36(2) 16.fm

w ³wz The Korean Journal of Mycology The Korean Society of Mycology Kor. J. Mycol. 36(2) : 189-195 (2008) Aspergillus nidulans Ÿ w y w sila» w Áš Á½w Áw³ Áw z Áw 1 1 1 2 3 1,4 1Ÿw w, 2ûw ew, 3w œw, 4Ÿw œw Isolation and Functional Analysis of the sila Gene That Controls Sexual Development in Response to Light in Aspergillus nidulans Sang-Yong Han 1, Jin-A Ko 1, Jong-Hak Kim 1, Kyu-Yong Han 2, Kap-Hoon Han 3 and Dong-Min Han 1,4 1 Division of Life Sciences, Wonkwang University, Iksan 570-749, Korea 2 Department of Dental Hygiene, Namseoul University, Chonan 331-707, Korea Department of Pharmaceutical Engineering, Woosuk University, Wanju 565-701, Korea 4 Institute of Biotechnology, Wonkwang University, 570-749, Korea 3 (Received December 17, 2008. Accepted December 27, 2008) ABSTRACT: When a homothallic ascomycete Aspergillus nidulans is exposed to visible light, cleistothecial development is inhibited. The light response of development in A. nidulans implies the existence of delicate regulation process including reception and translocation of light signaling and determination of development. Previously, mutants that could develop cleistothecia even in the presence of relatively intensive visible light were isolated and several complementation groups were identified. A gene that was able to complement the sila98 mutation, which was responsible for preferred cleistothecia development under visible light, was isolated from AMA-NotI genomic library. The sila gene retained in the 4.3 kb recovered genomic library DNA has an open reading frame (ORF) consisted of 2,388 bp nucleotides, interrupted by 3 introns and consequently encoding 795 amino acids. The putative SilA carries a Zn 2 Cys 6 binuclear cluster motif at N terminus and shows high amino acid sequence similarity to Aro80p of Saccharomyces cerevisiae. Deletion mutants of sila showed a strong induction of sexual development under visible light, indicating that SilA is involved in the negative regulation of sexual development in response to the light. KEYWORDS:Aspergillus nidulans, Light, Sexual development, sila, Transcription factor û³ w ³ (sexual) (asexual) y. s(vegetative cell) w (haploid)š, (diploid) y ù kù. ³ Aspergillus nidulans w y 3 y ƒ, w yƒ, ƒ w w, š ƒ w š nondisjunction w yw (parasexual cycle) (Pontecorovo et al., 1953). q ww z w q(coenocytic hyphae) w (dikaryon) û pw q ascogenous hyphae yw ww(karyogamy) ùš (meiosis) e, z s w wù û(ascus) 8 ûs(ascospore)ƒ *Corresponding author <E-mail : dmhan@wonkwang.ac.kr>. q w z q w cleistothecium ü ù. w yw w s (conidia) x ƒ x š (Adams and Yu, 1998),»ù» w w. x w w, s x 200 ƒ vwš (Clutterbuck, 1969), s xwš ³ l mrna w cdna w 1,200 ƒ š (Timberlake, 1980), 6% w, sx pw w 300. mrna ƒ s y w. w y y w 189

