농약과학회지 (Korean J. Pestic. Sci.) Vol. 20, No. 3, pp. 189-196 (2016) Open Access http://dx.doi.org/10.7585/kjps.2016.20.3.189 Online ISSN 2287-2051 Print ISSN 1226-6183 ORIGINAL ARTICLES / SYNTHESIS / FORMULATION / CONTROL 복합기능성 Bacillus sp. GH1-13 균주의특징 김상윤 상미경 원항연 전영아 1 류재환 2 송재경 * 농촌진흥청국립농업과학원농업미생물과, 1 농촌진흥청국립농업과학원농업유전자원센터, 2 전주대학교농생명EM환경연구센터 Characterization of Multifunctional Bacillus sp. GH1-13 Sang Yoon Kim, Mee Kyung Sang, Hang-Yeon Weon, Young-Ah Jeon 1, Jae Hwan Ryoo 2 and Jaekyeong Song* Agricultural Microbiology Division, National institute of Agricultural Sciences, RDA 55365, Republic of Korea 1 RDA-Genebank Information Center, National institute of Agricultural Sciences, RDA 54874, Republic of Korea 2 Research Center for Agro-Bio EM & Environmental Resources, Jeonju University 55065, Republic of Korea (Received on July 26, 2016. Revised on September 6, 2016. Accepted on September 11, 2016) Abstract Several microorganisms in particular Bacillus subtilis group have been isolated from diverse places such as soils and the gastrointestinal tract of ruminants etc., and used as biocontrol agent against various plant pathogens and utilized as plant growth promoting agents. Among them, Bacillus is well known as one of the most useful bacteria for biocontrol and plant growth promotion. Bacterium GH1-13 was isolated from a reclaimed paddy field in Wando Island and identified as Bacillus velezensis using phylogenetic analysis on the basis of 16S rrna and gyrb gene. It was confirmed that GH1-13 produced indole acetic acid (IAA) associated with promoted growth of rice root. GH1-13 showed characteristics of antagonization against the main pathogen of rice as well as diverse pathogenic fungi. GH1-13 had biosynthetic genes, bacillomycin, bacilycin, fengycin, iturin, and surfactin which are considered to be associated closely with inhibition of growth of pathogenic fungi and bacteria. This study showed that GH1-13 could be used as a multifunctional agent for biocontrol and growth promotion of crop. Key words Bacillus, biocontrol, growth promotion, multifunction, secondary metabolites. 서 론 농업에서작물의병을방제하고생산성을증대시키기위해다량으로사용되고있는화학농약과비료를대체할수있는환경친화적인소재로서미생물에대한연구가많이이루어지고있다 (Avis et al., 2008; Santoyo et al., 2012). 최근다양한미생물이시설하우스, 밭, 과수원등의농업현장에서활용되고있으며, 시군농업기술센터에서다양한미생물을배양하여농가에공급하고있다. 많은시군농업기술센터에서배양하여보급하는미생물은주로바실러스 (Bacillus), 유산균 (Lactic acid bacteria), 효모 (Saccharomyces), 광합성균 (Photosynthetic bacteria) 등이며몇몇곰팡이 (Aspergillus) *Corresponding author E-mail: mgjksong@korea.kr 와방선균 (Streptomyces), 슈도모나스 (Pseudomonas) 등도활용되고있다. 