03.원저01-김진욱( ).hwp
|
|
- 도현 유
- 6 years ago
- Views:
Transcription
1 The Korean Journal of Hepatology 2009 ; 15 : DOI: /kjhep 논평참조 B 형간염바이러스 X 유전자를표적으로하는렌티바이러스매개 short hairpin RNA 의항바이러스효과 서울대학교의과대학분당서울대학교병원내과 김진욱 이상협 박영수 정숙향 김나영 이동호 Abstract Inhibition of in vitro hepatitis B virus replication by lentivirus-mediated short-hairpin RNA against HBx Jin-Wook Kim, M.D., Sang Hyub Lee, M.D., Young Soo Park, M.D., Sook-Hyang Jeong, M.D., Nayoung Kim, M.D., Dong Ho Lee, M.D. Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Seoul National University Bungdang Hospital, Seongnam, Korea Backgrounds/Aims: Hepatitis B virus (HBV) replicates via RNA intermediates, which could serve as targets for RNA interference (RNAi). Vector-mediated short-hairpin RNA (shrna) can induce sustained RNAi in comparison to small interfering RNA. Lentiviral vector is known to induce prolonged RNAi with high transduction efficiency. In this study, we sought to test the in vitro efficacy of shrna delivered by a lentiviral vector in suppressing the replication of HBV. Methods: Two shrna sequences against the hepatitis B viral protein HBx (sh1580 and sh1685) were cloned downstream of the U6 promoter in an HIV-based plasmid to generate third-generation lentiviral vectors. HepAD38 cells were transduced with anti-hbx lentiviral vectors, and HBV replication was induced for 5 days. HBV DNA was isolated and quantified using real-time PCR. Results: Lentiviral vectors encoding the shrna against HBV transduced HepAD38 cells with high efficacy. The total intracellular HBV DNA content was significantly reduced by both sh1580 and sh1685 (2.9% and 12.0%, respectively; P<0.05). HBV covalently closed circular DNA (cccdna) was also suppressed significantly (19.7% and 25.5%, respectively; P<0.05). Conclusions: Lentivirus-mediated delivery of shrna against HBx can effectively suppress the replication of HBV and reduce HBV cccdna in cell culture systems. (Korean J Hepatol 2008;15:15-24) Key words: Hepatitis B virus; Lentivirus; MicroRNAs; RNA interference; sirna Received September 3, 2008; revised February 2, 2009; accepted February 17, 2009 Abbreviations: HBV, hepatitis B virus; HBx, hepatitis B x protein; PCR, polymerase chain reaction; RNAi, RNA interference; shrna, short hairpin RNA; sirna, small interfering RNA Corresponding author: Jin-Wook Kim, kimjw@snubh.org; Phone: 031) ; Fax: 031) 주소 : 경기도성남시분당구구미동 300, 분당서울대학교병원소화기내과 ( 우 ) This work was supported by The GlaxoSmithKline Research Fund of the Korean Association for the Study of the Liver (2005 GlaxoSmithKline Academic Scholarship of the Korean Association for the Study of the Liver)
2 The Korean Journal of Hepatology : Vol. 15. No 서론 RNA interference(rnai) 는세포내에서 RNA 를매개로하여염기서열에특이적으로표적유전자의발현을조절하는기전이다. 두가닥의 RNA (double stranded RNA) 가 RNaseIII enzyme Dicer 에의하여 21개의염기로이루어진 small interfering RNA(siRNA) 로처리된후 RNaseH core enzyme argonaute와결합하여 RNA-induced silencing complex(risc) 를형성하며, 이는상보적염기서열의전령 RNA(messenger RNA) 를분해함으로써특이적으로표적유전자의 posttranscriptional gene silencing(ptgs) 을유도한다. 1 B형간염바이러스 (hepatitis B virus; HBV) 는세포내증식과정중역전사과정을거치며, 역전사의주형이되는 RNA intermediate 는 sirna 의표적이될수있으리라추론할수있다. 실제로세포배양및생쥐모델에서 sirna가 HBV RNA를분해함으로써 HBV의증식을억제할수있음이여러보고에서확인되었다. 2-6 초기의 HBV 에대한 RNAi 관련연구는대부분합성 sirna(double stranded RNA oligonucleotide) 를이용하였는데, 합성 sirna 를이용한 RNAi 는시험관내에서표적염기서열에대한 dsrna를직접세포에핵산전달감염 (transfection) 시킴으로써단시간내에특정핵산서열에의한유전자발현억제효과를스크리닝할수있다는장점이있으나, 반감기가짧아유전자발현억제효과가 2~3일간정도만유지되므로지속적인항바이러스효과를나타내기위해서는다량의합성 dsrna 를반복주입하여야하는문제점이있다. Short hairpin RNA(shRNA) 를이용한 RNAi 의경우, 합성 dsrna 를직접주입하는대신 hairpin 구조의단일가닥 RNA를전사하는플라즈미드 DNA 를이용하며세포안으로주입된 DNA로부터전사된 shrna 는 microrna 와유사한처리과정을거쳐최종적으로 sirna 로변환된다. 