190 w flug(lee and Adams, 1994), y w flbb, flbc, flbd(adams and Yu, 1998) š. y Aspergillus yù Saccharomyces Neurospora y w p š y w. y w k ù(han et al., 1994). w x A. nidulans s x y w» w», y w wü» w r ƒ wš. A. nidulans y w e y w ³ ww p ƒ w y š yƒ y w y(han et al., 2003)., š s k y yƒ š, s yƒ (acetate) k y. ƒ y» y y y y û wš. w ³ š ¼ z œ» wš w» w, w x (hypoxia) x»(anaerobic) y ƒ (Han et al., 1990). w 1M KCl, 0.5 M MgSO 4 p(salt stress) 1.2 M sorbitol n p(osmotic stress) w p(light stress) y pƒ w y š y ù {k s y s sƒ y ùküš. w p w y w w l w wš. p w y w w p ƒ w w k w w, š n k k œ w w w, w p w w ƒ 8 ƒƒ 6 complementation w q ƒƒ sila98, silb216, silc18, sild6, sile11, silf174 (Min et al., 2007). sila98 w sila w wš, w x w» wš w. ³, l, A. nidulans x ³ Fungal Genetics Stock Center(FGSC) A4 w q x ³ pyrg89 ƒ A773³ w vea + pyrg89 t w w HSY2(veA +, argb::trpc, ana1) w w. Escherichia coli ³ DH5α w. w» w genomic library FGSC w prg3-ama1-noti library w š, w plasmid DNA DNA s w l pbluescript II SK( )(Stratagene, USA) T-Easy vector (Promega, USA) w. (CM) (MM) Han (1990) w. A. nidulans ³ 37 o C, 3 w, w w vw ƒ w. g j» ww» w sodium deoxycholate ƒ 500 mg/l ƒw. s 3 w l 0.01% Tween80 yw w w 1ml w, xy w. y z w» w z, 24 w wš wk w(han et al., 1990). E. coli ³ LB, ampicillin kanamycin ƒ LB MacConkey agar w. DNA sila» w» w AMA1- Notlibrary NotI-SmaI 4.3 kb genomic DNAƒ r üš pbluescript II SK jw psila w wz w (Fig. 1). r SalI self ligation 6 kb(psila9803) SalI-SalI 1.3 kb r(psila9804), PstI self ligation 5.7 kb(psila9801), PstI-PstI r 1.6 kb(psila9802) pbluescript II SK subcloningw» w. j ww» w v DNA alkaline lysis(sambrook et al., 1989) w w, wz ù A. nidulans xyl v DNA z, š Southern analysis ww» w genomic DNA Lee and Taylor(1990) w., ³ ƒ 20~60 mg p, 400 µl Lysis buffer[50 mm Tris-Cl(pH 8.0), 50 mm EDTA(pH 8.0), 3% SDS, 1% 2-mercaptoethanol] ƒw yww. tube 65 C 1 k o z, phenol/chloroform wš k e

의 광 조건하 유성분화에 관여하는 sila 유전자의 분리 및 기능분석 Aspergillus nidulans 191 Fig. 1. DNA sequence and Physical map of sila gene. (A) The complete sequence of SmaI-NotI DNA fragment which includes the whole sila ORF is shown. Underlined capitalized letters are binuclear zinc cluster motif and underlined small alphabet regions indicate introns. (B) Restriction map and gene structure of sila gene. sila ORF is indicated as arrow. Introns and Zn2Cys6 binuclear zinc cluster motif are represented as black boxes and dashed box, respectively.

192 w Table 1. Oligonucleotide primers used in this study Name SAS 1 OMK24 OMK25 OMK26 OMK27 OMK28 argb Forward argb Reverse SAS22 SAS23 Sequences (5'-3') ACAATGTCCAAAGGCACG AAGGGTTCGTGAGCATACCC CAAATGAGGCCTCTAAACTGGTCAGGCAAGGGATACAAGCCTTG CAAGGTAGATCCAGGCCTAACACAAAGAGTGTGTGGTTGAGGGCAG CTGACGTAGCAAGCACTGCA GCGATCATTTAGGCTGTG GACCAGTTTAGAGGCCTC GTGTTAGGCCTGGATCTA CCCTCGAGGGCCACACTCTTAC CCCTCGAGGGGAATTTGATTGT Fig. 2. Multiple alignment of Zn 2 Cys 6 binuclear zinc cluster motif between various fungal transcription factors. g. DNA Sambrook(1989) w DNA w. UV mw yw ³ complementationw ywš, A. nidulans ƒ (autonomous replication) AMA1 ƒš l w šz xy genomic library prg3-ama1-noti library w xy w. A. nidulans xy Min (2007) w E. coli xy CaCl 2 w (Sambrook et al., 1989). wz Min (2007) ww. ORF w PCR RT-PCR rtaq ExTaq(Takara, Japan) w, reverse transcriptase AMV(Promega, USA) w. 0.7% agarose gel» w, DNA band UltraClean TM 15 DNA Purification Kit w z, pgem -T Easy Vector System I w j w. (deletion) w w Double-Joint PCR (Yu et al., 2006) ww. omk24, omk25 primer(table 1; Fig. 3A, ) 5'-flanking region, omk26, omk27 primer(table 1; Fig. 3A, ) 3'- flanking region sw PCR wwš, argb argb Forward, argb Reverse primer (Table 1; Fig. 3A, ) PCR ww PCR ü. PCR PCR 3 r w ww PCR wwš, annealingw PCR mixture x wš nested primer SAS1, omk28(table 1; Fig. 3A, ) PCR w sila deletion w PCR w xy ³ HSY2 x yw(fig. 3A). sila x l w» w A. nidulans x ³ genomic DNA x w SAS22 SAS23 primer(table 1) PCR ww sila ORF sww 2.4 kb PCR product š, pgem T-Easy l jw.» z» psilaoet8 ü. psilaoet8 niia promoter swwš prb2-1 vector ƒƒ XhoI w ligation wš E. coli xy psilao21 w. Southern Northern hybridization 0.7% TAE agarose gel DNA» w 0.4 N NaOH w upward capillary mw Hybond TM - N + g. DNA k z, cross linking w UV wš Modified church buffer(church and Gilbert, 1984) [α- 32 P] labeled probe w hybridization ww. Probe Random primer labeling kit(takara, Japan) w w. Hybridization z, membrane 2Ü SSC 0.5% SDS yw 10 wš, w w z 1Ü SSC 0.1% SDS yw 65 o C 30 w. membrane 70 o C KODAK BioMax MS Film(Kodak, USA) g. Northern A. nidulans RNA ³ ƒ 50~100 mgl Easy-BLUE TM (intron) w w. RNA( 20 mg) 1.0% formaldehyde agarose gel»w, 20Ü SSC w upward capillary mw Hyboind TM -N+ g