이들중바실러스는작물의생육촉진, 병저항성증진, 병방제뿐아니라해충방제, 악취저감, 사료제조등의목적으로다양한농업현장에사용되고있다 (Velivelli et al., 2014). 바실러스는 non-ribosomal peptide synthetase (NRPS) 와 polyketide synthase (PKS) 를이용하여관련된여러항생제뿐만아니라다양한휘발성물질등을생산하여식물의생장을촉진하고병저항성을강화시켜병방제에도효과가있는것으로알려져있다 (Ongena and Jacques, 2008; Insam and Seewald, 2010; Raaijmakers et al., 2010; Chowdhury et al., 2015). 오이 (Cucumis sativus) 균핵병을방제할수있는 Bacillus sp. M27 균주와벼 (Oryza sativa) 의생육촉진및병을억제할수있는 Bacillus vallismortis EXTN-1 등이 189
190 김상윤 상미경 원항연 전영아 류재환 송재경 일반적으로알려져있다 (Park et al., 2006; Lee et al., 2013). 인삼밭토양으로부터미생물을분리하여인삼 (Panax ginseng) 뿌리썩음병균에길항력이있는바실러스균주를선발하여동정하고, 항진균활성에대한특성조사또한이루어진바있다 (Kim et al., 2012). 최근친환경농산물의수요증대와저농약농산물의폐지등으로작물병방제및생육촉진등의활성을가진미생물제의수요가증대하고있으며, 특히내생포자를생성하여제제화하기가용이한바실러스는다양하게미생물제재로서개발되어상용화되고있다 (Nicholson, 2002; Cawoy et al., 2011). 이와같이친환경미생물제의개발을위해작물의근권및주변토양뿐아니라다양한환경으로부터유용한미생물을분리하여특성을밝히고현장에적용하는연구가수행되고는있으나여전히생육촉진과병방제를동시에수행하는미생물에대한연구는미흡한실정이다. 본연구에서는간척지작물의병방제와더불어생육촉진등에활용할수있는유용미생물을분리하기위해대표간척지 3지역 ( 전남고흥, 충남당진, 전남완도 ) 의논으로부터시료를채취하여염에내성을가지며, 작물의주요병원균에대한길항활성이우수한균주를선발하고특성을분석하였으며, 16S rrna와 gyrb 유전자를이용하여동정하였다. 재료및방법 균주분리내염성을가지며, 작물생육촉진및병방제에활용할수있는세균을분리하기위해 2015년 5월간척지논 ( 전남고흥, 충남당진, 전남완도일대 ) 에서약 1cm의표토를제거하고오우거 (auger) 를이용하여 15 cm까지의토양을채취하였다. 각시료 1g을 9ml의멸균수에현탁하여 3% NaCl을 Table 1. Antagonistic activity of Bacillus sp. GH1-13 against diverse crop pathogenic bacteria and fungi. Length of inhibition zones were measured in triplicate. No inhibition zones were found in the control in this study Pathogens Strain/KACC a) Inhibition zones (mm) numbers Rep. 1 b) Rep. 2 Rep. 3 Anthracnose Colletotrichum acutatum KACC 40804 10.2 10.9 9.9 Bakanae disease Gibberella moniliformis KACC 44022 6.8 6.2 6.2 Bakanae disease Fusarium fujikuroi RGF-1 6.4 5.6 4.6 Bakanae disease F. fujikuroi RGF-29 4.9 4.6 5.7 Bakanae disease F. fujikuroi RGF-54 6.9 6.9 6.9 Bakanae disease F. fujikuroi RGF-77 8.0 8.0 8.8 Black mold Alternaria alternata KACC 40019 8.5 9.9 9.0 Blast Pyricularia grisea KACC 40435 17.1 17.1 16.8 Blight Xanthomonas oryzae KACC 10331 7.4 7.9 8.3 Brown spot Cercospora capcisi KACC 42531 14.7 13.4 14.9 Brown spot Bipolaris oryzae KACC 41025 13.3 13.7 14.6 Brown streak Acidovorax avenae KACC 10162 4.4 5.3 5.2 Canker Clavibacter michiganensis KACC 16995 4.0 4.7 4.1 Damping-off Phythium ultimum KACC 40705 10.0 10.5 8.6 Grain rot Burkholderia glumae KACC 10138 2.0 2.0 2.9 Gray mold Botrytis cinerea KACC 40573 8.3 8.0 11.3 Phytophthora