국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 연세대학교대학원 의학과 이상국
국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 지도교수이경원 이논문을석사학위논문으로제출함 2008 년 12 월 연세대학교대학원 의학과 이상국
이상국의석사학위논문을인준함 심사위원 인 심사위원 인 심사위원 인 연세대학교대학원 2008 년 12 월
감사의글 본논문을완성하기까지끊임없는관심과사랑으로지도해주신존경하는이경원교수님과조상래교수님, 이혁민교수님께진심으로감사드립니다. 그리고바쁘신가운데도아낌없는조언으로격려해주신정석훈교수님, 용동은교수님께감사의말씀을드립니다. 또한연구에전념할수있도록많은시간을할애하고, 실험을도와주신서영희연구원과진단검사의학과미생물파트선생님들께감사드립니다. 저자씀
< 차례 > 국문요약 1 Ⅰ. 서론 4 II. 재료및방법 8 1. 시험대상균주 8 2. 항균제감수성시험 9 가. 한천희석법 9 나. β-lactamase 생성시험 9 3. pena 유전자분석 10 4. mtrr, pona, porb 및 pilq 유전자분석 11 5. Nucleotide sequence accession number 11 III. 결과 13 1. 항균제감수성 13 2. PBP 2 아미노산서열 15 3. PBP 2 아미노산서열형과항균제감수성 19 4. mtrr, pona, porb 및 pilq 유전자다형성 19 IV. 고찰 22 V. 결론 27
참고문헌 29 영문요약 35
그림차례 Figure 1. Frequency of the PBP 2 patterns according to isolation sites 17 Figure 2. MICs of penicillin G, ceftriaxone, and cefixime for the N. gonorrhoeae clinical isolates with various patterns of PBP 2 alterations 18 표차례 Table 1. Primers used for PCR amplification and sequencing of the pena, mtrr, pona, porb and pilq genes 12
Table 2. PCR conditions for pena, mtrr, pona, porb and pilq gene amplication 13 Table 3. Proportion of N. gonorrhoeae isolates with decreased susceptibility to cephalosporins 14 Table 4. Amino acid substitutions identified in PBP 2 of the N. gonorrhoeae strains 16 Table 5. Polymorphisms of pena, mtrr, pona, porb and pilq 21
국문요약 국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 근래다제내성임균의증가로 cephalosporin 항균제사용이증가하였고이로인해 cephalosporin 항균제에감수성이저하된균주들이국외에서보고되기시작하였다. Cephalosporin 항균제사용이증가한국내의환경을고려하면임균의 cephalosporin 내성에대한감시가필요할것으로생각된다. 본연구에서는전국주요지역에서 2001년부터 2007년까지특수직업여성및일반환자로부터임균을수집하였고연도별도 20-50주씩임의로선택하여총 208주의항균제감수성을한천희석법으로시험하였다. 이중 cephalosporin계항균제에대하여감수성이저하된균주 46주 ( 실험군 ) 와감수성균주 2주 ( 대조군 ) 를대상으로 pena, mtrr, porb, pona 및 pilq 유전자의염기서열을분석하였다. 1
Penicillin binding protein 2 (PBP 2) 유전자인 pena 분석을통해 PBP 2 아미노산서열형 8가지를관찰하였고, 그중 PBP 2 XXⅣ형 (GenBank accession number FJ465093) 은이전보고들에서발견되지않은새로운형이었다. 대조군의경우 PBP 2 XⅣ형을가지고있었고, 실험군중 1 주에서만 PBP 2 모자이크 (X) 형이발견되었다. PBP 2 모자이크형을가진균에대한 cefixime MIC는 0.5 µg/ml로가장높았다. mtrr의경우대조군에서는불완전 MtrR단백이생성되었고실험군중 44주에서는 promoter 영역의변이가, 2주에서는 mtrr ORF 내의점변이 (Ala39Thr, Leu47Pro) 가관찰되었다. porb의경우대조군 1주를제외한모든균주가 101번, 102번위치에서아미노산치환을보였다. pona의경우대조군에서는돌연변이가발견되지않았고실험군중 44주에서 Leu421Pro의아미노산치환이관찰되었다. 그러나 pona의변이유무에따라 cephalosporin에대한감수성저하정도에차이는없었다. 한편 pilq의돌연변이는발견되지않았다. 본연구에서 pena 모자이크형변이를가진균주는 cephalosporin, 특히경구용제제 (cefixime) 에더높은내성을보였다. 그러나모자이크형이아닌 pena 변이를가진균주도 mtrr, porb 및 pona의유전자다형성을함께가질 2
경우주사제뿐만아니라경구용제제에대해서도비슷한 수준의감수성저하를나타내었다. ---------------------------------------------- 핵심되는말 : 임균, pena, mtrr, porb, pona, pilq, 모자이크 형변이, cephalosporin, 감수성저하 3
국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 < 지도교수이경원 > 연세대학교대학원의학과 이상국 I. 서론 임균은그람음성쌍구균으로임질, 요도염, 골반염등다양한감염질환을일으키며불임, 자궁외임신등의합병증을유발할수있다. 질병관리본부의임균표본감시보고에따르면 (http://stat.cdc.go.kr/index_list.aspx) 임균감염보고건수는 2001년 18,520건에서, 2004년 10,845 건, 2007년 3,115건으로감소하였으나아직도적지않은환자가발생하고있다. 2004년성매매금지법의제정이후로특수직업여성의국가적인관리가어려워졌다. 이로인해임균등의성병이음성적으로전파될 4
위험성이높아졌음을감안할때, 임균감염건수는실제보다낮게보고되었을가능성이많다. 임균관리에있어중요한점은새로운항균제내성균출현에대한지속적인감시와이에대한체계적인대책마련이라할수있다. 임균의전파를효율적으로통제할수있는방법중하나는진단즉시가장효과적인항균제를투여하여완치하는것이다. 과거임균은 penicillin G를포함한여러가지항균제에감수성으로치료에어려움이없었으나, 근래에는다제내성인임균이증가하여 문제가되고있다. 1 임균에서항균제내성균의출현과확산에는 여러요인들이관련된다. 많은경우내성균이출현하고성병의고위험군집단에전파되면서이들을통해지역사회에확산, 정착되는과정을갖는다. 또한치료에사용되는항균제를적절히선택하는것이중요한데이는선택작용에의해사용항균제에대한내성이증가할가능성이높기때문이다. 2 국내에서는 1979년 penicillinase 생성주 (penicillinaseproducing Neisseria gonorrhoeae, PPNG) 가분리된이후, 1990년대에급격히증가하여그비율은 1991-1992년약 50% 에서 1999년약 84% 까지증가하였고이로인해 penicillin G는임균 감염의치료제로사용하기어렵게되었다. 3 Fluoroquinolone 은 대부분의임균에항균력이있고, 요에고농도로농축되며, 경구 5
