The Korean Journal of Microbiology, Vol. 43, No. 1, March 2007, p. 23-30 Copyright 2007, The Microbiological Society of Korea Quick Real-time PCR w Avian Influenza Virus Subtype H5N1 ½ yá Áw zá«y 1 Á *» w w w w w w y k v (AIV) H5N1 x Real-time PCR w ƒ w w.» AIV H5N1 x hemagglutinin ƒ 387 bp kw š, x w œw w. Microchip» w Real-time PCR w, PCR 1 µl, PCR ƒ, w, w, ƒ 1, 1, 3 w x w. w x PCR 12 28, d 2.4 hemaggutinin» w w p 189 bp PCR sw», š PCR x Quick Real-time PCR w. ƒ q AIV H5N1 x, PCR» w. Key words ý avian influenza, detection, hemagglutinin, H5N1, Real-time PCR v (influenza) y» y, v (influenza virus) w. v jš x w, w 2-3 ü m 10-20%ƒ w (1, 3). v Orithomyxoviridae w, negative single strand RNA 8 r y. polymerase yyw PB1, PB2, PA, š glycoprotein hemagglutinin, neuraminidase y w NP M, NS1 NS2 (12). wr v (Avian Influenza Virus, AIV) nucleoprotein matrix (M1) protein w w Ax, w x t glycoprotein hemagglutinin (HA) neuraminidase (NA) w w (19, 20). x ¾ 16 HA 9 NAƒ v Ax x, HA NA w w w w (9, 14). HA NA x w, 3 HA x(h1-h3) 2 NA x(n1 N2) (5, 10). AIV H5N1, H7N7, H7N3, H9N2 w *To whom correspondence should be addressed. Tel: 82-31-249-9645, Fax: 82-31-243-1707 E-mail: bsyoon@kyonggi.ac.kr x v A (influenza A virus)ƒ j š (17). AIV H5N1 w ù, 1996 100% ƒ¾ e š H5N1 x š, 1997, AIV w y, 18 6 w š, q» w ƒ (8, 13). z 2001 l x ¾ AI ü sw, pû, k, ƒ, š AIV H5N1 ƒ, y, š, p w e (2003 pû 93 42, 2006 k 22 14 ) w Ÿ»¾ ƒw vw û (4, 7, 15, 18). ƒw AI H5N1» ƒ w, š q» w» w j š, ƒ» y w w, w y, x, œw w, x p š. x AIV w» w, x x (Hemagglutination Inhibition, HI), xÿ (Immunofluorescence Assay, IFA), z x (Enzyme Linked Immunosorbant Assay, ELISA), wz (Polymerase Chain 23
24 Eul hwan Kim et al. Kor. J. Microbiol Reaction, PCR) š. HI ƒ š yw v wš, IFA ELISA w p (16). w PCR ƒ š p š w š multiplex PCR, Realtime PCR, NASBA, PCR-ELISA PCR» w w AIV ƒ w (6). PCR w w x, x w (Immunochromatography) w y ùù,, r x», q» w œw, w w wš, w w., AIV w, Realtime PCR w 10 w x wš w, w» Real-time PCR w Quick Real-time PCR w. AI w,, 13 ü y x e», AIV H5N1 x w x x wš w, šw. w oligo primer AIV H5N1 t x DNA Primer w GenBank database (National Center of Biotechnology Information, NCBI) x avian influenza A virus subtype H5N1 82 hemagglutinin (HA)» šw.» w ww (CLUSTAL X program, Version 1.81, ftp://ftp-igbmc.u-strasbg.fr/ pub/clustalx),» ƒ» ww œ» w.» avian influenza A virus subtype H5N1 (GenBank accession number, AY651322) hemagglutinin ƒ w», ƒ ƒ» 387 bp kw Fig. 1. Synthesis of partial hemagglutinin gene from avian influenza A virus subtype H5N1 by templateless gene synthesis. 387 bp-long hemagglutinin (HA) DNA was synthesized through 7-step templateless oligonucleotide extension. This electrophoretic image shows the result of each extension step. Lane 1 to lane 7 were 77 bp, 119 bp, 182 bp, 244 bp, 309 bp, 330 bp, and 387 bp of HA DNA, respectively. Lane M and M' represents two different DNA size markers. w AIV t» w, œw w (Fig. 1, 2). t»» (AY651322) 820 nt 1206 nt¾» w, Primer3 (Version 0.2, primer design software) w w oligonuclotide primer w. oligonucleotide ( ) w (Bionics, Korea), œ oligonucleotide œw primer. primer» Table 1, t x DNA e Fig. 2 ùkü. Hemagglutinin w 7 HA w oligonucleotide w (» ), PCR (PTC-200, MJ Research, USA), 387 bp hemagglutinin t w w. 20 µl ƒ 10 pmole oligonucleotide ƒ 1.25 mm dntp, 1.25 unit Ex Taq DNA polymerase (TaKaRa, Japan), 2 µl 10 reaction buffer (25 mm MgCl 2 ) w 94 o C 3 predenaturation z, denaturation 94 o C 12, annealing 61 o C 12, Table 1. Oligonucleotide sequence of AIV detection primers Name Sequence(5'->3') mer Amplicon HA HF TCCACAACATACACCCTCTC 20 189 bp HR ACCCATACCAACCATCTACC 20 Fig. 2. DNA sequences of an artificial synthesis of hemagglutinin genes (387 bp, partial sequence). The bold letters represent two position of AIV detection primers pairs named HA-HF and HA-HR, 5' 3' respectively, in this study.