blight Phytophthora capcisi KACC 40483 11.8 10.7 11.6 Root rot Fusarium oxysporum KACC 40037 7.6 6.6 8.6 Root rot Sclerotinia nivalis KACC 45152 8.5 8.6 8.7 Root rot Fusarium solani KACC 44891 5.2 5.8 5.8 Root rot Cylindrocarpon destructans KACC 41077 12.1 11.4 12.5 Scab Streptomyces acidophilus S70 7.2 7.4 6.0 Scab Streptomyces scabiei S28 3.8 4.5 ND c) Sclerotinia rot Sclerotinia sclerotiorum KACC 40457 10.1 10.8 10.6 Sheath blight Rhizoctonia solani KACC 40123 9.6 11.9 11.1 Soft rot Pectobacterium carotovorum KACC 11130 2.5 0.7 1.3 a) Korean agricultural culture collection. b) Replicate. c) Not detected
Multifunctional Bacillus sp. GH1-13 191 포함한 R2A 배지에현탁액 0.1 ml를도말한후 28 o C 항온기에서 3일간배양하였다. R2A배지의조성은 Yeast extract 0.5 g, Proteose peptone 0.5 g, Casamino acids 0.5 g, Glucose 0.5 g, Soluble starch 0.5 g, Na-pyruvate 0.3 g, K 2 HPO 4 0.3 g, MgSO 4 7H 2 O 0.05 g, Agar 15.0 g, distilled water 1,000 ml 이며 ph 7.0으로조절하였다. 다양한세균을분리하기위해무작위로다른형태나색깔을보이는집락을순수분리하였다. 분리균주의항균활성검정분리균주의항균활성검정은대치배양법을이용하였다. 병원성곰팡이인경우페트리접시에서병원균과분리균을대치배양하여식물병원균의생장저해능을검정하였으며, 세균인경우병원균을배지에도말한후분리균을그위에접종하여 3-5일간배양한후분리균에의한식물병원균의생장저해능을검정하였다. 사용된균주는벼에해를입히는주요병원균및다양한작물에서해를입히는주요병원균을사용하였으며, 이들균주는농촌진흥청농업유전자원센터 (Korean Agricultural Culture Collection (KACC), www.genebank.go.kr) 에서분양받아사용하였다 (Table 1). Table 2. Primers used in this study Antibiotic Gene Primers Primer sequence (5-3 ) References Bacilysin bacd BACD-F1 AAAAACAGTATTGGTYATCGCTGA Chung et al. (2008) BACD-R1 CCATGATGCCTTCKATRCTGAT Bacillomycin D bmya BACC1F GAAGGACACGGCAGAGAGTC Athukorala et al. (2009) BACC1R CGCTGATGACTGTTCATGCT Fengycin fend FEND1F TTTGGCAGCAGGAGAAGTTT Athukorala et al. (2009) FEND1R GCTGTCCGTTCTGCTTTTTC Iturin A itua ITUD1F GATGCGATCTCCTTGGATGT Athukorala et al. (2009) ITUD1R ATCGTCATGTGCTGCTTGAG Surfactin srfa SUR3F ACAGTATGGAGGCATGGTC Athukorala et al. (2009) SUR3R TTCCGCCACTTTTTCAGTTT Zwittermicin A zwia ZWITF2 TTGGGAGAATATACAGCTCT Athukorala et al. (2009) ZWITR1 GACCTTTTGAAATGGGCGTA 16S 27F AGAGTTTGATCCTGGCAC Kim et al. (2012), rrna 1492R TACGGYTACCTTGTTACGACTT Song et al. (2004), 518F CCAGCAGCCGCGGTAATACG Ahn et al. (2014) 800R TACCAGGGTATCTAATCC 984F ACGCGARGAACCTTAC gyrb UP-1 UP-2r UP-1S UP-2Sr 선발균주의생육촉진활성검정선발균주의생육촉진활성을검정하기위해 L-tryptophan 을첨가한배지 (0.1% wt/v) 와무첨가 R2A broth배지에각각균주접종후 30 o C, 150 rpm에서약 48시간동안균주를배양하였다. 균주밀도가 1 10 9 cfu/ml 수준으로배양완료된배약액 1ml를 4 o C, 4000 rpm, 15분간원심분리하여균체를침강시킨후상등액만회수하였다. 