7,8 세포내에주입된 DNA가잔존하는동안계속적으로 shrna 의전사가일어나므로 sirna 보다오래 RNAi가유지되지만, naked plasmid 로부터 shrna가전사되려 면표적세포의핵으로 plasmid 가이동하여야하므로활발히분열하는세포에서만 plasmid 의핵내전달이가능하다. 또한, 주입된 foreign DNA는다양한경로로세포내에서비활성화되어장기적인발현을기대하기어렵다. 렌티바이러스 (lentivirus) 는 retroviral vector 의일종으로분열하지않는세포도형질도입 (transduction) 이가능하며주입된유전자는수개월이상발현이가능하므로, 9 RNAi를장기간유지시키는데유리한장점을가진다. 10 본연구에서는렌티바이러스벡터를이용하여 HBV x protein 유전자 (HBx) 를표적으로하는 shrna 를세포내에발현시킨후, 유발된 RNAi 에의하여 HBV의증식이억제되는지를알아보고자하였다. 대상과방법 1 HBx gene에대한 shrna의제작 HBx 유전자염기서열을표적으로하는 21개핵산의 sirna 서열은 Ambion사 (Austin, Tx, USA) 의 web-based program 을이용하여스크리닝하였으며 (sirna Target Finder, techlib/misc/sirna_finder.html), 이중기존의보고 11,12 에서효과적으로 HBV를억제하였던두개의염기서열 ( , TGCACTTCGCTTCACCT CTGCACGT , AACGACCGACCTTG AGGCCTA) 을선택하였다 ( 표 1, 그림 1). 2. shrna를발현하는렌티바이러스벡터의제작각각의표적염기서열에대한 short hairpin RNA(shRNA) expression cassette는 polymerase chain reaction(pcr) 으로합성하였다. 10,13,14 Human U6 promoter sequence 를가지는 ptz U6+1 plasmid를 template로하여 5 U6 universal primer(5 - ATAAGAATGCGGCCGCCCCGGGGATCCA AGGTCGGG-3 ) 와표적염기서열을포함하는 3 primer( 표 1) 를사용하여기존의보고와동일한방법으로증폭하였다. 10,15 증폭된 PCR product 를 1%
3 Jin-Wook Kim, et al. Lentivirus-mediated short haipin RNA against HBx Table 1. Primer sequences for the generation of shrna-expressing cassettes against HBX gene Name Sequence Location* Scrambled shrna 46 sh sh GGAAGATCTAGAAAAAAGCACCTATAACAACGGTAGCTACACAAACTACCG TTGTTATAGGTGCCGGTGTTTCGTCCTTTCCACAAG-3 5 -GGAAGATCTAGAAAAAATGCACTTCGCTTCACCTCTGCACGTTCTCTTGAA ACGTGCAGAGGTGAAGCGAAGTGCACCGGTGTTTCGTCCTTTCCACAAG-3 5 -GGAAGATCTAGAAAAAACGACCGACCTTGAGGCCTACTACACAAATAGGCC TCAAGGTCGGTCGCCGGTGTTTCGTCCTTTCCACAAG Underlined nucleotides indicate sirna sequences (sense) for scrambled control and target area in HBX gene. Italicized nucleotides indicate loop sequence of shrna. *Nucleotide numbering is based on the reference sequence AF Figure 2. HIV7 lentiviral backbone plasmid. PCR-amplified shrna shuttle cassettes are cloned into the polylinker area. Figure 1. Organization of the HBV genome with respect to shrna sequences targeting HBV RNA. The four arrows indicate major open reading frames, and vertical bars indicate the initiation sites of each transcript of HBV. The target sequences of two shrnas (sh-1580 and sh-1685) are marked on the X gene area. agarose gel에서전기영동으로분리하여 3세대렌티바이러스 backbone plasmid(phiv7-gfp PL, 그림 2) 10 의 NotI / XbaI restriction enzyme site에클로닝하였으며, 염기서열분석을통하여해당 sh- RNA expression cassette 가삽입되었음을확인하였다. 합성된재조합렌티바이러스 backbone plasmid 는 core packaging plasmid(pmdlg/prre, prsv- Rev) 와 envelope plasmid(pmd2.vsvg) 와함께 calcium phosphate 를이용하여 293FT packaging cell line(invitrogen, Carlsbad, CA, USA) 에핵산전달감염시켰으며, 16 16시간이경과한후배양액을교환하여 24시간동안추가로배양한후상청액을 얻어 real-time reverse transcriptase(rt)-pcr 법으로렌티바이러스 genomic RNA titer를정량하였다. 17 요약하면, 배양상청액 100 µl로부터 Trizol(Invitrogen) 1 ml를이용하여 RNA를추출한후 10 µl의증류수에녹였다. Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) 에대한 primer(wpre1277f, 5 -CCGT TGTCAGGCAACGTG-3; WPRE1361R, 5 -AGC TGACAGGTGGTGGCAAT-3 ) 와 probe(wpre- 1314P, 5 -FAM-TGCTGACGCAACCCCCACTG T-TAMRA-3) 17 를사용하여 one-step real-time RT-qPCR 을시행하였으며, 18 PCR 반응의조성 (20 µl) 은다음과같다 : ABI real time PCR master mix(1x, Applied Biosystems, Foster City, USA), forward and reverse primer 800 nm, probe