Vol. 43, No. 1 Avian Influenza 25 extension 72 o C 12 30 cycles ww, 72 C o 5 final extension w. ƒ w DNA 2.5 % agarose gel» z ethidium bromide w UV transilluminator ƒ j» y wš MEGA-spin TM agarose gel elution kit (Intron, Korea) w DNA w PCRw» DNA w. 7 w w dsdna pbx vector (2) cloning w z,» (Bionics, Korea) y w š, phc16 w. Real-time PCR Real-time PCR»» Exicycler TM Quantitative Thermal Block (Bioneer, Korea) w. s d w SYBR Green w, t phc16 HA primer w PCR ww (Table 1). AIV Real-time PCR w annealing y w» w primer ƒ 10 pmole phc16 1 ng template w 5µl 4 GreenStar PCR premix (Bioneer, Korea), 2.0 mm MgCl 2 20 µl w (temperature gradient) Real-time PCR ww. PCR 94 C 3 o pre-denaturation z, denaturation 94 o C 20, annealing 53-64 o C 15, extension 20 35 cycles ww š, z 94 C l o 50 C¾ û ƒ o 1C xÿ o d w PCR ƒƒ (melting temperature analysis) w. w MgCl 2 y w» w MgCl 2 2 mm l 6 mm¾ 1 mm MgCl 2 ƒ g MgCl 2 PCR PCR cycle ww w. d AIV Real-time PCR w» w w w hemagglutinin pbx vector ww AIV plasmid (phc16) 10 ng l 10 ag¾ 1/10 w z template w y PCR Real-time PCR ww. Real-time PCR w t avian influenza A virus H5N1 w hemagglutinin (387 bp) w phc16, DNA spectrophotometer d w š plasmid copy (11). 6 10 23 (copies/mol) concentration (g/µl) MW (g/mol) = amount (copies/µl) Quick real-time PCR Quick Real-time PCR 10 Real-time PCR óù Real-time PCR w,» Real-time PCR w» w w.»» GenSpector TMC-1000 (Samsung, Korea), ge» w, 1 µl PCR w v w w. Quick Real-time PCR w w» w PCR, phc16 DNA 1 pg-10 ag w ww. reaction volume 1µl w, ƒ 1µl template 2µl 10 mm MgCl 2, 7 µl yw z 1µl wš, detection primer ƒ 1µl ƒw z, 1µl 1µl 2 premix (GeNet Bio, Korea) yww 1µl w PCR-chip ww. GenSpector TMC-1000 (Samsung, Korea) w ³ Real-time PCR 94 o C 1 pre-denaturation e z denaturation 94 o C 10, annealing 58 o C 7, extention 72 o C 7 35 cycles w. z 96 C l o 66 C¾ û ƒ o 1 C xÿ o d w, PCR ƒƒ w (melting temperature analysis) w. w AIV w PCR ƒ ww, 94 o C, 1 pre-denaturation e z, PCR 3, denaturation 1, annealing 1, extension 3 ƒ w. Quick PCR w 30 cycles ww w. w (melting temperature analysis) 85 C l o 75 C¾ o û xÿ d w. š Hemagglutinin w Avian influenza A virus (AIV) subtype H5N1 hemmaglutinin (HA) 1.69 kb j» ƒ š neuraminidase (NA) w w ƒ x w. HA w» w w e e (hydrophilicity analysis) mw w»ƒ w, 82 AIV H5N1 x HA homologyƒ š w 387 bp HA w, œ w w Real-time PCR w w. HA w w» w 7 HA w oligonucleotide w š, 7 HA 387 bp w w 2.5% agarose gel ƒ size ƒ ew y w (Fig. 1). w z HA pbx vector cloningw» mw HA ew y w, phc16 w. phc16 DNA spectrophotometer w, d w, 100 ag phc DNA 24 AIV HA sww (Fig. 2). Real-time PCR w HA phc16 1 ng template w Real-time