투여가가능하다는장점이있어서, PPNG 의증가이후임균감염의 치료제로널리사용되었다. 그러나 1994 년 fluoroquinolone 에 감수성이저하된임균이최초로보고되었고, 4 근래에는이약제에 고도내성인임균까지도보고되었다. 5-7 2004 년에용등 9 이보고한 바에의하면국내에서분리되는임균의 fluoroquinolone 내성은 처음보고된 8 이후로급격히증가하여, 2000 년에수집된 190 주의 임균중 172주 (90%) 가 fluoroquinolone에중간혹은내성으로국내의 fluoroquinolone 내성이심각함을알수있었다. Fluoroquinolone 항균제에대한내성은국외에서도심각하여, 미국 Centers for Disease Control and Prevention (CDC) 는 2007년치료지침에서아시아및미국전지역에서발생한임균감염에대해 fluoroquinolone을사용하지말고, ceftriaxone 또는 cefixime을사용할것을권장하였다. 10 한편, ceftriaxone은제 3세대 cephalosporin 항균제이며대부분의임균이감수성이어서임균감염에효과적인약제이나주사제로만사용이가능하다는단점이있다. 1991년 Handsfield 등 11 은임균에감염된 333 명의환자를대상으로경구로 cefixime을투여받은군과근주로 ceftriaxone을투여받은환자군의치료효과를비교하여, cefixime이 ceftriaxone과동일한치료효과를갖고있고 ( 치료율 ; cefixime 400 mg, 96%; cefixime 6
800 mg, 98%; ceftriaxone, 98%), 주사제의불편함이없이 1회의경구투여로임균을치료할수있음을보고하였다. 그러나 cefixime 사용이증가됨에따라감수성이저하된임균이일본에서처음보고되었다. 12 Cefixime에대한감수성저하임균의경우 penicillin-binding protein (PBP) 2 유전자인 pena의염기서열에서감수성균주와많은차이를보였고, 오히려 transpeptidase 영역일부는다른 Neisseria spp. 의염기서열과는매우유사하였다. 이러한 pena 유전자의변이는다른 Neisseria 균종의 pena 일부가삽입된것으로, 모자이크형변이 (mosaicism) 로보고되었다. 12 2005년 Ito 등 13 은 cefixime에감수성이저하된균주들을대상으로 pena의염기서열을분석하였고, PBP 2 아미노산서열에따라 10가지형을보고하였다. 이중 X형은모자이크형변이였고, 나머지 I IX형은모자이크형변이가아닌다른형의변이였다. I IX형은 mutation selection에의한것으로생각되며공통적으로 345번과 346번아미노산사이에 aspartic acid의삽입이있었고 transpeptidase 영역 C 말단아미노산잔기의변화양상이각각달랐다. 그후 Whiley 등 14 이 13가지형을추가적으로보고하여 23가지형 (I XXIII) 이보고되었다. 2006년 Tanaka 등 15 은 ceftriaxone에감수성이저하된균주에서 pena, mtrr, porb 및 pona 유전자의돌연변이를처음보고하였고, 이후 Lindberg 등 16 은 7
cephalosporin 감수성저하와 pena, mtrr, porb 및 pona 유전자다형성 (genetic polymorphism) 의연관성을보고하였다. 본연구에서는전국주요지역에서 2001년부터 2007년사이에특수직업여성및일반환자로부터임균을수집하고, 근래에사용이증가한 cephalosporin계항균제에대한내성양상및주요내성기전등을규명하여임균감염증환자의치료및내성균의확산을막기위한중요한자료를제공하고자하였다. II. 재료및방법 1. 시험대상균주 2001-2007년에전국 10여개의의료기관과서울의과학연구소및녹십자검사센터에서분리된일반환자분리임균과, 전국 5개지역에위치한보건소에서분리된특수직업여성분리임균을수집하였다. 임균분리를위한선택배지는 modified Thayer-Martin 배지 (BBL, Becton-Dickinson, Cockeysville, MD, USA) 를사용하였고, 균종동정은전통적인방법과, 필요에따라서상품화된 kit를이용하였다. 동정된균주는 -70 이하의냉동고에보관하였고수집된 865주중연도별도 20-50주씩임의로선택하여총 208주에대해주요항균제감수성을시험하였다. 8
2. 항균제감수성시험 가. 한천희석법 (Agar dilution method) 동결보관균주를초콜릿한천에접종하여양초단지에서 35, 24-48시간배양한후, Mueller-Hinton broth에현탁하여 10 4 CFU/mL으로 희석하였다. GC agar base (BBL) 에 1% hemoglobin과 1% IsoVitaleX (BBL) 을 첨가하고, 규정된 희석액으로녹인항균제를넣어 2배수단계희석된농도가되도록 평판을만들었다. 항균제는 penicillin G (Sigma Chemical Co., St. Luis, MO, USA), cefixime ( 동아제약, 서울 ), ceftriaxone ( 한미약품, 서울 ) 을 사용하였다. 세균부유액을 Steers' replicator (Craft Machine Inc., Woodline, PA, USA) 를이용하여배지에접종하고 35, 5% CO 2 항온기에 24시간배양후세균의증식을관찰하였다. 세균의증식을완전히억제시킨최소한의농도를최소억제농도 (minimal inhibitory concentration, MIC) 로 정하였다. 결과의 정도관리를 위해서 N. gonorrhoeae ATCC 49226을 같이 시험하였다. 나. β-lactamase 생성시험 9
PPNG 가의심되는균주는 chromogenic cephalosporin 인 cefinase 디스크 (BBL) 로시험하여, 노란색이분홍색으로변하면 양성으로판정하였다. 3. pena 유전자분석 pena유전자는 cephalosporin에감수성이저하된균주 (ceftriaxone 또는 cefixime MIC 0.12 µg/ml 이상 ) 50주중소실된 4주를제외한 46주와 cephalosporin에높은감수성을보인대조군 2주에서분석되었다. 균집락을멸균증류수에부유시킨후 10분간끓여서 2분간 13,000 rpm으로원심분리한상층액 1 µl를 template로사용하였다. PBP 2의아미노산서열을분석하기위해서 pena 유전자전체를 3부분으로나누어각각의 primer set를사용하였다 (Table 1). 1U의 Taq DNA polymerase가들어있는 PreMix (Bioneer, 창원 ) 에상층액 1 µl, 20 pmol의 primer 각각 1 µl, 증류수 17 µl를첨가하여총 20 µl로 Master Cycler gradient 5331 (Eppendorf, Hamburg, Germany) 를사용하여 PCR을시행하였다 (Table 2). PCR 산물은전기영동한후각 primer set에적합한크기의 PCR 산물을 DNA extraction kit을사용하여추출한후염기서열을분석하였다. 13 10
4. mtrr, pona, porb 및 pilq 유전자분석 Cephalosporin에감수성이저하된균주 46주와대조군 2주를대상으로 mtrr, pona, porb 및 pilq 유전자를분석하였다. 추출한 DNA는 mtrr, pona, porb 및 pilq 유전자의돌연변이분석을위해 PCR을시행한후염기서열을분석하였다 (Table 1, 2). 5. Nucleotide sequence accession number PBP 2 XXIV형을부호화하는 pena 유전자염기서열 (accession number FJ465093), 불완전 MtrR 단백을부호화하는 mtrr 유전자 염기서열 (FJ465094), 새로운 아미노산 치환 (Ala39Thr, Leu47Pro) 을갖는 MtrR 단백을부호화하는 mtrr 유전자염기서열 (FJ465095) 을 GenBank nucleotide sequence database에 등록하였다. 11