4 대한간학회지제 15 권제 1 호 2009 nm, RNase OUT 1 U/µL, SuperScript III RT (Invitrogen) 5 U/µL, RNA template 2 µl. PCR cycle 은역전사과정을 50 에서 30분, 95 10분으로시행하였으며, 이후 PCR 증폭을 40 cycle(95 15 초, 60 1분 ) 시행하였다. 3. In vitro model of HBV replication and transduction of lentiviral vectors in HepAD38 cells 시험관내 HBV 증식의모델로는 HepG2 세포를기반으로 tetracycline-responsive CMV-IE promoter로조절받는 HBV genome을가지는 Hep- AD38 cell 19 을이용하였다. 배양액은 Dulbecco s modified Eagle s/f-12 medium(gibco Invitrogen) 을이용하였고 10% fetal bovine serum, 50 µg/ml penicillin, 50 µg/ml streptomycin, 0.3 µg/ ml tetracycline, 400 µg/ml G418(Invitrogen) 을첨가하였다. 12-well tissue culture plate에 /ml 의세포를분주하고 7일동안배양한후 2 개의 60 mm tissue culture dish에계대배양하였으며, 이때 dish 당 개의 lentiviral particle 을 polybrene(4 µg/ml, Sigma Aldrich Chemical Co., St. Louis, MI) 과함께배양액에첨가하였다. 다음날부터 5일간배양액에서 tetracycline 을제거하여 HBV replication을유도하였다. 형광현미경으로 green fluorescent protein(gfp) 발현을확인하였으며, 200배시야에서전체세포중형광을보이는세포를비교하여핵산전달효율을확인하였다. 한개의 tissue culture dish 로부터 genomic DNA extraction kit(bioneer, 대전, 대한민국 ) 를이용하여 DNA를분리, 20 µl의증류수에녹인후 1 µl를 total HBV DNA 정량에이용하였다. 나머지한 dish로부터 HepAD38 cell의세포핵에서단백질과결합된 DNA 분획을 Hirt extraction 20,21 을이용하여제거하여단백과결합하지않은 HBV covalently closed circular DNA(HBV cccdna) 분획을분리하였다. Plasmid-safe DNase(Epicentre Biotechnologies, Madison, WI, USA) 를이용하여 contaminating chromosomal DNA를제거한 후 20 µl의증류수에녹여 1 µl를 HBV cccdna 정량에이용하였다. HBV에대한렌티바이러스매개 shrna 의장기적억제효과를확인하기위하여, 2주간 HBV 발현을유도시킨 HepAD38 세포를 96-well tissue culture plate에 well당 개씩분주한후곧이어 sh1580 렌티바이러스를 particles/well의농도로넣어 transduction 시켰으며, tetracycline 이포함된배양액에서 4주간계대배양하였다. Lentiviral transduction 자체가 HepAD38 세포의성장에미치는영향을확인하기위하여동일한수 ( /dish) 의 sh1580 주입 HepAD38 세포와 control HepAD38 세포를 60 mm tissue culture dish 에분주한후 1주간배양하였으며, trypsin 처리로세포를얻어 trypan blue염색후 total / vialble cell number 를구하였다. Trizol 을이용하여 RNA를분리한후 3 µg의 RNA를 random hexamer 를시발체로하여 SuperScriptIII RT로역전사하였으며, 60 ng에해당하는 cdna를이용하여아래에기술된 HBS gene real-time quantitative PCR로 HBV RNA를정량하였고, GAPDH로보정하여상대적 cdna 양을계산하였다. GAPDH 정량에이용한 primer / probe는다음과같다 : forward(500 nm), 5 -GAAGGTGAAGGTCGGAGTC-3; reverse(500 nm), 5 -GAAGATGGTGATGGGATTTC-3; probe 5 -FAM-CAAGCTTCCCGTTCTCAGCC-3 -TA MRA. HBV relaxed circular DNA와 HBV cccdna의정량은 Applied Biosystems 7500 Real-Time PCR System(Applied Biosystems, Foster City, CA, USA) 을이용하여 real-time quantitative PCR assay로측정하였다. 세포내 HBV DNA의총량은 HepAD38 cell 로부터분리한총 DNA를이용하여 HBs gene 부위에대한 real-time quantitative PCR을시행하였으며, 22 사용된 primer와 fluorescent probe 의염기서열은다음과같다 : HBV rcdna-forward, 5 -CACATCAGGATTCCTAG GACC-3; HBV rcdna-reverse, 5 -GGTGAGT GATTGGAGGTTGG-3; probe, 5 -FAM-CAGA
5 김진욱외 5 인. 렌티바이러스매개 short hairpin RNA 의항 HBV 효과 Figure 3. Green fluorescent protein (GFP) expression in HepAD38 cells transduced with shrna-encoding lentivirus. Fluorescence images were superimposed on light-microscopy images to assess transduction efficiency. Control cells without lentiviral transduction showed no fluorescence (A), whereas cells transduced with lentivirus encoding scrambled shrna (B), sh-1580 (C), and sh-1685 (D) exhibited uniform cytoplasmic expression of GFP, demonstrating a lentiviral transduction efficiency of more than 95% (magnification 200 ). The images are representative of three independent experiments. GTCTAGACTCGTGGTGGACTTC-TAMRA-3. 반응조건은총 20 µl의반응액으로맞추어 Taq- Man Universal PCR Master Mix(1x, Applied Biosystems), template 1 µl, forward / reverse primer 500 nm, probe 200 nm로사용하였다. 반응 cycle은 50 C에서 2분, 95 C에서 10분동안반응시킨후 95 C에서 20초, 60 C에서 1분으로 45 cycle 증폭하였다. HBV sequence를가지는 pam6 plasmid(american Type Culture Collection, Manassas, VA, USA) 를 10 4, 10 6, 10 8, /ml 의농도로만들어 standard로이용하였으며, 정량에이용된 DNA의총량 ( 이용된세포의수 ) 을보정하기위하여 β-globin에대한 real-time PCR을동시에시행하였다 : 23 β-globin-forward, 5 -GTGCACCTGA CTCCTGAGGAGA-3 (final 900 nm); β-globinreverse, 5 -CCTTGATACCAACCTGCCCAG-3 (final 900 nm); β-globin-probe, 5 -FAM-AAGG TGAACGTGGATGAAGTTGGTGG-TAMRA-3 (final 200nM). HBV cccdna의정량은 chimeric primer를이용한기존의보고대로시행하였다. 