26 Eul hwan Kim et al. Kor. J. Microbiol PCR detection w. 53 o C-64 o C annealing gradient Real-time PCR 2-6 mm MgCl 2 w Real-time PCR ww 189 bp p PCR product sw. AIV HA PCR-detection annealing temperature 58æ š, MgCl 2 3 mm d ( ). Real-time PCR d AIV HA detection d w, AIV HA sww phc16 DNA» w 10 pg phc16 10 ag¾ 1/10 w z,»» w Real-time PCR w Real-time PCR ww. d»» w PCR amplification fluorescence curve standard curve mw ùkü š,»» 10 pg l 1 fg ( 240 HA sw)» Ct yw ƒ y (Fig. 3A). wr, 100 ag (27 HA )»» Real-time PCR AIV p» ƒ wù, yw w ùkû, 10 ag (2.7 HA )»» w Real-time PCR, z e x, ƒ w w q w (Fig. 3, 4B). x ƒ w HA copy 24 w. w,»» 10 pg l 100 ag ¾ PCR 83.1 C o Tm (Mid-point of melting temperature) d, w -(df/dt) curve ƒ w xk ƒ ùkù w PCR q (Fig. 3B). phc16 DNA 10 pg l 10 ag¾, 1/10 w 7»» Real-time PCR d Ct z (Regression equation) Y(»» ; log ag) = - 0.38X (C T ; cycles) + 11.00, z (Regression coefficiency) R 2 = 0.9650 (Fig. 4A). x q w»» 100 ag (24 HA ) 10 ag sww w, wš w z R 2 = 0.995 ù kû ( ). ƒ PCR» ww j» PCR y w, 10 ag w»» 10 pg l 100 ag¾ PCR 189 bp j» (Fig. 4). Quick real-time PCR PCR 1µl PCR ƒ w ƒ thermocycler, GenSpector TMC-1000 (Samsung, Korea) w, Quick Real-time PCR w.,»» e, w w» w AIV HA sww phc16» w,»» 1 pg, 100 fg, 10 fg, 1 fg, 100 ag, 10 ag ( 2.4 phc16 ) ƒ» w PCR ww. x plasmid DNA 100 fg l 100 ag¾ C T (Threshold cycles) ù, 1 pg, 10 ag PCR»» C T w (Fig. 5). GenSpector TMC-1000 (Samsung, Korea) w Exicycler TM Quantitative Thermal Block (Bioneer, Korea) w, ƒ ƒ j ƒ ù ùkû, plasmid phc16 100 fg l 100 ag ( 24 HA )¾ C T ƒ q ù, z 10 pg l 1 fg ( 240 HA sw)»» C T ƒ y. z w yw ù, 1 pg yw. GenSpector TMC-1000 1µl PCR w w»,»» DNA w PCR w» d. wr, ƒ w»» e, w w Fig. 3. Real-time PCR with serially diluted templates of AIV HA gene using Exicycler TM Quantitative Thermal Cycler. Real-time PCR was performed with the standard condition in this studies. Initial quantities of templates in each experiments were 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 100 ag (24 copies of AIV gene) and 10 ag, respectively. Panel (A) Fluorescence curve. The Ct values were shown initial quantity-dependent manner in the range of 10 pg to 1 fg. Distilled water was used in blank instead of DNA template. Panel (B) Melting point analysis of same PCR products. All products were identical, depending on same temperature of midpoint around 83.1 o C, except 10 ag and blank.