의 광 조건하 유성분화에 관여하는 sila 유전자의 분리 및 기능분석 193 Aspergillus nidulans Fig. 4. Phenotype of sila over-expression strain. (A) Confir- mation of over-expression of sila by Northern blot analysis. (B) Phenotypes of sila over-expression strain (OSILA11). AT (ammonium tartrate); repression condition, SN (sodium nitrate); induction condition. 이 되게 희석하여 배양접시 당 500 µl를 접종한 다음 4 일간 배양하여 관찰하였다. 유성분화의 비율은 36 mm 안에 있는 cleistothecia의 수를 세었고, 무성포자의 비율 은 36 mm 안에 있는 무성포자를 0.01% Tween 80 1 ml 에 희석시켜 haemacytometer를 이용하여 광학현미경으로 포자의 수를 세어 조사하였다. ml 2 2 결과 및 고찰 유전자의 클로닝과 염기서열 결정 A. nidulans 야생형 균주는 빛의 존재하에서는 유성생식 이 강하게 억제되는 특성을 가지고 있다. 기존의 연구에 서 자외선을 이용하여 돌연변이를 유발시킨 무성포자를 3,500 Lux의 형광등 빛이 존재하는 조건에서 완전배지에 서 배양하였을 때 자낭각(cleistothecia)을 생성하는 돌연 변이균주들 8종을 분리하였다(Min et al., 2007). 이들은 각각 6종의 서로 다른 complementation 그룹에 속하는 것으로 판명되었으며 각각의 돌연변이 유전자들은 sila98, silb216, silc18, sild6, sile11, silf174로 명명되었다(Min et al., 2007). 분리된 돌연변이균주들을 complementation 하는 유전자를 확보하고자, genomic library를 이용하여 형질전환을 실시하였다. 약 20,000여 pyrg 형질전환체를 분석하여 sila98 돌연변이를 complementation하는 genomic DNA 조각 NotI-SmaI 4.3 kb를 확보하였다. sila 유전자를 분석하기 위해 라이브러리 절편 4.3 kb의 genomic DNA를 포함하는 psila의 restriction map과 DNA의 염기서열을 결정하였으며 Open Reading Frame (ORF)이 중단되는 부위를 중심으로 RT-PCR을 수행하여 sila Fig. 3. Construction and phenotypes of sila deletion mutant. (A) Schematic diagram of generation of the sila gene deletion construct by DJ-PCR. (B) Schematic diagram of replacement of sila by a selection marker, argb. (C) Confirmation of the sila gene deletion by Southern hybridization. (D) Phenotype of sila deletion mutant (KSILA-3) and sila allelic mutant (SIL98). 다. Hybridization, probe labelling, washing 그리고 signal detection 은 Southern hybridization과 같은 방법으 로 수행하였다. 표현형 및 유성분화와 무성분화 비율 조사 A. nidulans의 야생형 균주 및 sila 유전자의 결손 돌연 변이 균주의 무성포자를 0.01% Tween 80으로 수확하여 glucose 1%의 고체 최소배지에 접종량이 2.0 10 cells/ 6 +