배양상등액 0.5 ml 과 Salkowski 시약 1 ml (35% HClO 4 50 ml, 0.5 M FeCl 3 1mL) 을혼합하여상온에서 30분간반응시킨후분광광도계 (Infinite 200 PRO multimode reader, Tecan, Austria) 를이용하여 530 nm에서흡광도를측정하여균주의 IAA 생성능을확인하였다. 이때표준곡선은 Sigma사의 IAA (Indole- 3-Acetic Acid) 를 0, 10, 30, 50, 100 mg/l 농도로제조하여 R2A broth 배지에첨가후시료와동일한조건하에서반응후측정하였다 (Naqqash et al., 2016). 선발균주의작물생육촉진활성을검정하기위해 tryptic soy broth (TSB) 배지에서 40시간배양 ( 약 1 10 9 cfu/ml) 한후, 균체를 13,000 rpm, 15분간원심분리하고멸균증류수로두번세척하였다. TSB배지의조성은 Tryptone 17.0 g, Soytone 3.0 g, Glucose 2.5 g, Sodium Chloride 5.0 g, Dipotassium hydrogen phosphate 2.5 g, distilled water GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAART- TYGA AGCAGGGTACGGATGTGCGAGCCR TCNACRTCNGCRTC- NGTCAT GAAGTCATCATGACCGTTCTGCA AGCAGGGTACGGATGTGCGAGCC Fukushima et al. (2002), Yamamoto and Harayama (1995)
192 김상윤 상미경 원항연 전영아 류재환 송재경 1,000 ml이며, ph 7.3으로조절하였다. 수확한선발균주의균체는 0.03 M MgSO 4 용액에 1 10 6 cfu/ml의농도로현탁하였다. 활성검정대상작물인벼, 토마토 (Solanum lycopersicum), 오이종자는 1차소독액 (70% 에탄올, 0.1% Triton X-100) 에서 1분간침지한후, 2차소독액 (10% 차아염소산 (NaOCl), 0.1% Triton X-100) 에 15분간침지하였다. 침지된종자를멸균수로 5번세척하여준비하였다. 각종자를선발균주의현탁액 (A600 0.5) 에 3시간침지한후풍건하고생육검정파우치 (PhytoTC, USA) 에종자를올려놓고 28 o C 항온기 (16시간광조건 ) 에서 10일간배양한후줄기의생육길이와무게, 뿌리의발달개수및뿌리털의발달개수를육안으로관측후계수하였다. 선발균주의이차대사물질유전자의검출바실러스의병원균에대한길항활성을나타내는NRPS와 PKS의합성관련유전자를검출하기위해특이프라이머를활용하여 PCR을실시하였다 (Athukorala et al. 2009) (Table 2). PCR은 PCR 반응혼합액 (2X TOPsimple DyeMIX- Tenuto; Enzymonics Co., Korea) 을이용하였으며, 1 ul의 genomic DNA (30 ng) 와 10 pmol의프라이머를혼합하여 20 ul를최종부피로하여실행하였다. PCR은초기변성반응 (initial denaturation; 95 o C, 3분 ) 후, 증폭반응 ( 변성 ; 95 o C 30초, 결합 ; 55 o C 45초, 신장 ; 72 o C 1분 ) 을 30회반복하였으며, 최종신장반응은 72 o C에서 5분간실시하였다. 증폭한 PCR 산물은전기영동하여존재여부및크기를확인하였다. 선발균주의동정 GH1-13 균주의동정을위해 16S rrna 유전자와 Bacillus spp. 의분류에유용한 gyrb 유전자 (DNA gyrase유전자 ) 의염기서열을분석하였다 (Wang et al., 2007). GH1-13 균주는 TSB에접종하여 28 o C에서 24시간이상배양한후원심분리하여균체를수확하였다. QIAamp DNA mini kit (Qiagen, USA) 를이용하여 genomic DNA를추출하였다. 16S rrna 유전자는범용프라이머인 27F와 1492R을사용하였고, gyrb 유전자는범용프라이머 UP-1과 UP-2r을사용하여 PCR한후각각유전자의증폭산물을얻었다 (Yamamoto and Harayama, 1995; Song et al., 2004). 16S rrna 유전자의염기서열분석은3개의프라이머 (800R, 518F, 984F) 를이용하고 gyrb 유전자는두개의염기서열분석용프라이머 (UP-1S, UP-2Sr) 를이용하여분석하도록제노텍 ( 대전, 한국 ) 에의뢰하였다 (Table 1). 얻어진염기서열은 Seqman (DNASTAR, USA) 을이용하여직접오류를검정하고연결하였다. 각유전자의비교분석을위해서 16S rrna 유전자의염기서열은 EzTaxon-e 서버를통해서얻었으며, gyrb 유전자의염기서열은 Genbank (www.ncbi.nlm.nih/genbank) 를통하여얻었 다. 계통도의작성을위해 MEGA 5.0 프로그램의 Clustal W 프로그램으로염기서열을정렬하였으며, Neighbor-joining 알고리즘을사용하고 1,000회반복 bootstraping을통해계통도의신뢰성을확인하였다 (Tamura et al., 2011). 통계분석통계분석은 SAS 프로그램 ( 버전 9.2) 을이용하여실시하였으며, t-검정을통해유의수준 5% 에서균주처리에따른생육증진효과를비교하였다. 