Table 1. Primers used for PCR amplification and sequencing of the pena, mtrr, pona, porb and pilq genes Primer Nucleotide sequence (5' to 3') Reference pena-a1 CGGGCAATACCTTTATGGTGGAAC 13 pena-b1 AACCTTCCTGACCTTTGCCGTC 13 pena-a2 AAAACGCCATTACCCGATGGG 13 pena-b2 TAATGCCGCGCACATCCAAAG 13 pena-a3 GCCGTAACCGATATGATCGA 13 pena-b3 CGTTGATACTCGGATTAAGACG 13 mtrr-f GCCAATCAACAGGCATTCTTA 32 mtrr-r GTTGGAACAACGCGTCAAAC 32 pona-f GAGAAAATGGGGGAGGACCG 32 pona-r GGCTGCCGCATTGCCTGAAC 32 porb-f CCGGCCTGCTTAAATTTCTTA 17 porb-r TATTAGAATTTGTGGCGCAG 17 pilq-f pilq-r CGTTACGCCGAACATCACG TGACCGAAACTGAACGGACTG GenBank No. AE004969 GenBank No. AE004969 12
Table 2. PCR conditions for pena, mtrr, pona, porb and pilq gene amplication Target Pre-denaturation Denaturation Annealing Extension pena-a1 95, 2 min 95, 1 min 58, 1 min 72 1 min pena-a2 95, 2 min 95, 1 min 56, 1 min 72 1 min pena-a3 95, 2 min 95, 1 min 52, 1 min 72 1 min mtrr 94, 5 min 94, 30 s 50, 30 s 72 30 s porb 94, 5 min 94, 30 s 46, 30 s 72 1 min pona 94, 5 min 94, 30 s 56, 30 s 72 30 s pilq 94, 5 min 94, 30 s 52, 30 s 72 30 s III. 결과 1. 항균제감수성임균 208주중 cefixime의 MIC가 0.12 µg/ml 이상으로감수성이저하된균주는 43주였고이중 MIC 0.5 µg/ml 이상의비감수성균주는 1주였다. Ceftriaxone에감수성이저하 (MIC 0.12 µg/ml 이상 ) 된균주는 30주였고비감수성 (MIC 0.5 µg/ml 이상 ) 균주는없었다. Cefixime 또는 ceftriaxone에감수성이저하된균주는 13
50주이었고, 두항균제에동시에감수성이저하된균주가많았다. 감수성이저하된균주의비율은분리연도에따라달라서 8.3-34.9% 였다 (Table 3). β-lactamase를생성하는균주는모두 50주 (24%) 이었고 47주는 penicillin MIC가 16 µg/ml 이상의고도내성을보였다. Table 3. Proportion of N. gonorrhoeae isolates with decreased susceptibility to cephalosporins Year No. of isolates No. (%) of isolates with decreased susceptibility 1 2001 24 2 (8.3) 2002 22 7 (31.8) 2003 24 2 (8.3) 2004 20 5 (25.0) 2005 21 3 (14.3) 2006 43 15 (34.9) 2007 54 16 (29.6) Total 208 50 (24.0) 1 Cefixime or ceftriaxone MIC 0.12 µg/ml. 14
2. PBP 2 아미노산서열본연구에서는 PBP 2 아미노산서열형 8가지가발견되었다 (Table 4). PBP 2 아미노산서열형은 Ito 등 13 과, Whiley 등 14 이이전에보고한분류에따랐다. XⅢ형이 28주에서발견되어가장많았고, Ⅳ형 9주, Ⅴ형 4주순이었다. XXIV형은본연구의 1주에서처음발견되었다. XXIV형은기존의 Ⅴ형와유사하였고, 551번째아미노산이 proline에서 serine으로치환된것이유일한차이였다. 모자이크형변이인 X형은 cefixime에비감수성인 1주에서발견되었다. Cephalosporin에감수성이높았던대조군 2주는 XⅣ형을가졌다. 분리지역에따른 PBP 2 형의차이는없었다 (Figure 1). 15
Table 4. Amino acid substitutions identified in PBP 2 of the N. gonorrhoeae strains Patterns No. of isolates 1 Insertion of a single aspartic acid codon between Arg345 and Asp346. 2 Mosaic pattern. 345D PBP 2 amino acid substitution in Ins 1 501A 504F 510A 512N 516A 541H 542G 545G 549A 551P 552P 555K 556I 566I 574A IV 9 D L V G S V 4 D L V G S V NV X 2 1 - L V Y N S T V Q V V NV XII 2 D L V G S XIII 28 D V L V G S XIV 2 D L V G N XVII 1 D V L V G S V NV XXIV 1 D L V G S S V NV A, alanine; F, phenylalanine; N, asparagine; H, histidine; G, glycine; P, praline; K, lysine; I, isoleucine; D, aspartic acid; L, leucine; V, valine; S, serine; Y, tyrosine; T, threonine; Q, glutamate 16
25 20 15 10 5 0 Gwangju Daejeon Sungbuk Suwon Shinchon Wonju Inchon Others IV V X XII XIII XIV XVII XXIV Figure 1. Frequency of the PBP 2 patterns according to isolation sites. The pattern XⅢ was the most common. No relation was found between PBP 2 patterns and isolation sites. 17
Penicillin G µg/ml >128 128 64 32 8 4 2 1 0.5 0.25 0 5 10 15 20 25 No. isolates IV V X XII XIII XIV XVII XXIV Ceftriaxone Cefixime 0.25 0.5 0.25 µg/ml 0.12 0.06 µg/ml 0.12 0.06 0.03 0.008 0.008 0 5 10 15 20 25 30 No. isolates 0 5 10 15 20 25 30 35 No. isolates Figure 2. MICs of penicillin G, ceftriaxone, and cefixime for the N. gonorrhoeae clinical isolates with various patterns of PBP 2 alterations. 18