Avian Influenza의 신속검출법 개발 Vol. 43, No. 1 27 Standard curve and electrophoresis of Real-time PCR with serially diluted templates of AIV HA gene using ExicyclerTM. Panel (A) Regression analysis of PCR products. The linear relationship between the quantities of initial template and Ct values was fairly accepted. Regression equation was calculated as Y = - 0.38X + 11.00. Regression coefficient was R2 = 0.9650. Panel (B) Electrophoresis of same PCR products. Lane M is 100 bp DNA size marker; Lane 1-7 were loaded 7 PCR products amplified from initial template plasmid, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 100 ag (24 copies of AIV gene) and 10 ag, respectively. Lane N; negative control (distilled water). PCR products of 189 bp were shown in all lanes, except 10 ag and blank. Fig. 4. The sensitivity of Quick Real-time PCR by 10-fold serially diluted template DNA. Quick Real-time PCRs were performed with 1 pg (2.4 105 copies of AIV gene) - 10 ag plasmid template using GenSpector under 10 seconds - 7s - 7s of 3 steps (denaturation-annealing-extension) in 35 cycles. Panel (A) Fluorescence curve of template-diluted Quick Real-time PCRs. 1 pg, 1 fg, 10 ag etc. represent each weight of template DNA, 1 picogram, 1 femtogram, 10 attogram etc., respectively. PCR with 10 ag template (2.4 copies of AIV gene) was detectable. Panel (B) Melting point analysis in the range of temperature 96oC to 65oC. All 6 PCR products were identical, depends on same melting temperature. The temperatures of mid point (Tm) were calculated in range of 81.8-82.3oC. Fig. 5. 여는 전자가 10 ag의 plasmid phc16 (AIV HA 유전자 2.4개)을 성공적으로 증폭시켰기에, 후자가 보인 검출한계의 수준(100 ag 의 phc 16, 24개 AIV HA 유전자)을 분명히 뛰어 넘는 것으로 나타났다. 10 ag에서 100 ag까지 10 ag단위의 보다 정밀한 검출 한계에 대한 실험은 수행하지 아니하였지만, 10 ag과 100 ag을 단위를 사용한 양자의 반복 실험을 통하여 전자의 우수한 검출 한계를 분명하게 볼 수 있었으며, 이는 GenSpector TMC-1000이 1 µl수준의 총 PCR 반응액을 사용하기에, 20 µl의 총 PCR 반응 액을 사용하는 Exicycler Quantitative Thermal Block보다 초기 TM 기질 농도의 면에서 유리하고, 이 수준의 저농도 기질 DNA의 PCR 증폭은 전자가 보다 유리할 수 있을 것이라 해석하였다(자 료 미제시). 또한 PCR 산물들의 용융온도분석에서 이 PCR 산물들이 모두 동일한 Tm (Temperature of midpoint; 약 82 C)을 가지는 것으 로 나타났고, 이는 모두 성공적 증폭에 의한 동일한 DNA들임을 시사하는 것이라 하겠다. 이 PCR산물들은 1 µl수준의 극소량이 기에 건조에 의한 정량적 회수가 불가능하나, 각기 회수하여 전 기영동을 실시하였으며, 모두 AIV HA유전자의 예상된 크기인 o
28 Eul hwan Kim et al. Kor. J. Microbiol Fig. 6. Electrophoresis of Quick Real-time PCR products. Quick Real-time PCRs were performed with 1 pg - 10 ag plasmid template. 10 fg plasmid was calculated as 2.4 10 3 copies of AIV gene. Lane M was DNA size marker in 100, 200, 300 bp, respectively. PCR with 10 ag template (2.4 copies of AIV gene) was detectable in the level of fluorescence (Fig. 5A), but hard to detect in this electrophoresis. 189 bp DNA y w (Fig. 5, 6). wr, AIV HA ƒ w» w PCR ƒ Quick Real-time PCR ww. Rapid kit (Lateral flow Immunochromatography ) 10, AIV HA Quick Real-time PCR q w d wš w.» ƒ 10 fg AIV HA phc16 DNA w, PCR w ƒ cycle ƒ, 94 o C 1 pre-denaturation e z denaturation 94 o C 1, annealing 58 o C 1, extension 72 o C 3 30 cylces ww š ww. ¾ AIV A 12 28, C T 25.03 cycles, mw PCR product Tm 82.8 o C ü PCR ü y (Fig. 7). C T» š w, 189 bp DNA sw ü x polymerization ƒ j w e q, w denaturation annealing w e d. AIV hemagglutinin p 10 š q ƒ w Real-time PCR w š w. w PCR ƒ cycles denaturation, annealing, polymerization ƒ 1 w PCR ƒ w ƒƒ x. x mw, PCR ƒ cycle ƒ 1, 1, 3, Template (10 fg; 2400 AIV HA phc16 DNA) w ý, GenSpector TMC-1000 (Samsung, Korea) w polymerization 3 ¾», w w ù, z»» w ƒ w». 12 28 PCR Fig. 7. Detection-time limit of Quick Real-time PCR. Quick Real-time PCR was performed with 10 fg plasmid template DNA (2.4 10 3 copies of AIV gene) using GenSpector. To save time of PCR-experiment, times of each 3 steps (denaturation-annealing-extension) were reduced serially, and PCR were performed with 30 cycles and in the range of temperature in melting point analysis 85 o C to 75 o C (except PCR 1; 35 cycles, 96 o C to 65 o C; see Fig. 5). Panel A. Fluorescence curve of time-reduced Quick Real-time PCR. The numbers of 1-6 represent each time-reduced PCR independently performed with 3 different times of denaturation-annealing-extension step in PCR cycles. 1 was 10 seconds - 7 s - 7 s (denaturationanealing-extension); 2, 2 s - 6 s - 4 s; 3, 2 s - 8 s - 3 s; 4, 2 s - 3 s - 4 s, 5, 2 s - 2 s - 4 s; 6, 1 s - 1 s - 3 s, respectively. Panel B. Melting point analysis of same PCR products. All 6 PCR products were identical, depends on same melting temperature. The temperatures of mid-point (Tm) were calculated in the range of 82.46 to 83.25 o C. Only PCR 1 was performed
Vol. 43, No. 1 Avian Influenza 29 l s ƒ w (Melting point analysis) óù ƒ¾, x w w z (reverse transcriptase) ww w, 12 PCR q ¾, AI w PCR, l q ¾ z sww 20 óý ƒ w. Quick Real-time PCR x, x ƒ PCR x Immunochromatography w Rapid kitƒ ƒ š x w ƒ ƒ. x GenSpector TMC-1000 (Samsung, Korea) Real-time PCR»» wì j»ƒ, w x ƒ w ƒ. w PCR k w chip 1µl w w x x Rapid kit w w. AI w Quick PCR ƒ w, x e w q w, w š AI w œw w 1 w» w. w AIV» Real-time PCR w ƒw, AIV ³ w PCR w, w ³ w PCR w x ƒ» ƒ» w. w w,» š, ( ) l j z w». š x 1. û,,,,. 2005. x ; y x 3q. 857-869. 2. w z, ³,. 2006. w III.» w q 82-84. 3. Alexander, D.J. 1995. The epidemiology and control of avian influenza and Newcastle disease. J. Comp. Pathol. 112, 105-126. 4. CDC. 2004. Outbreaks of avian influenza A (H5N1) in Asia and interim recommendations for evaluation and reporting of suspected cases? United States. MMWR 13, 97-100. 5. Claas, E.C.J., A.D. Osterhaus, R. Van Beck, J.C. de Jong, G.F. Rimmelzwaan, D.A. Senne, S. Krauss, K.F. Shortridge, and R.G. Webster. 1998. Human influenza A (H5N1) virus related to highly pathogenic avian influenza virus. Lancet 351, 472-477. 6. Ellis, J.S., and M.C. Zambon. 2002. Molecular diagnosis of influenza. Rev. Med. Virol. 12, 375-389. 7. Fauci, A.S. Emerging and re-emerging infectious diseases: Influenza as a prototype of the host-pathogen balancing act. Cell 124, 665-670. 8. Fleming, D.M., P. Chakraverty, C. Sadler, and P. Litton. 1995. Combined clinical and virological surveillance of influenza in winters of 1992 and 1993-4. BMJ 29, 290-291. 9. Fouchier, R.A., V. Munster, A. Wallensten, T.M. Bestebroer S. Herfst, D. Smith, G.F. Rimmelzwaan, B. Olsen, and A.D. Osterhaus. 2005. Characterization of a Novel Influenza A Virus Hemagglutinin Subtype (H16) Obtained from Black-Headed Gulls. J. Virol. 79, 2814-2822. 10. Gamblin, S.J., L.F. Haire, R.J. Russell, D.J. Stevens, B. Xiao, Y. Ha, N. Vasisht, D.A. Steinhauer, R.S. Daniels, A. Elliot, D.C. Wiley, and J.J. Skehel. 2004. The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 303, 1838-1842. 11. Guan, M.K., L.C. Hsueh, Y.K. Liang, T.J. Wen, L.C.J. Chulu, H.M. Liao, T.J. Chang, and H.J. Liu. 2006. Development of a quantitative Light Cycler real-time RT-PCR for detection of avian reovirus. J. Virol. Methods 133, 6-13. 12. Horimoto, T. and Y. Kawaoka. 2001. Pandemic threat posed by avian influenza A viruses. Clin. Microbiol. Rev. 14, 129-149. 13. Lau, L.T., J. Banks, R. Aherne, I.H. Brown, N. Dillon, R.A. Collins, K.Y. Chan, Y. W. Fung, J. Xing, and A.C.H. Yu. 2003. Nucleic acid sequence-based amplification methods to detect avian influenza virus. Biochem. Biophys. Res. Commun. 313, 336-42. 14. Nicholson, K.G., J.M. Wood, and M. Zambon. 2003. Influenza. Lancet 362, 1733-1745. 15. Payungporn, S., P. Phakdeewirot, S. Chutinimitkul, A. Theamboonlers, J. Keawcharoen, K. Oraveerakul, A. Amonsin, and Y. Poovorawan. 2004. Single step multiplex reverse transcription polymerase chain reaction for Influenza A virus subtype H5N1 detection. J. Vir. Immun. 17, 588-593. 16. Poddar, S.K. 2002. Influenza virus types and subtypes detection by single step single tube multiplex reverse transcription. polymerase chain reaction (RT-PCR) and agarose gel electrophoresis. J. Virol. Methods 99:63-70. 17. Trampuz, A., R.M. Prabhu, T.F. Smith, and L.M. Baddour. 2004. Avian influenza: a new pandemic threat? Mayo Clin. Proc. 79, 523-530. 18. Tran, T.H., T.L. Nguyen, T.D. Nguyen, T.S. Luong, P.M. Pham, V.C. Nguyen, T.S. Pham, C.D. Vo, T.Q. Le, T.T. Ngo, B.K. Dao, P.P. Le, T.T. Nguyen, T.L Hoang, V.T. Cao, T.G. Le, D.T. Nguyen, H.N. Le, K.T. Nguyen, H.S. Le, et al. 2004. Avian influenza A (H5N1) in 10 patients in Vietnam. N. Engl. J. Med. 350, 1179-1188. 19. Yuen, K.Y., P.K.S. Chan, M. Peiris, D.N. Tsang, T.L. Que, K.F. Shortridge, P.T. Cheung, W.K. To, E.T. Ho, R. Sung, and A.F. Cheng. 1998. Clinical features and rapid viral diagnosis of human disease associated with avian influenza A H5N1 virus. Lancet 351, 467-471. 20. Xie, Z., Y.S. Pang, J. Liu, X. Deng, X. Tang, J. Sun, and M.I. Khan. 2006. A multiplex RT-PCR for detection of type A influenza virus and differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Mol. Cell Probes. 20, 245-249. (Received December 5, 2006/Accepted February 13, 2007)
30 Eul hwan Kim et al. Kor. J. Microbiol ABSTRACT : Rapid Detection Method of Avian Influenza Subtype H5N1 using Quick Real-Time PCR Eul hwan Kim, Dong woo Lee, Sang hoon Han, Soon hwan Kwon 1, and Byoung Su Yoon* (Department of Life Science, College of Natural Science, Kyonggi University, Suwon 443-760, Korea, 1 Chronic Inflammatory Disease Research Center, School of Medicine, Ajou University, Suwon 443-721, Korea) The most rapid Real-time PCR based detection method for Avian influenza A virus (AIV) subtype H5N1 was developed. The target DNA sequence in this study was deduced from H5N1 subtype-specific 387 bp partial gene of hemagglutinin, and was synthesized by using PCR-based gene synthesis on the ground of safety. Real- Time PCR was performed by GenSpector TM using microchip-based, total 1 µl of reaction mixture with extremely short time in each steps in PCR. The detection including PCR-amplication and analysis of melting temperature was totally completed within 13 min. The H5N1-specific 189 bp PCR product was correctly amplified until 2.4 molecules of hemagglutinin gene as minimum of templates. This kind of PCR was designated as Quick Real-Time PCR in this study and it could be applied to detect not only AIV H5N1, but also other pathogens using PCR-based detection.