24 요약하면, chimeric primer(5 -tcgctttcgggtccctcatgcaacgtgc-3 ) 를이용하여 HBV DNA(+) strand 에대한상보적 DNA를합성하였으며반응조건은다음과같다 : 10 µl reaction당 1 PCR reaction buffer, 500 nm chimeric primer, 200 nm each dntp, 1 U Hot- StarTaq DNA polymerase(qiagen Korea, 서울, 대한민국 ), 1 µl DNA template. 94 에서 7분간 initial denaturation시킨후 94 에서 20초, 50 에서 20초, 72 에서 45초로 15 cycle 증폭시켰다. 1 차반응의산물 3 µl를이용하여 real-time quantitative PCR을시행하였으며반응조건은다음과같다 : 10 µl reaction당 TaqMan Universal PCR Master Mix(1x, Applied Biosystems), forward primer 5 -tcgctttcgggtccct-3 (500 nm), reverse primer 5 -GCACCTCTCTTTACGCGGT C-3 (500 nm), probe 5 -FAM-CCCGTCTGTGCCTTCTC ATCTGCCG-3 -TAMRA(250 nm). 반응 cycle은
6 The Korean Journal of Hepatology : Vol. 15. No A B Figure 4. Quantification of HBV DNA in HepAD38 cells transduced with shrna-encoding lentivirus. Real-time quantitative PCR was performed to measure the total HBV DNA (A) and HBV cccdna (B). Final results are normalized against β- globin, which was measured simultaneously to ensure an identical DNA input for each group. Data are mean and SD values of triplicate samples from two independent experiments. *P<0.05 vs. scrambled shrna. 50 C에서 2분, 95 C에서 10분동안반응시킨후 93 C에서 10초, 62 C에서 35초로 45 cycle 증폭하였다. 통계분석은 independent t-test를이용하였으며, MedCalc(version , MedCalc Software, Mariakerke, Belgium) 을사용하여분석하였다. 결과 1. HepAD38 cell에서 shrna-encoding lentivirus 의형질도입효율 shrna 를발현하는렌티바이러스를 HepAD38 cell에형질도입시킨후 5일째에형광현미경을이용하여 GFP 발현을확인하였을때렌티바이러스를처리하지않은대조세포에서는형광신호를관찰할수없었으나 scrambled shrna 및 HBV에대한 shrna를 encoding하는렌티바이러스를첨가한 culture dish 에서는대부분세포의세포질에서 GFP 발현을확인할수있었다 ( 그림 3). 2. 렌티바이러스를매개로주입된 HBx-targeting shrna 가 HBV의증식에미치는영향 Lentivirus를매개로 HBx에대한 shrna를형질도입한 HepAD38 cell 로부터핵산을분리하여 정량적 PCR로 HBV DNA의발현을측정하였을때세포내총 HBV DNA는 scrambled shrna 와비교하여 2.9%(sh1580) 및 12.0%(sh1685) 로감소하였다 (P<0.05, 그림 4A). 세포핵으로부터분리한 HBV cccdna 를정량적 PCR로측정한결과, HBV cccdna 역시 scrambled shrna 투여군과비교하였을때 HBV에대한 shrna 를발현시킨세포에서 19.7%(sh1580) 및 25.5%(sh1685) 로감소하였다 (P<0.05, 그림 4B). sh1580의장기적항 HBV 효과를 lentiviral transduction 후 5주째에 real-time RT-PCR법으로평가하였을때, sh1580을주입한 HepAD38 세포에서는 HBV RNA의발현이대조군에비하여유의하게억제되었다 (100% vs 48.5%, P=0.005, 그림 5). Trypan blue염색후계수한세포수는대조군과 sh1580 주입군간에차이가없었으며 ( vs , P=0.685), non-viable cell도두군모두 1% 미만으로차이를보이지않았다. 고찰본연구에서는렌티바이러스벡터를이용하여 HBV에대한 shrna를 HepAD38 cell에서발현시켰을때 HBV의증식을효과적으로억제할수있
7 Jin-Wook Kim, et al. Lentivirus-mediated short haipin RNA against HBx Figure 5. Quantification of HBV RNA in HepAD38 cells at 5 weeks after transduction with the sh1580-encoding lentivirus. Real-time quantitative RT-PCR was performed to measure the total HBV RNA. Data are mean and SD values of triplicate samples. *P<0.05 vs. control. 음을확인하였다. 시험관내실험과동물실험결과 RNAi가여러가지바이러스를효과적으로억제할수있음이알려지면서새로운항바이러스치료제로응용될가능성이제시되었다. 25 현재 HIV-1 등몇몇바이러스질환에대한핵산기반치료 (nucleic acid-based therapy) 의임상시험이진행중이며 HBV의경우 shrna를 encoding하는 plasmid 를이용한제1상임상시험이시작되어, 25 RNAi를이용한 HBV 억제에대한연구는향후임상적응용가능성이매우높은 transitional research 분야이다. 하지만 RNAi 가임상적으로바이러스질환의치료에이용되기위해서는안전성과효율성면에서아직해결되어야할과제가많다. 안전성면에서는목표로하는유전자이외의다른유전자들의발현에영향을미치는소위 off-target effect 를고려하여야하며, 유사한염기서열의유전자억제, 인터페론시스템활성화, 세포내 microrna pathway 의포화에의한영향등이 off-target effect의원인으로제시되었다. 26,27 또한, RNAi 를만성바이러스간염의치료에응용하려면간세포로의전달효율을높여야하는데, 1) 외부에서주입된핵산치료제가표적장기 ( 간 ) 의모든세포에충분한양이효과적으로전달되어야하며, 2) 간세포내 최종작용부위까지 ( 핵또는세포질 ) 분해되지않고이동되어야하고, 3) HBV 감염을치료하는경우 cccdna가희석, 제거될때까지장기간치료효과가유지되어야하기때문이다. HBV에대한 sirna 를이용한 RNAi 관련기존보고들은대부분 sirna 주입후 2~3일이내에표적 mrna를측정하였으며, 3,28 이는 sirna 의작용기간이수일정도로짧기때문이다. sirna 의화학적구조를변형시켜서반감기를늘이고약력학적지표를개선시킬수있으나, 29 유전자발현억제효과가감소하며, 30 장기적인반복주사가필요한점은여전히현실적인제한요소가된다. shrna를이용한 RNAi의경우, RNA polymerase III promoter로조절되는플라즈미드가표적세포의핵에서 pre-mirna 와유사한루프를가지는단일가닥 RNA로전사된후 Exportin-5에의하여세포질로이동하여 Dicer 에의하여처리과정을거치면서 sirna 로변환된다. 25 HBV에대한 shrna 를이용한기존의보고의경우시험관내핵산전달에는 calcium phosphate 4,5 혹은 liposome 12,31,32 을이용하였으며, 동물실험에서는정맥주입시일시에높은압력을가하여간세포로핵산전달을유도하는 hydrodynamic injection법이이용되었다. 4,32 하지만이러한핵산전달방법은모두임상적으로적용할수있는방법이아니며, 플라즈미드단독주입으로는효율적인핵산전달을기대하기어렵다. 설령성공적으로핵안으로플라즈미드가전달되었다하더라도, sirna 보다는작용시간이길지만 HBV를근치할정도의장기적인발현을기대하기힘들다. 33 유전자치료에사용되는바이러스벡터를 RNAi 에응용한다면생체내에서핵산전달의효율을높일수있을것이기대되는바, 레트로바이러스, 34 아데노바이러스, 11,35 adeno-associated virus 36,37 등의벡터를이용한 RNAi가효과적임이보고되었다. HBV의경우 prototype foamy virus, 38 아데노바이러스, 39 adeno-associated virus 38 등을이용하여수주에서수개월까지 RNAi에의한억제효과가유지될수있었다