3. PBP 2 아미노산서열형과항균제감수성 PBP 2 형에따른 MIC의분포를 Figure 2에나타내었다. XⅣ형을가진대조군의경우다른형균주에비해 penicillin ( 0.5 µg/ml), cefixime ( 0.008 µg/ml) 및 ceftriaxone ( 0.008 µg/ml) 의 MIC가낮았다. X형의모자이크형을가진균주에대한 penicillin MIC (8 µg/ml) 의경우다른균주들에대한 MIC의값의중간정도이었다. 그러나 cefixime과 ceftriaxone의 MIC는 0.5 µg/ml와 0.25 µg/ml로다른형을가진가진균주들에비해높았다. 나머지 Ⅳ, Ⅴ, XⅡ, XⅢ, XⅦ 및 XXⅣ형을가진균주들에대한 penicillin, cefixime 및 ceftriaxone의 MIC 범위는서로비슷하게분포하여특정형과 MIC를연관시키기는어려웠다. 4. mtrr, pona, porb 및 pilq 유전자다형성유전자분석을시행한 48주중 44주에서 mtrr promoter의 - 10과 -35 염기서열사이에위치한 13-bp 역방향반복서열에서의하나의염기쌍 (A/T) 의소실을보였다 (Table 5). 나머지 4주중 2주에서는 mtrr ORF 내의아미노산치환 (Ala39Thr, Leu47Pro) 을보였다. 그리고나머지 2주는대조군으로 41개의아미노산으로이루어진불완전 MtrR 단백이생성되었다. PorB의경우 48주중대조군 1주를제외한 47주에서 101번째아미노산 Gly와 102번째아미노산 Ala의치환을발견할수있었다. 대다수인 42주는 Gly101Lys, Ala102Asp의아미노산치환을보였고, 2주는 Gly101Lys, Ala102Asn, 나머지 2주는 Gly101Asn, Ala102Asp, 그리고한주는 Gly101Lys, Ala102Gly의아미노산치환을보였다. PonA의경우 48주중대조군 2주를포함한 4주를제외하고는모두 19
Leu421Pro 의아미노산치환을보였다. 한편 pilq 의경우 돌연변이 17 가관찰되지않았다. 20
Table 5. Polymorphisms of pena, mtrr, pona, porb and pilq Isolates MIC (µg/ml) Polymorphisms in BL no. PEN Cefixime CRO pena pona mtrr porb pilq 1-0.25 0.008 0.008 XIV WT truncated MtrR WT, WT WT 2-0.5 0.008 0.008 XIV WT truncated MtrR G101K, A102D WT 3-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 4 + >128 0.125 0.06 XIII WT Deletion of A G101K, A102D WT 5 + 128 0.125 0.06 XIII L421P A39T, L47P G101K, A102D WT 6-4 0.125 0.125 XIII L421P Deletion of A G101K, A102D WT 7-4 0.125 0.125 XIII L421P Deletion of A G101K, A102N WT 8 + 32 0.125 0.06 XII L421P A39T, L47P G101K, A102D WT 9-4 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 10-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 11-2 0.125 0.125 XXIV L421P Deletion of A G101K, A102D WT 12-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 13-2 0.125 0.125 XIII L421P Deletion of A G101K, A102D WT 14 + 32 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 15 + 32 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 16-2 0.125 0.06 XIII L421P Deletion of A G101K, A102N WT 17-8 0.5 0.25 X L421P Deletion of A G101K, A102D WT 18-1 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 19-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 20-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 21-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 22-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 23-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 24-2 0.125 0.06 XIII L421P Deletion of A G101K, A102D WT 25-2 0.125 0.125 XIII L421P Deletion of A G101K, A102D WT 26-1 0.125 0.125 XIII L421P Deletion of A G101K, A102G WT 27-2 0.06 0.125 XII L421P Deletion of A G101K, A102D WT 28 + 128 0.25 0.125 IV L421P Deletion of A G101K, A102D WT 29-0.5 0.25 0.125 XIII L421P Deletion of A G101K, A102D WT 30 + >128 0.25 0.25 IV L421P Deletion of A G101K, A102D WT 31-2 0.06 0.125 V L421P Deletion of A G101K, A102D WT 32-4 0.25 0.25 V L421P Deletion of A G101K, A102D WT 33-2 0.125 0.125 V L421P Deletion of A G101K, A102D WT 34-4 0.125 0.125 IV L421P Deletion of A G101K, A102D WT 35-2 0.25 0.25 XIII L421P Deletion of A G101K, A102D WT 36 + 128 0.125 0.125 IV L421P Deletion of A G101K, A102D WT 37-2 0.25 0.125 XIII L421P Deletion of A G101K, A102D WT 38-2 0.125 0.125 XVII L421P Deletion of A G101N, A102D WT 39 + 64 0.06 0.125 IV L421P Deletion of A G101K, A102D WT 40 + 128 0.25 0.125 IV L421P Deletion of A G101K, A102D WT 41-1 0.125 0.125 XIII L421P Deletion of A G101K, A102D WT 42-1 0.06 0.125 XIII L421P Deletion of A G101K, A102D WT 43-1 0.06 0.125 XIII L421P Deletion of A G101K, A102D WT 44 + 128 0.125 0.125 IV L421P Deletion of A G101K, A102D WT 45-2 0.25 0.25 IV L421P Deletion of A G101N, A102D WT 46-1 0.06 0.125 XIII WT Deletion of A G101K, A102D WT 47-4 0.06 0.125 IV L421P Deletion of A G101K, A102D WT 48-2 0.03 0.125 V L421P Deletion of A G101K, A102D WT PEN, penicillin; CRO, ceftriaxone; BL, β-lactamase; WT, wild type. Amino acid abbreviations: see Table 4. 21