194 w intron yw(fig. 1). sila 3 intron 4 exon x, 3 w intron ƒƒ 52 bp(intron I), 58 bp (intron II), 57 bp (intron III) j» ƒš. ORF 2,388 bp» 795 yywš (Fig. 1).» m NCBI(Nation Center for Biotechnology Information) A. nidulans genome database(http://www.ncbi.nlm.nih.gov) w w, sila chromosome VII e wš AN1893.2 annotation yw. sila sila DNA» NCBI Blastn w Saccharomyces cerevisiae aromatic w y ARO80 ùkû, SilA N-terminus 24l 59¾ ³ p(fungal specific) Gal4 type Zn 2 Cys 6 binuclear cluster DNA binding motif ƒš ùkû(fig. 2). w s w GATA boxù TATA box w GATA box 174 bp w wš TATA box 40 bp w GATA box e 174 bp GATA boxƒ w wš. š pw ws ó (telomere)» 34 bp~ 766 bp. sila sila»»w A. nidulans x ³ double crossing-over mw w(homologous recombination) w j w w. sila w» wpsila x»w Double-Joint PCR(DJ-PCR; Yu et al., 2006) ww PCR x y ³ HSY2 xy w(fig. 3). argb + xy sila98 w x xy 4 w Southern hybridization mw sila ƒ ywš w (Fig. 3C). Fig. 3B x sila ORF ü PvuII ƒ ù argb ü. x ORF 3' probe w 3.7 kb DNAƒ sila ORFƒ argb ey sila ORF PvuII 7.8 kb DNA ùkù. Fig. 3C yw ew š. sila x» w yƒ x ù,, šn(0.6 M KCl) p ƒ w k y w. šn x y w w(fig. 3D). ù sila98 w Ÿ p w»(cleistothecium) xw(fig. 3D), sila ƒ pw w y w w š. sila x(over-expression) sila x SilA pw w y w». sila ƒ w xù p x w w e» w nitrate w š ammonium w niia vl w. sila niia vl»w ww x l psilao21 w yp ³ HSY2 xy w. mw xy Southern hybridization ww wù copy ³ OSILA21³ ³ w Northern Hybridization ww x yw (Fig. 4). txx w» w niia vl x w ammonium tartrate niia vl x w sodium nitrate ƒw w ƒƒ wš, niia vl x w sodium nitrate 0.1% 0.6% k w. x ³ x txx ƒ j sila xù x w» SilA ƒ x j w e (Fig. 4). Aspergillus nidulans y ƒ ùš yƒ š yƒ. w yƒ w y w ƒ w. w w» w Ÿ w y w sila98 w, w wš A. nidulans

Aspergillus nidulans Ÿ w y w sila» 195 AMA-NotI genomic libraryl sila98 w sila w. sila ORF 2,388 bp» š 795 yywš. Saccharomyces cerevisiae ARO80 SilA N 51.9% ƒ Zn 2 Cys 6 motif š. sila Ÿ w š sorbitol yƒ. sila ƒ šn y w wš w. sila niia promoter xg x x j. 2006 Ÿw w. šx Adams, T. H. and Yu, J. H. 1998. Coordinate control of secondary metabolite production and asexual sporulation in Aspergillus nidulans. Curr. Opin. Microbiol. 1:674-677. Church, G. M. and Gilbert, W. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995. Clutterbuck, A. J. 1969. A mutational analysis of conidial development in Aspergillus nidulans. Genetics 63:317-327. Han, D. M., Han, Y. J., Lee, Y. H., Jahng, K. Y,, Jahng, S. H. and Chae, K. S. 1990. Inhibitory conditions of asexual development and their application for the screening of mutants defective in sexual development. Kor. J. Mycol. 18:225-232. Han, D. M., Han, Y. J., Chae, K. S., Jang, K. Y. and Lee, Y. H. 1994. Effects of cariou carbon sources on the development of Aspergillus nidulans with vela+ or vela1 allele. Kor. J. Mycol. 22:332-337. Han, K. H. Lee, D. B., Kim, J. H., Kim, M. S., Han, K. Y., Kim, W. S., Park, Y. S., Kim, H. B. and Han, D. M. 2003. Environmental factors affecting development of Aspergillus nidulans. J. Microbiol. 41:34-40. Lee, B. N. and Adams, T. H. 1994. Overexpression of flba, and early regulator of Aspergillus asexual sporulation, leads to activation of brla and premature initiation of development. Mol. Microbiol. 14:323-334. Lee, S. B. and Taylor, J. W. 1990. Isolation of DNA from fungal mycelia and single spores. in PCR Protocol; A Guide to Methods and Application pp. 282-287. Min, J. Y., Kim, H. R., Han, K. H. and Han, D. M. 2007. Isolation and characterization of Aspergillus nidulans mutants which undergo sexual development in light exposure. Kor. J. Microbiol. 43:77-82. Pontecorvo, G., Roper, J. A., Hemmons, L. M., MacDonald, K. D. and Bufton, A. W. J. 1953. The Genetics of Aspergillus nidulans, Advances in Genetics. 5:141-238. Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular Cloning: Alaboratory manual, 2nd ed. CSH. Timberlake, W. E. 1980. Developmental gene regulation in Aspergillus nidulans, Developmental Biol. 78:497-510. Yu, J. H. 2006. Heterotrimeric G protein signaling and RGSs in Aspergillus nidulans, J. Microbiol. 44: 145-149.