8 대한간학회지제 15 권제 1 호 2009 렌티바이러스벡터는기존의레트로바이러스벡터와는달리분열하지않는세포에도높은효율로유전자전달이가능하며, 전달된유전자를장기간발현시킬수있다는장점이있다. 9,10,40 또한 cisacting element를분리하여별도의플라즈미드로전달하는방법을채용함으로써 replication competent lentiviral vector 의생성을최소화하였으며, 3세대이후의렌티바이러스는스스로불활성화되는 (self-inactivating) 특징이있어역전사후 proviral DNA의복제가불가능하게되어안전성면에서도기존의레트로바이러스벡터보다현저히개선되었다. 40 HIV 감염환자를대상으로렌티바이러스벡터를이용한유전자치료의제1상임상시험에서특별한부작용은관찰되지않았으며, 41 현재제2 상임상시험이진행중이다 ( co.uk/genmed/clinical/). 렌티바이러스를이용하여 shrna 를세포내에전달한경우표적유전자가 3주이상억제됨이보고되어, 42 RNAi 를장기간유지시키기에적합한특성을가지고있다. 본연구에서는형질주입후 5일까지 shrna 에의한항HBV 효과가유지됨을확인하여통상의 sirna oligonucleotide 보다긴작용시간을보였으며, 계대배양결과 5주까지 HBV의증식억제효과를관찰할수있었다. 렌티바이러스를이용하여 HBV에대한 antisense RNA와 hammerhead risozyme 를전달함으로써 HBV의증식을억제한보고가있었으나, 43 렌티바이러스를매개로하는 HBV에대한 RNAi 는아직보고되지않았다. 본연구에서정립한렌티바이러스매개 shrna 모델은 HBV에대한장기적인 RNAi의효과를규명하는연구에응용될수있으며, 향후유전자이입에의한항HBV 치료의전임상및임상시험을계획하는경우이론적인근거로서이용될수있다. 본연구에서는 total intracellular DNA 및 cccdna를정량하여 shrna 의항HBV 효과를평가하였으며, HepAD38 세포는염색체에 HBV genome 을포함하고있으므로 genomic DNA에의한 contamination 의가능성을생각해볼수있다. 하 지만, 연구자의실험결과 HepAD38 cell에서 HBV relaxed circular DNA / HBV cccdna ratio 가 10 2 ~10 4 정도이므로 ( 자료미제시 ) 세포당 HBV ccc- DNA가 1 copy 이상임을고려하면 genomic DNA 의오염에의한영향은미미한것으로판단된다. 기존에 lipofectamine 을이용하여 shrna expression cassette를 Huh7 세포에 transduction시킨연구결과에서는 HBsAg 분비를대조군의 5% 미만으로감소시킴을보고하였는바, 11 본연구에서도 2.9% 로서유사한정도의 HBV 억제효과를보였다. 하지만 HBV RNA를정량하였을때에는대조군의 35% 수준으로억제되었으며, 11 본연구에서도보다장기간배양효과이지만 48.5% 의억제효과를관찰하여, RNA 수준과 downstream의 relaxed circular DNA 및단백수준의억제효과간에는차이가있을것으로예상된다. 장기간 shrna 투여로인하여 HBV genome 의돌연변이가유발될가능성을생각해볼수있으며, 이에대해서는추가연구가필요하다. 본연구에서선택한 HBV X protein 유전자 (HBx) 부위는전사, 신호전달, 세포주기, 단백분해, 세포자멸등다양한기능을나타내는조절인자로알려져있다. 하지만 HBV의 4개의 open reading frame 으로부터전사되는 major transcript 는모두공통의 poly A 부위에서끝나게되어 3 말단부위에동일한염기서열을공유하고본연구에이용된 shrna 는모두이공통서열부위를표적으로하므로 ( 그림 1), 본연구에서의 HBV DNA 억제효과가 X 유전자 transcript 에작용하였기때문인지, 혹은 HBV genome 역전사의주형으로작용하는 pregenomic RNA에작용하여나타났는지는본연구결과만으로는확인이불가능하여추가연구가필요한부분이다. 흥미롭게도, 본연구결과 HBV에대한 shrna 는 relaxed circular DNA뿐아니라 cccdna의양도유의하게감소시킴을확인할수있었다. HBV 에대한 shrna 가 cccdna를억제하는기전으로는 shrna 가세포질내 HBV RNA에작용하여 viral nucleocapsid 의생성을억제함으로써세포핵
9 김진욱외 5 인. 렌티바이러스매개 short hairpin RNA 의항 HBV 효과 으로의 recycling 과정을차단하였기때문으로생각되나, 염색체에삽입된 HBV 유전자로부터전사되는 mrna에직접작용하여 HBV pregenonmic RNA를감소시켰을가능성도고려할수있다. Viral nucleocapsid 로부터 HBV cccdna의재공급이차단된상태에서 HepAD38 cell이지속적으로분열하게되면세포당 HBV cccdna의개수는희석, 감소하게된다. 44 최근한연구에서 HBV에대한 sirna 를 encoding 하는플라즈미드를주입하여 4일째에약 50% 의 HBV cccdna를감소시킬수있음이보고되었으며, 45 저자는 nuclear localizing signal의억제가 HBV genome 의핵내이동을차단하여 cccdna 의감소를초래하였을것으로제시하였다. shrna 에의한 HBV cccdna 감소효과의기전과의미에대해서는추가연구가필요하다. 요약배경 / 목적 : RNA interference 는 double stranded RNA가상보적인 mrna 를억제하는세포내방어기전으로서, small interfering RNA가 HBV RNA 를억제할수있음이알려졌다. 바이러스벡터를이용하여전달된 shrna 는 sirna 에비하여보다지속적인 RNAi를유도할수있다. 렌티바이러스벡터를이용한 RNAi는높은효율로장기적인유전자억제효과를나타낸다. 본연구에서는렌티바이러스를이용하여전달된 shrna 가 HBV의증식을억제할수있는지를알아보고자하였다. 대상및방법 : HBx 유전자에대한두종류의 shrna 를렌티바이러스벡터에삽입하여 HepAD38 cell에전달한후 real-time PCR로 HBV DNA를정량하였다. 결과 : HBV에대한 shrna 를 encoding 하는렌티바이러스벡터는효율적으로 HepAD38 cell을감염시켰다. HBV에대한 shrna 는세포내총 HBV DNA를 2.9~12% 로감소시켰으며, HBV cccdna 또한 19.7~25.5% 로유의하게억제하였다. 결론 : 렌티바이러스를매개로하는 RNAi는세포내에서효과적으로 HBV의증식을차단할수있다. 색인단어 : B형간염바이러스, 렌티바이러스, micro- RNAs, RNA interference, sirna 참고문헌 1. Hammond SM. Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett 2005;579: Giladi H, Ketzinel-Gilad M, Rivkin L, Felig Y, Nussbaum O, Galun E. Small interfering RNA inhibits hepatitis B virus replication in mice. Mol Ther 2003;8: Hamasaki K, Nakao K, Matsumoto K, Ichikawa T, Ishikawa H, Eguchi K. Short interfering RNA-directed inhibition of hepatitis B virus replication. FEBS Lett 2003; 543: McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, et al. Inhibition of hepatitis B virus in mice by RNA interference. Nat Biotechnol 2003;21: Shlomai A, Shaul Y. Inhibition of hepatitis B virus expression and replication by RNA interference. Hepatology 2003;37: Ying C, De Clercq E, Neyts J. Selective inhibition of hepatitis B virus replication by RNA interference. Biochem Biophys Res Commun 2003;309: Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296: McManus MT, Petersen CP, Haines BB, Chen J, Sharp PA. Gene silencing using micro-rna designed hairpins. RNA 2002;8: Kafri T, Blomer U, Peterson DA, Gage FH, Verma IM. Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 1997;17: Li MJ, Rossi JJ. Lentiviral vector delivery of recombinant small interfering RNA expression cassettes. Methods Enzymol 2005;392: Carmona S, Ely A, Crowther C, Moolla N, Salazar FH, Marion PL, et al. Effective inhibition of HBV replication in vivo by anti-hbx short hairpin RNAs. Mol Ther 2006;13: Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, et al. Stable inhibition of hepatitis B virus expression and replication by expressed sirna. Biochem Biophys Res Commun 2005;335: Castanotto D, Li H, Rossi JJ. Functional sirna expression from transfected PCR products. RNA 2002;8: Scherer LJ, Yildiz Y, Kim J, Cagnon L, Heale B, Rossi JJ. Rapid assessment of anti-hiv sirna efficacy using PCRderived Pol III shrna cassettes. Mol Ther 2004;10: Kim JW, Zhang YH, Zern MA, Rossi JJ, Wu J. Short hairpin RNA causes the methylation of transforming
10 The Korean Journal of Hepatology : Vol. 15. No growth factor-beta receptor II promoter and silencing of the target gene in rat hepatic stellate cells. Biochem Biophys Res Commun 2007;359: Follenzi A, Naldini L. Generation of HIV-1 derived lentiviral vectors. Methods Enzymol 2002;346: Lizee G, Aerts JL, Gonzales MI, Chinnasamy N, Morgan RA, Topalian SL. Real-time quantitative reverse transcriptase-polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Hum Gene Ther 2003;14: Geraerts M, Willems S, Baekelandt V, Debyser Z, Gijsbers R. Comparison of lentiviral vector titration methods. BMC Biotechnol 2006;6: Ladner SK, Otto MJ, Barker CS, Zaifert K, Wang GH, Guo JT, et al. Inducible expression of human hepatitis B virus (HBV) in stably transfected hepatoblastoma cells: a novel system for screening potential inhibitors of HBV replication. Antimicrob Agents Chemother 1997;41: Hirt B. Selective extraction of polyoma DNA from infected mouse cell cultures. J Mol Biol 1967;26: Zhang YY, Summers J. Low dynamic state of viral competition in a chronic avian hepadnavirus infection. J Virol 2000;74: Takehara T, Suzuki T, Ohkawa K, Hosui A, Jinushi M, Miyagi T, et al. Viral covalently closed circular DNA in a non-transgenic mouse model for chronic hepatitis B virus replication. J Hepatol 2006;44: Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, et al. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 1998;62: Jun-Bin S, Zhi C, Wei-Qin N, Jun F. A quantitative method to detect HBV cccdna by chimeric primer and real-time polymerase chain reaction. J Virol Methods 2003; 112: Haasnoot J, Westerhout EM, Berkhout B. RNA interference against viruses: strike and counterstrike. Nat Biotechnol 2007;25: Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR, et al. Fatality in mice due to oversaturation of cellular microrna/short hairpin RNA pathways. Nature 2006;441: Martin SE, Caplen NJ. Applications of RNA interference in mammalian systems. Annu Rev Genomics Hum Genet 2007;8: Konishi M, Wu CH, Wu GY. Inhibition of HBV replication by sirna in a stable HBV-producing cell line. Hepatology 2003;38: Morrissey DV, Lockridge JA, Shaw L, Blanchard K, Jensen K, Breen W, et al. Potent and persistent in vivo anti-hbv activity of chemically modified sirnas. Nat Biotechnol 2005;23: Czauderna F, Fechtner M, Dames S, Aygun H, Klippel A, Pronk GJ, et al. Structural variations and stabilising modifications of synthetic sirnas in mammalian cells. Nucleic Acids Res 2003;31: Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, et al. Inhibition of hepatitis B virus replication by stably expressed shrna. Biochem Biophys Res Commun 2003;311: Wu HL, Huang LR, Huang CC, Lai HL, Liu CJ, Huang YT, et al. RNA interference-mediated control of hepatitis B virus and emergence of resistant mutant. Gastroenterology 2005;128: Chen Y, Cheng G, Mahato RI. RNAi for treating hepatitis B viral infection. Pharm Res 2008;25: Barton GM, Medzhitov R. Retroviral delivery of small interfering RNA into primary cells. Proc Natl Acad Sci U S A 2002;99: Arts GJ, Langemeijer E, Tissingh R, Ma L, Pavliska H, Dokic K, et al. Adenoviral vectors expressing sirnas for discovery and validation of gene function. Genome Res 2003;13: Tomar RS, Matta H, Chaudhary PM. Use of adenoassociated viral vector for delivery of small interfering RNA. Oncogene 2003;22: Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, et al. Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8- delivered short hairpin RNA. Gene Ther 2007;14: Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO. Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors. J Gene Med 2005;7: Uprichard SL, Boyd B, Althage A, Chisari FV. Clearance of hepatitis B virus from the liver of transgenic mice by short hairpin RNAs. Proc Natl Acad Sci U S A 2005;102: Cockrell AS, Kafri T. Gene delivery by lentivirus vectors. Mol Biotechnol 2007;36: Levine BL, Humeau LM, Boyer J, MacGregor RR, Rebello T, Lu X, et al. Gene transfer in humans using a conditionally replicating lentiviral vector. Proc Natl Acad Sci U S A 2006;103: Abbas-Terki T, Blanco-Bose W, Deglon N, Pralong W, Aebischer P. Lentiviral-mediated RNA interference. Hum Gene Ther 2002;13: Nash KL, Alexander GJ, Lever AM. Inhibition of hepatitis B virus by lentiviral vector delivered antisense RNA and hammerhead ribozymes. J Viral Hepat 2005;12: Dandri M, Petersen J. Hepatitis B virus cccdna clearance: killing for curing? Hepatology 2005;42: Li GQ, Gu HX, Li D, Xu WZ. Inhibition of Hepatitis B virus cccdna replication by sirna. Biochem Biophys Res Commun 2007;355: Shin D, Kim SI, Kim M, Park M. Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice. Virus Res 2006;119:
System Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
<30322E535453BABBB9AE2DC6EDC1FD2E687770>
Covalently closed circular DNA activity in HBV infection 분당서울대학교병원내과 김진욱 Covalently closed circular DNA (cccdna) is a viral minichromosome from which HBV RNA replication intermediate (pregenomic RNA) is
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
Microsoft PowerPoint - pr 18 L8 ch26 RNA metabolism [호환 모드]
Processing of trna and rrna Bases are modified in post transcription rxs (see Fig. 26 22) Pseudouridine ( ) Thiouridine Dihydrouridine, etc. rrnas and trnas are cleaved from longer precursors Modified