IV. 고찰 Cephalosporin 에대한임균의감수성저하는 pena, mtrr, porb 및 pona 유전자다형성과연관되어있다는것이최근 보고되었다. 16 pena 유전자의변이는 2 가지형으로나타날수 있는데, 하나는모자이크형변이 (PBP 2 mosaicism) 이고, 다른하나는 345번과 346번아미노산사이에서 aspartic acid 삽입과함께 5개내외의아미노산잔기가치환된변이이다. 이중 pena 유전자의모자이크형변이가 cephalosporin, 특히경구용제제인 cefixime에대한감수성저하에중요하였다. Takahata 등 18 은유전자변환실험을통해, 모자이크형 pena를획득한균주에대한 ceftriaxone MIC는획득전에비해 4배증가한반면, cefixime MIC는 16배증가하였음을보고하였다. 그러나모자이크형 pena를획득한균주에대한 cefixime MIC가임상분리주에대한 MIC만큼현저히높은것은아니어서임상분리주에서관찰되는정도의감수성저하를나타내기위해서는추가적인유전자돌연변이가필요할것으로생각되었다. 18 Penicillin의염색체성내성에 pena, mtrr, porb 및 pona 유전자 다형성이관여한다는것은이미많이연구되었다. 19 pena 유전자에 변이가발생하면 PBP 2 의 penicillin 친화성이감소되어임균의 15, 20, 21 penicillin 내성이높아지게된다. pona 유전자변이로 PBP 1 의 421 번째아미노산이 proline 에서 leucine 으로치환되면 β- lactam 제의 acylation 율이낮아져내성이유발된다. 19 mtrr 유전자 변이로는 MtrCDE 유출펌프계의발현이증가되어소수성인 erythromycin, azithromycin 및 rifampicin 등에내성이 22
유발된다. 22-26 Penicillin 에내성인임균에서는 mtrr ORF 내에 점변이또는 promoter 의 -10 과 -35 염기서열사이의 13 bp 역방향반복서열위치 (inverted repeat position) 에 1 개의염기쌍 (A/T) 결손이보고되었다. 19 porb 유전자의변이로 Gly101 과 Ala102 위치에서아미노산치환이발생하면 penicillin 과 tetracycline 등친수성항균제의외막투과감소로내성이유발된다. porb 유전자의변이로인한내성은 mtrr 에의한내성이있을때 추가적으로내성을증가시킨다. 27-30 또한 pilq 돌연변이는 pena, mtrr 및 porb 돌연변이가이미획득된상태에서페니실린내성을 증가시킨다. 17, 19 PilQ 는세포막에구멍을형성하는역할을하며, 이를통해항균제가세포질내로들어오게된다. 돌연변이로인하여 PilQ 를통한항균제의투과가감소될경우, 내성이증가할수있다. 그러나 pilq 돌연변이는아직임상분리주에서관찰된적이없으며, 실험실균주에서자발적으로발생한돌연변이만이보고된 17, 19 상태이다. Ceftriaxone 내성에대한이들유전자다형성의영향은 2006 년 Tanaka 등 15 에의해처음보고되었다. Lindberg 등 16 은모자이크형 pena 유전자변이를가진균주들에대한 cefixime MIC 는 0.19-0.38 µg/ml 로다른 pena 유전자변이를가진균주들에대한 MIC (0.032-0.094 µg/ml) 보다높았음을보고하였다. 본 연구에서는 1 주만이모자이크형 pena 유전자를가지고있었고, 이전연구들에서보고된 PBP 2 X 형과아미노산서열이 일치하였다. 13 모자이크형 pena 는 N. perflava, N. cinerea 등의 다른 Neisseria 균종의유전자서열을부분적으로가지고있었으며 다른종들간의유전자재조합에의한것으로생각되었다. 13 상기 23
균주에서는모자이크형 pena 외에 mtrr, porb 및 pona 유전자의돌연변이도함께발견되었다. 이균주에대한 cefixime MIC는 0.5 µg/ml로다른균주들과비교하여가장높은값을보였으며유일하게 cefixime에비감수성이었다. 한편, ceftriaxone에대한감수성저하의경우, 모자이크형 pena 변이를가진균주에대한 ceftriaxone MIC는 0.25 µg/ml로다른 pena 변이를가진균주들에대한 MIC (0.06-0.25 µg/ml) 범위에포함되었다. 이것으로미루어모자이크형 pena 변이는 ceftriaxone보다는 cefixime에대한감수성저하에더중요한요소로생각된다. 최근 Whiley 등 31 의연구에서는모자이크형 pena 변이를가지고있지만 ceftriaxone MIC가 0.008 µg/ml 인균주가보고되었다. 이균주의경우모자이크형아미노산서열이기존에보고된 X형이아닌새로운 XXIII형이었지만 ceftriaxone에높은감수성을보인점이특이하였다. 또한본연구에서다른형태의 pena 변이와 mtrr, porb 및 pona 유전자돌연변이를가진 45주에대한 cefixime MIC는 0.03-0.25 µg/ml이었다. 이중 7주를제외한 38주에대한 cefixime MIC가 0.12 µg/ml-0.25 µg/ml로모자이크형변이를가진균주의 0.5 µg/ml 보다는낮았지만 Lindberg 등 16 이보고한모자이크형변이균주에대한 MIC 결과 (0.19-0.38 µg/ml) 와비슷하였다. 따라서 pena 유전자의모자이크형변이뿐만아니라다른형태의 pena 유전자변이도다른여러관련유전자변이와동반될경우 cefixime에대한감수성저하를유도할수있을것으로생각되었다. 24
PBP 2 의아미노산서열형은이전연구들에서 23 가지가보고 13, 14 되었다. 본 연구에서는 8 가지의 PBP 2 가발견되었고, 그중 XXⅣ형은이전보고에서는발견되지않은새로운형이었다. Cephalosporin에감수성이높았던대조군의경우이전에보고된 XⅣ형을가지고있었고, 당시보고된균주에대한 ceftriaxone MIC는 0.008 µg/ml로본연구와동일하였다. 14 대조군 2주의경우 pona 유전자의돌연변이는발견되지않았으며, mtrr 유전자에서는 promoter 영역의변이가아닌 81번째염기 G의소실로인한미성숙 stop codon 발생으로 41개아미노산으로구성된불완전단백이형성되는변이가발견되었다. 그러나 MtrR의소실은 promoter 영역의변이보다항균제내성에 미치는영향이적다고보고되었다. 25 이것은 mtrr promoter 영역의 변이는 mtrr 과 mtrc 유전자의전사에모두영향을주기때문으로설명되었다. mtrr promoter와 mtrc promoter의위치는서로겹치는데변이로인해 mtrr promoter와 RNA polymerase의결합은감소하지만, 그와반대로 mtrc promoter와 RNA polymerase의결합은증가하여 mrtr의전사감소와동시에 독립적으로 mtrcde 의전사가증가할수있기때문이었다. 25 본 연구에서는 cephaloporin에감수성이높았던대조군에서만불완전 MtrR 단백이발견되었고감수성이저하된실험군들에서는 promoter 영역의변이가관찰되어이전연구결과를뒷받침하였다. 임균에서불완전 MtrR 단백을유발하는돌연변이는본연구에서처음보고되는것이다. 대조군에서공통적으로불완전 MtrR 단백이생성되는것으로미루어보았을때항균제감수성저하에관련된 MtrR 단백의역할은적을것으로생각되며, promoter 영역의 25
돌연변이에의한 mtrcde의전사조절이감수성저하의주요기전으로생각되었다. 하지만정확한 MtrR 단백의역할을규명하기위해서는더많은연구가필요할것으로생각된다. 대조군중 1주에서만 Gly101Lys, Ala102Asp 아미노산변이를일으키는 porb 유전자돌연변이가발견되었고, 이균주는다른대조균주보다 penicillin MIC (0.5 µg/ml vs. 0.25 µg/ml) 가조금높았다. Cephalosporin에감수성이저하된 46주중 44주에서 PonA단백의 Leu421Pro의아미노산치환을발견할수있었다. mtrr의경우 46주중 44주에서 mtrr promoter 영역의변이를발견할수있었고, 나머지 2주에서는 mtrr ORF 내의점변이가발견되었는데, 이전에보고된 Gly45Asp가아닌새로운 Ala39Thr, Leu47Pro 돌연변이가발견되었다. 24 porb 유전자분석에서는감수성저하를보인 46주모두가 101번, 102번아미노산의돌연변이를가지고있었다. 41주가 Gly101Lys, Ala102Asp의아미노산치환을, 2주가 Gly101Lys, Ala102Asn 치환을, 그리고한주는 Gly101Lys, Ala102Gly의치환을보였다. 그리고나머지 2주에서는이전에보고된적이없는새로운 Gly101Asn, Ala102Asp 아미노산치환이 발견되었다. 27 pena, mtrr 및 porb 유전자의돌연변이를모두 가지고있는균주들에서 pona 돌연변이의유무는 cephalosporin 의 감수성저하에영향을주지않았다. 한편 pilq 유전자돌연변이 (Gly666Lys) 는발견되지않았다. PilQ 는 pore 형성단백으로 작용할뿐만아니라 type IV pilus 의생합성에도관여한다. 17 Pili 는 임균의감염에서중요한역할을하기때문에 pilq 돌연변이가임상 균주에서발생하는것은어려울것으로보고되었다. 17 26
Penicillin의고도내성에 pena, mtrr, porb 및 pona의유전자다형성이관여한다는것은이미잘알려져있다. Penicillin 내성과는달리 cephalosporin 내성에관련된대부분의연구들에서는여러관련유전자의다형성보다는모자이크형 pena 변이가주요연구대상이었다. 특히모자이크형 pena는경구용 cephalosporin의감수성저하에중요하게생각되었다. 본연구에서모자이크형 pena 돌연변이를가진균주는 cefixime에가장높은내성을나타내었다. 그러나모자이크형이아닌 pena 변이를가진균주들도 mtrr, porb 및 pona 유전자다형성을동반할경우주사제뿐만아니라경구용제제 (cefixime) 에대해서도비슷한수준의감수성저하를나타내었다. V. 결론 2000년대초반부터임균의 fluoroquinolone 내성으로인해 cephalosporin 항균제사용이증가한국내의환경을고려하여임균의 cephalosporin 항균제내성양상과감수성저하기전을규명하였다. Cephalosporin에감수성이높은균주는 pena, mtrr, porb, pona 및 pilq 유전자의돌연변이가없거나있더라도감수성이저하된균주와다른형태의돌연변이를보였다. Cefixime에비감수성인 1주에서만모자이크형 pena를발견할수있었고나머지감수성저하를보인균주들은다른형태의 pena 변이를가지고있었다. 모자이크형 pena 돌연변이를가진균주가 cefixime에가장높은내성을보였지만모자이크형이아닌 pena 변이를가진균주들도 27
mtrr, porb 및 pona 유전자다형성을동반할경우주사제뿐만아니라경구용제제 (cefixime) 에감수성저하를보일수있음을알수있었다. 각각의 pena, mtrr, porb 및 pona 유전자돌연변이가 cephalosporin 내성에어느정도기여를하는지는더연구가필요할것으로생각되었다. 28
참고문헌 1. Tapsall J. Antibiotic resistance in Neisseria gonorrhoeae is diminishing available treatment options for gonorrhea: some possible remedies. Expert Rev Anti Infect Ther 2006;4:619-28. 2. Seong WK, Chung KT, Kill JY, Kim SH, Oh HB. Antimicrobial Resistance of Neisseria gonorrhoeae Isolated in Korea. Korean J Infect Dis 2001;33:338-45. 3. 항균제내성소식. 1999년 1-12월에분리된세균의항균제감수성. 항균제내성소식지 2000;8:1-2. 4. Birley H, McDonald P, Carey P, Fletcher J. High level ciprofloxacin resistance in Neisseria gonorrhoeae. Genitourin Med 1994;70:292-3. 5. Trees DL, Sirivongrangson P, Schultz AJ, Buatiang A, Neal SW, Knapp JS, et al. Multiclonal increase in ciprofloxacinresistant Neisseria gonorrhoeae, Thailand, 1998-1999. Sex Transm Dis 2002;29:668-73. 6. Dan M, Poch F, Sheinberg B. High prevalence of high-level ciprofloxacin resistance in Neisseria gonorrhoeae in Tel Aviv, Israel: correlation with response to therapy. Antimicrob Agents Chemother 2002;46:1671-3. 7. Shultz TR, Tapsall JW, White PA. Correlation of in vitro susceptibilities to newer quinolones of naturally occurring quinolone-resistant Neisseria gonorrhoeae strains with 29
changes in GyrA and ParC. Antimicrob Agents Chemother 2001;45:734-8. 8. Lee K, Chong Y, Erdenechemeg L, Soon Song K, Hun Shin K. Incidence, epidemiology and evolution of reduced susceptibility to ciprofloxacin in Neisseria gonorrhoeae in Korea. Clin Microbiol Infect 1998;4:627-33. 9. Yong D, Kim TS, Choi JR, Yum JH, Lee K, Chong Y, et al. Epidemiological characteristics and molecular basis of fluoroquinolone-resistant Neisseria gonorrhoeae strains isolated in Korea and nearby countries. J Antimicrob Chemother 2004;54:451-5. 10. Centers for Disease Control and Prevention. Update to CDC's sexually transmitted diseases treatment guidelines, 2006: fluoroquinolones no longer recommended for treatment of gonococcal infections. MMWR Morb Mortal Wkly Rep 2007;56:332-6. 11. Handsfield HH, McCormack WM, Hook EW, 3rd, Douglas JM, Jr., Covino JM, Verdon MS, et al. A comparison of singledose cefixime with ceftriaxone as treatment for uncomplicated gonorrhea. The Gonorrhea Treatment Study Group. N Engl J Med 1991;325:1337-41. 12. Ameyama S, Onodera S, Takahata M, Minami S, Maki N, Endo K, et al. Mosaic-like structure of penicillin-binding protein 2 Gene (pena) in clinical isolates of Neisseria gonorrhoeae with reduced susceptibility to cefixime. 30
Antimicrob Agents Chemother 2002;46:3744-9. 13. Ito M, Deguchi T, Mizutani KS, Yasuda M, Yokoi S, Ito S, et al. Emergence and spread of Neisseria gonorrhoeae clinical isolates harboring mosaic-like structure of penicillin-binding protein 2 in Central Japan. Antimicrob Agents Chemother 2005;49:137-43. 14. Whiley DM, Limnios EA, Ray S, Sloots TP, Tapsall JW. Diversity of pena alterations and subtypes in Neisseria gonorrhoeae strains from Sydney, Australia, that are less susceptible to ceftriaxone. Antimicrob Agents Chemother 2007;51:3111-6. 15. Tanaka M, Nakayama H, Huruya K, Konomi I, Irie S, Kanayama A, et al. Analysis of mutations within multiple genes associated with resistance in a clinical isolate of Neisseria gonorrhoeae with reduced ceftriaxone susceptibility that shows a multidrug-resistant phenotype. Int J Antimicrob Agents 2006;27:20-6. 16. Lindberg R, Fredlund H, Nicholas R, Unemo M. Neisseria gonorrhoeae isolates with reduced susceptibility to cefixime and ceftriaxone: association with genetic polymorphisms in pena, mtrr, porb1b, and pona. Antimicrob Agents Chemother 2007;51:2117-22. 17. Zhao S, Tobiason DM, Hu M, Seifert HS, Nicholas RA. The penc mutation conferring antibiotic resistance in Neisseria gonorrhoeae arises from a mutation in the PilQ 31
secretin that interferes with multimer stability. Mol Microbiol 2005;57:1238-51. 18. Takahata S, Senju N, Osaki Y, Yoshida T, Ida T. Amino acid substitutions in mosaic penicillin-binding protein 2 associated with reduced susceptibility to cefixime in clinical isolates of Neisseria gonorrhoeae. Antimicrob Agents Chemother 2006;50:3638-45. 19. Ropp PA, Hu M, Olesky M, Nicholas RA. Mutations in pona, the gene encoding penicillin-binding protein 1, and a novel locus, penc, are required for high-level chromosomally mediated penicillin resistance in Neisseria gonorrhoeae. Antimicrob Agents Chemother 2002;46:769-77. 20. Dowson CG, Jephcott AE, Gough KR, Spratt BG. Penicillinbinding protein 2 genes of non-beta-lactamase-producing, penicillin-resistant strains of Neisseria gonorrhoeae. Mol Microbiol 1989;3:35-41. 21. Dougherty TJ. Genetic analysis and penicillin-binding protein alterations in Neisseria gonorrhoeae with chromosomally mediated resistance. Antimicrob Agents Chemother 1986;30:649-52. 22. Mavroidi A, Tzouvelekis LS, Kyriakis KP, Avgerinou H, Daniilidou M, Tzelepi E. Multidrug-resistant strains of Neisseria gonorrhoeae in Greece. Antimicrob Agents Chemother 2001;45:2651-4. 32
23. Lucas CE, Balthazar JT, Hagman KE, Shafer WM. The MtrR repressor binds the DNA sequence between the mtrr and mtrc genes of Neisseria gonorrhoeae. J Bacteriol 1997;179:4123-8. 24. Shafer WM, Balthazar JT, Hagman KE, Morse SA. Missense mutations that alter the DNA-binding domain of the MtrR protein occur frequently in rectal isolates of Neisseria gonorrhoeae that are resistant to faecal lipids. Microbiology 1995;141:907-11. 25. Hagman KE, Shafer WM. Transcriptional control of the mtr efflux system of Neisseria gonorrhoeae. J Bacteriol 1995;177:4162-5. 26. Hagman KE, Pan W, Spratt BG, Balthazar JT, Judd RC, Shafer WM. Resistance of Neisseria gonorrhoeae to antimicrobial hydrophobic agents is modulated by the mtrrcde efflux system. Microbiology 1995;141:611-22. 27. Liao M, Bell K, Gu WM, Yang Y, Eng NF, Fu W, et al. Clusters of circulating Neisseria gonorrhoeae strains and association with antimicrobial resistance in Shanghai. J Antimicrob Chemother 2008;61:478-87. 28. Unemo M, Olcen P, Berglund T, Albert J, Fredlund H. Molecular epidemiology of Neisseria gonorrhoeae: sequence analysis of the porb gene confirms presence of two circulating strains. J Clin Microbiol 2002;40:3741-9. 29. Olesky M, Hobbs M, Nicholas RA. Identification and analysis 33