결과및고찰 균주분리및항균활성검정간척지로알려진전남고흥군, 충남당진군, 전남완도군일대의논토양으로부터내염성이있는균주총 137균주를분리하였다. 분리한균주의 45% 는 Bacillus 속에속한균주였으며, 이들중대부분 (80%) 은 B. aryabhattai와 B. marisflavi, B. stratosphericus, B. megaterium 등인것으로분석되었다. 대치배양법을이용하여분리균주의벼의주요병원균에대한항균활성검정을수행한결과, 벼의주요병원균에대한생장억제활성을나타내는다양한세균을확인하였으며이들중가장강한활성을보이는바실러스균주 (GH1-13) 를선발하였다 (Fig. 1). GH1-13 균주는벼의주요곰팡이병원균인 Fusarium fujikuroi ( 키다리병균 ), Pyricularia grisea ( 도열병균 ), Bipolaris oryzae ( 깨씨무늬병균 ), Rhizoctonia solani ( 잎집무늬마름병균 ) 에대한강한활성을보였으며, 벼의주요세균병원균인 Xanthmonas oryzae ( 흰잎마름병균 ), Acidovorax avenae ( 세균성줄무늬병균 ), Burkholderia glumae ( 알마름병균 ) 에대해서도생육억제능을보였다 (Fig. 1). 또한 GH1-13은다양한작물에병을일으키는것으로알려진 Cercospora capsici ( 갈색무늬병균 ), Phytophthora capcisi ( 역병균 ), Sclerotinia sclerotiorum ( 균핵병균 ), Colletotrichum acutatum ( 탄저병균 ), Alternaria alternata ( 검은곰팡이병균 ), Botrytis cinerea ( 잿빛곰팡이병균 ), Fusarium oxysporum ( 뿌리썩음병균 ), Streptomyces scabiei ( 더뎅이병균 ), Clavibacter michiganensis ( 궤양병균 ), Pectobacterium carotoborum ( 무름병균 ) 에대한생육억제활성을보였다 (Table 1). 인삼뿌리썩음병의원인균인 Cylindrocarpon destructans ( 뿌리썩음병균 ), Sclerotinia nivalis ( 뿌리썩음병균 ) 에대한강한생육억제활성을보였다 (Table 1). 이결과를통해 GH1-13균주가벼를포함한다양한작물의병해방제를위한미생물제로서의잠재적가치가큰것으로평가된다. 향후실제농가에서생물검정을바탕으로 GH1-13 균주의현장적용성평가가수행되어야할것으로판단되며, 이를바탕으로토착세균을이용한우수한미생물제로서의활용가능성확인및다
Multifunctional Bacillus sp. GH1-13 193 Fig. 1. Growth inhibition of pathogenic fungi and bacteria of rice (Oryza sativa L.) by Bacillus sp. GH1-13. (A) Gibberella moniliformis KACC 44022 and Fusarium fujikuroi, (B) Bipolaris oryzae KACC 41025, (C) Pyricularia grisea KACC 40435, (D) Rhizoctonia solani KACC 40123, (E) Xanthomonas oryzae KACC 10331, (F) Acidovorax avenae KACC 10162, (G) Burkholderia glumae KACC 10138. Fig. 2. IAA production potential from several Bacillus stains in the presence or absence of tryptophan in R2A media. Bars indicate standard deviations (n=3). 양한병원균에대한생육억제활성기작에대한연구가진행되어야할것으로여겨진다. 선발균주의생육촉진활성검정 GH1-13 균주의 IAA 생성능을분석한결과, tryptophan 이 배지에추가되었을때의 IAA생성량 (31.4 µg/ml) 은없을때의생성량 (6.3 µg/ml) 보다약 5배정도증가되었으며타바실러스균주와비교하여큰차이를나타내지는않았다 (Fig. 2). 이는 GH1-13균주가 tryptophan을전구체로사용하여 IAA 를만드는 tryptophan 의존형경로를가진세균이라는것을보여준다 (Idris et al., 2007). 작물생육촉진활성을검정하기위하여 GH1-13 균주로침지처리한벼, 토마토, 오이의종자를생육검정파우치를이용하여검정하였다 (Fig. 3). 토마토와오이에대한생육촉진효과는통계적으로유의한차이가없는것으로나타났다. 벼의경우뿌리의길이에대한생육촉진효과는통계적인차이는없었으나뿌리털의개수에는통계적인유의성을보였다 (p<0.05, n=9)(fig. 3). 이러한결과는 GH1-13 균주가식물생육촉진과관련있는IAA같은물질분비를통해벼뿌리털의발달을촉진시켜벼의생육을촉진하는역할을하는것으로판단된다 (Richardson et al., 2009). 이러한균주의특징을이용하여벼의직파에활용한다면벼의생장초기에뿌리의발달에도움을줌으로써입모율을향상시켜벼의생육및생산성을개선할수있는미생물제의개발이가능할것으로여겨진다.