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
Chapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
미래의학 - 맞춤형의학 유전자가위
미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin
Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등
44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
Cloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
SMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용
Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
PowerPoint 프레젠테이션
mrna (messenger RNA) : 양이가장적다 ( 전체 RNA 중 5-10% 이하 ) : mrna의염기서열은단백질의아미노산순서를지정 : 성장하는세포는수많은다른단백질을필요로함으로 mrna가만들어져단백질이합성되게한후 nucleotide가재생될수있도록분해된다 (trna, rrna도재생 ) : 5 말단의끝이 7-methyl guanosine triphosphate
Custom sirna Genepharma 는 ISO9000 품질경영시스템인증을획득하여 high quality, high purity 의 custom sirna 를생산, 제공해드립니다. 기본제공되는 duplex type 은 HPLC 정제로 unpaired single
2016 GenePharma RNAi Solution GenePharma는 RNAi 전문 기업으로 고효율, 고순도의 sirna, mirna mimics, mirna inhibitor, shrna plasmid를 최적의 가격으로 제공해드립니다. 코스모진텍은 국내 단독 대리점으로 전제품에 대한 상담, 견적, 발주를 진행합니다. 또한, 온라인 주문(www.cosmogenetech.com)으로
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
Slide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
슬라이드 1
TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
학습영역의 Taxonomy에 기초한 CD-ROM Title의 효과분석
,, Even the short history of the Web system, the techniques related to the Web system have b een developed rapidly. Yet, the quality of the Webbased application software has not improved. For this reason,
<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
Manufacturing6
σ6 Six Sigma, it makes Better & Competitive - - 200138 : KOREA SiGMA MANAGEMENT C G Page 2 Function Method Measurement ( / Input Input : Man / Machine Man Machine Machine Man / Measurement Man Measurement
Jksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
Journal of Educational Innovation Research 2018, Vol. 28, No. 2, pp DOI: IPA * Analysis of Perc
Journal of Educational Innovation Research 2018, Vol. 28, No. 2, pp.45-72 DOI: http://dx.doi.org/10.21024/pnuedi.28.2.201806.45 IPA * Analysis of Perception and Needs on Teaching Competencies of Faculty
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
Chapter 11
Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,
DBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
02-1³í´Ü-±èµµÇÑ
*Tel. 062-970-2485 / Fax. 062-970-3414 / E-mail. dhkim@gist.ac.kr,.,.. (1)? (2) 1. (URL) KoSBI (http://www.kosbi.or.kr) Receptor Tyrosine Kinase Consortium (http://receptorkinase.gsc.riken.jp) Hepatocyte
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
44-3대지.08류주현c
A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional
목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
À±½Â¿í Ãâ·Â
Representation, Encoding and Intermediate View Interpolation Methods for Multi-view Video Using Layered Depth Images The multi-view video is a collection of multiple videos, capturing the same scene at
[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
Slide 1
2013 년대리점집체교육 Exiqon 2013 년 2 월 21 일 ( 목 ) 1 Agenda 1. mirna 란무엇인가? 2. LNA 기술의장점 3. Exiqon 제품 RNA 샘플추출 cdna 합성 qpcr Array Northern blot/in situ Hybridization Inhibitor 4. 주문방법 2 이것만은꼭기억해주세요! 1. mirna 가무엇이고어디에쓰이는지안다
歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
01 sirna AccuTarget TM sirnas 35 Custom sirna 36 Genome-wide sirna 38 AccuTarget Genome-wide Predesigned sirna Library 39 AccuTarget Premade sirna Set
Custom sirna Genome-wide sirna sirna Oligonucleotide FAQs AccuTarget mirna mimics & inhibitors AccuTarget mirna Controls sirna & mirna Phone: 1588-9788 (ext.4->1) Email: sirna@bioneer.co.kr Email: sirna-support@bioneer.co.kr
°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis