2011년02월23일 심사청구일자 전체 청구항 수 : 총 9 항 2011년02월23일 (11)
More information( )34.fm
Jurnal f the Krean Ceramic Sciety Vl 46, N 3, pp 75~81, 009 DOI:104191/KCERS00946375 Prus Materials frm Waste Bttle Glasses by Hydrthermal Treatment Dng-kyu Lim and Eun-Tae Kang Schl f Nan & Advanced Material
More information10(1)-08.fm
w y wz 10«( 1y) 47~52, 2007 J. of the Korean Society for Environmental Analysis œ w t y ½ xá Á x Á½ Á x* Ÿ œ, * w œw Optimization of Coagulation In The Conventional Water Treatment Plant Jun-Hyun Kim,
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information83-07.fm
w y wz 8«( 3y) 137~142, 2005 J. of the Korean Society for Environmental Analysis sw n w Polychlorinated Biphenyls»y Áwx Á yá w w yw Analysis of Polychlorinated Biphenyls from Pohang and Gangseo, Busan
More information( )-80.fm
Jurnal f the Krean Ceramic Sciety Vl. 7, N. 6, pp. 603~607, 00. DOI:0.9/KCERS.00.7.6.603 Synthesis and Frmatin Mechanism f Cbalt Dped Willemite Blue Pigments Dng-Ha Hwang, Han Kyng-Sp, and Byung-Ha Lee
More information202.fm
Journal of the Korean Housing Association Vol. 19, No. 2, 2008 w w w w Physical Identities of Bukchon Hanok Area Viewed from Literary Geography * Park, Cheol-Soo "CTUSBDU This study explores the beneficial
More information103.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N., pp. 6~66, 007. Preparatin and Characterizatin f SiC Cated Graphite Fam Jae Jin Kyung, Jung Ju Kim, S Ryng Kim, W Teck Kwn, Kwang Yun Ch, and Yung Hee Kim Ec-Materials
More information( )-68.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 5, pp. 445~449, 010. DOI:10.4191/KCERS.010.47.5.445 Blating Mechanism f Artificial Lightweight Aggregate fr Recycling the Waste Glass Shin Hyu Kang and Ki Gang
More information