194 김상윤 상미경 원항연 전영아 류재환 송재경 Fig. 3. Growth promotion effects on cucumber, rice and tomato root after soaking seed into cell suspension (1 106 cfu/ml) of Bacillus sp. GH1-13. (p<0.05, n=9). NS means not significant, and * denote significance at the p<0.05 level. Bars indicate standard deviations (n=9). Fig. 4. Detection of biosynthetic genes of Bacillus sp. GH1-13 by PCR amplification. M. marker (100 bp ladder), 1; bacilysin (bacd, 749 bp), 2; bacillomycin (BmyA, 875 bp), 3; iturin (itua, 647 bp), 4; surfactin (srfa, 441 bp), 5; fengycin (fend, 964 bp), 6; zwittermicin (zwia, 779 bp). PCR products were detected on 1.5% agarose gel. Fig. 5. Neighbor-joining phylogenetic tree based on partial 16S rrna (A) and gyrb (B) gene sequences (1,416 bp and 1,065 bp, respectively) of Bacillus strains. Bootstrap values are indicated at branch points. Strain or culture collection and accession numbers are indicated next to species name. T means type strain. 선발 균주의 길항활성 관련 유전자의 검출 GH1-13 균주는 벼의 주요 병원균뿐만 아니라 채소 등의 작물에서 발생하는 많은 병원균, 특히 진균에 의한 병원균 에 강한 길항 활성을 보였다(Fig. 1). 이는 바실러스 균주들 이 다양한 생합성 유전자를 이용하여 2차 대사산물을 생산 하는 것처럼 GH1-13균주가 생합성 유전자를 가지고 관련된 항생 물질을 생산할 것으로 판단하여 기존에 알려진 생합성 유전자, bacd (bacilycin), bmya (bacillomycin D), fend (fengycin), itua (iturin A), srfa (surfactin), and zwia (zwittermicin A)를 검출할 수 있는 특이 프라이머를 이용하 여 PCR을 수행하였다(Ramarathnam et al., 2007; Athukorala et al., 2009; Kim et al., 2012)(Fig. 4). GH1-13 균주는 bacillomycin D (875 bp), bacilycin (749 bp), fengycin (964 bp), iturin (647 bp), surfactin (441 bp)을 생성하는 유전자를 지
Multifunctional Bacillus sp. GH1-13 195 니는것으로조사되었으나, zwittermicin 생성관련유전자는검출되지않았다. Kim et al. (2012) 에의해보고된 Bacillus amyloliquifaciens GR4-5 균주와비교할때 fengycin 생합성유전자가추가적으로존재함을확인하였으며더불어세균에길항력을보이는 bacilycin 생합성유전자도확인하였다. 이러한결과는 GH1-13균주가다양한작물의진균및세균성병원균의생육을억제할수있는강력한미생물제로개발될수있음을보여준다. 선발균주의동정 GH1-13 균주의동정을위해 16S rrna와 gyrb 유전자를바탕으로 MEGA5 프로그램을이용하여분자유전학적인계통도를작성하였다 (Fig. 5). 16S rrna 유전자를바탕으로작성한계통도에서 GH1-13 균주는 Bacillus methylotrophicus KACC 13105(T) 균주와높은상동성 (100%) 을보였다 (Fig. 5(a)). 계통도의신뢰성을확보하기위한 Bootstrap 값도 69% 로비교적높은값을나타내어 Bacillus methylotrophicus 인것으로추정되었다. gyrb 유전자를바탕으로작성한계통도에서 GH1-13 균주는 Bacillus velezensis BCRC 17467 (T) 균주와 Bacillus methylotrophicus KACC 13105(T) 균주에같은높은상동성 (98.6%) 을보였다 (Fig. 5(b)). 최근계통유전체학을바탕으로두종 (B. methylotrophicus와 B. velezensis) 과더불어 B. amyloliquefaciens subsp. plantarum 과 B. oryzicola를포함하여모두 B. velezensis로분류되어져야한다고보고되었다 (Dunlap et al., 2016). 16S rrna 유전자와 gyrb 유전자의분석결과와 Dunlap et al. (2016) 의보고에따라 GH1-13 균주의분류학적인위치는 B. velezensis로판단된다. 결론적으로본연구에서는 B. velezensis GH1-13균주가작물의생육촉진과병방제를동시에해결할수있는강력한복합기능성미생물제로의가능성이있음을보여주었다. 그러나 B. velezensis GH1-13균주처리가실제현장에서항균활성에미치는영향에대한보다정밀한평가가요구되며, 현장적용성평가를위한후속연구가수행되어져야할것으로판단된다. 감사의글 본연구는농촌진흥청공동연구사업 ( 과제번호 : 010825) 의지원에의해수행되었습니다. Literature Cited Ahn, J. H., B. C. Kim, B. Y. Kim, S. J. Kim, J. Song, S. W. Kwon and H. Y. Weon (2014) Paenibacillus cucumis sp. nov. Isolated from Greenhouse Soil. J Microbiol. 52(6): 460-464. Athukorala, S. N. P., W. G. D. Fernando and K. Y. Rashid (2009) Identification of antifungal antibiotics of Bacillus species isolated from different microhabitats using polymerase chain reaction and maldi-tof mass spectrometry. Can. J. Microbiol. 55(9):1021-1032. Avis, T. J., V. Gravel, H. Antoun and R. J. Tweddell (2008) Multifaceted beneficial effects of rhizosphere microorganisms on plant health and productivity. Soil Biol. Biochem. 40(7):1733-1740. Cawoy, H., W. Bettiol, P. Fickers and M. Ongena (2011) Bacillus-based biological control of plant diseases, p. 273-302. In D.M. Stoytcheva (ed.), Pesticides in the modern world - pesticides use and management, InTech. Chowdhury, P. S., A. Hartmann, X. Gao and R. Borriss (2015) Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42 - a review. Front. Microbiol. 6(780):1-11. Dunlap, C. A., S. J. Kim, S. W. Kwon and A. P. Rooney (2016) Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. Plantarum and Bacillus oryzicola are later heterotypic synonyms of Bacillus velezensis based on phylogenomics. Int. J. Syst. Evol. Microbiol. 66(3):1212-1217. Fukushima, M., K. Kakinuma and R. Kawaguchi (2002) Phylogenetic analysis of Salmonella, Shigella, and Escherichia coli strains on the basis of the gyrb gene sequence. J. Clin. Microbiol. 40(8):2779-2785. Idris, E. E., D. J. Iglesias, M. Talon and R. Borriss (2007) Tryptophan-dependent production of indole-3-acetic acid (iaa) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol. Plant-Microbe Interact. 20(6):619-626. Insam, H. and M. S. A. Seewald (2010) Volatile organic compounds (vocs) in soils. Biol. Fertil. Soils 46(3):199-213. Kim, B. Y., J. H. Ahn, H. Y. Weon, J. Song, S. I. Kim and W. G. Kim (2012) Isolation and characterization of Bacillus species possessing antifungal activity against ginseng root rot pathogens. Korean J. Pestic. Sci. 16(4):357-363. Lee, S. Y., H. Y. Weon, J. J. Kim, J. H. Han and W. G. Kim (2013) Control effect of the mixture of Bacillus amyloliquefaciens M27 and plant extract against cucumber powdery mildew. Korean J. Pestic. Sci. 17(4):435-439. Naqqash, T., S. Hameed, A. Imran, M. K. Hanif, A. Majeed and J. D. van Elsas (2016) Differential response of potato toward inoculation with taxonomically diverse plant growth promoting rhizobacteria. Front. Plant Sci. 7(1):144. Nicholson, L. W. (2002) Roles of Bacillus endospores in the environment. Cell. Mol. Life Sci. 59(3):410-416. Ongena, M. and P. Jacques (2008) Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 16(3):115-125. Park, K., D. Paul and W. H. Yeh (2006) Bacillus vallismortis extn-1-mediated growth promotion and disease suppression