of amino acid mutations in porin IB that mediate intermediate-level resistance to penicillin and tetracycline in Neisseria gonorrhoeae. Antimicrob Agents Chemother 2002;46:2811-20. 30. Gill MJ, Simjee S, Al-Hattawi K, Robertson BD, Easmon CS, Ison CA. Gonococcal resistance to beta-lactams and tetracycline involves mutation in loop 3 of the porin encoded at the penb locus. Antimicrob Agents Chemother 1998;42:2799-803. 31. Whiley DM, Limnios EA, Ray S, Sloots TP, Tapsall JW. Further questions regarding the role of mosaic pena sequences in conferring reduced susceptibility to ceftriaxone in Neisseria gonorrhoeae. Antimicrob Agents Chemother 2007;51:802-3. 32. Ilina EN, Vereshchagin VA, Borovskaya AD, Malakhova MV, Sidorenko SV, Al-Khafaji NC, et al. Relation between genetic markers of drug resistance and susceptibility profile of clinical Neisseria gonorrhoeae strains. Antimicrob Agents Chemother 2008;52:2175-82. 34
Abstract Prevalence and mechanism of reduced susceptibility to cephalosporin of Neisseria gonorrhoeae in Korea Sang-Guk Lee Department of Medicine The Graduate School, Yonsei University (Directed by Professor Kyungwon Lee) The options for the effective treatment of Neisseria gonorrhoeae infections have been significantly reduced over time by the emergence and spread of gonococci resistant to the penicillins, tetracyclines, and quinolone groups of antibiotics. Cephalosporin antibiotics are now the mainstay of treatment in many settings. Therefore, the surveillance of cephalosporin resistance is required. We undertook the primary isolation of N. gonorrhoeae from clinical samples from sexually transmitted disease clinics and public heath centers during 2001 2007. Antimicrobial susceptibility was determined by agar dilution 35
method in randomly selected 208 isolates. Among these, 46 (22.1%) isolates with decreased susceptibility to cephalosporins and two highly susceptible isolates (controls) were tested for pena, mtrr, porb, pona, and pilq polymorphisms. In present study, eight patterns in amino acid sequence of penicillin binding protein 2 (PBP 2) were found, and one of them was new one (XXIV). We found mosaic PBP 2 in only one isolate, and this exhibited the increased cefixime MIC (0.5 µg/ml). In mtrr gene analysis, control isolates had incomplete MtrR protein. In contrast, the isolates with reduced susceptibility to cephalosporins had deletions in promoter region (44 isolates) or point mutations (Ala39Thr, Leu47Pro) within mtrr ORF (2 isolates). All isolates except one control isolate had two amino acid substitutions at 101 and 102 position of PorB. Control isolates had no mutation in pona gene. The isolates with reduced susceptibility had Leu421Pro in PonA except two isolates. However, cephalosporin susceptibility was not different between isolates with pona mutation and without the mutation if other genetic polymorphisms were same. In addition, pilq mutation was not detected in all isolates tested. In present study, the isolate with mosaic pena showed 36
the highest resistance to cephalosporins, especially to oral cefixime. However, the isolates with other type of pena mutation can exhibit reduced susceptibility to both oral and injectable cephalosporins when accompanied by mtrr, porb, pona polymorphisms. ---------------------------------------------- Key words: Neisseria gonorrhoeae, pena, mtrr, porb, pona, pilq, mosaic, cephalosporin, reduced susceptibility 37