196 김상윤 상미경 원항연 전영아 류재환 송재경 in rice. Plant Pathol. J. 22(3):278-282. Raaijmakers, J. M., I. De Bruijn, O. Nybroe and M. Ongena (2010) Natural functions of lipopeptides from Bacillus and Pseudomonas: More than surfactants and antibiotics. Fems Microbiol. Rev. 34(6):1037-1062. Ramarathnam, R., S. Bo, Y. Chen, W. G. D. Fernando, G. Xuewen and T. de Kievit (2007) Molecular and biochemical detection of fengycin- and bacillomycin d-producing Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Can. J. Microbiol. 53(7):901-911. Richardson, A. E., J. M. Barea, A. M. McNeill and C. Prigent- Combaret (2009) Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil 321(1):305-339. Santoyo, G., M. d. C. Orozco-Mosqueda and M. Govindappa (2012) Mechanisms of biocontrol and plant growthpromoting activity in soil bacterial species of Bacillus and Pseudomonas: A review. Biocontrol Sci. Technol. 22(8): 855-872. Song, J., S. C. Lee, J. W. Kang, H. J. Baek and J. W. Suh (2004) Phylogenetic analysis of streptomyces spp. Isolated from potato scab lesions in korea on the basis of 16s rrna gene and 16s-23s rdna internally transcribed spacer sequences. Int. J. Syst. Evol. Microbiol. 54(1):203-209. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar (2011) Mega 5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28(10): 2731-2739. Velivelli, S. L. S., P. De Vos, P. Kromann, S. Declerck and B. D. Prestwich (2014) Biological control agents: From field to market, problems, and challenges. Trends Biotechnol. 32(10):493-496. Wang, L. T., F. L. Lee, C. J. Tai and H. Kasai (2007) Comparison of gyrb gene sequences, 16s rrna gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int. J. Syst. Evol. Microbiol. 57(8):1846-1850. Yamamoto, S. and S. Harayama (1995) PCR amplification and direct sequencing of gyrb genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl. Environ. Microbiol. 61(3):1104-1109. 복합기능성 Bacillus sp. GH1-13 균주의특징 김상윤 상미경 원항연 전영아 1 류재환 2 송재경 * 농촌진흥청국립농업과학원농업미생물과, 1 농촌진흥청국립농업과학원농업유전자원센터, 2 전주대학교농생명 EM 환경연구센터 요약바실러스는토양및반추동물의소화기관과같은다양한곳에서분리되고있으며, 작물의생육촉진과병방제를위한미생물재제로서널리사용되고있다. 바실러스 GH1-13 균주는전남완도의간척지논에서분리되었으며, 16S rrna 유전자와 gyrb 유전자를이용하여계통유전학적으로분석한결과 Bacillus velezensis 인것으로동정되었다. GH1-13 균주의특성을분석한결과생육촉진에관련된 IAA 를생성할뿐아니라벼뿌리의생육을촉진하는것을확인하였다. 또한벼의주요병원균의생육을억제할뿐아니라작물의병원균인다양한곰팡이의생육을저해하였다. 더불어식물병원진균및세균의생육억제와밀접하게관련된것으로판단되는 bacillomycin, bacilycin, fengycin, iturin, surfactin 을생성하는생합성유전자를보유한것으로확인되었다. 본연구는 GH1-13 균주가작물의생육촉진과병방제를동시에해결할수있는강력한복합기능성미생물제로의가능성이있음을보여주었다. 색인어 바실러스, 생육촉진, 방제, 복합기능, 이차대사물질