03.원저01-김진욱( ).hwp

Transcription

1 The Korean Journal of Hepatology 2009 ; 15 : DOI: /kjhep 논평참조 B 형간염바이러스 X 유전자를표적으로하는렌티바이러스매개 short hairpin RNA 의항바이러스효과 서울대학교의과대학분당서울대학교병원내과 김진욱 이상협 박영수 정숙향 김나영 이동호 Abstract Inhibition of in vitro hepatitis B virus replication by lentivirus-mediated short-hairpin RNA against HBx Jin-Wook Kim, M.D., Sang Hyub Lee, M.D., Young Soo Park, M.D., Sook-Hyang Jeong, M.D., Nayoung Kim, M.D., Dong Ho Lee, M.D. Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Seoul National University Bungdang Hospital, Seongnam, Korea Backgrounds/Aims: Hepatitis B virus (HBV) replicates via RNA intermediates, which could serve as targets for RNA interference (RNAi). Vector-mediated short-hairpin RNA (shrna) can induce sustained RNAi in comparison to small interfering RNA. Lentiviral vector is known to induce prolonged RNAi with high transduction efficiency. In this study, we sought to test the in vitro efficacy of shrna delivered by a lentiviral vector in suppressing the replication of HBV. Methods: Two shrna sequences against the hepatitis B viral protein HBx (sh1580 and sh1685) were cloned downstream of the U6 promoter in an HIV-based plasmid to generate third-generation lentiviral vectors. HepAD38 cells were transduced with anti-hbx lentiviral vectors, and HBV replication was induced for 5 days. HBV DNA was isolated and quantified using real-time PCR. Results: Lentiviral vectors encoding the shrna against HBV transduced HepAD38 cells with high efficacy. The total intracellular HBV DNA content was significantly reduced by both sh1580 and sh1685 (2.9% and 12.0%, respectively; P<0.05). HBV covalently closed circular DNA (cccdna) was also suppressed significantly (19.7% and 25.5%, respectively; P<0.05). Conclusions: Lentivirus-mediated delivery of shrna against HBx can effectively suppress the replication of HBV and reduce HBV cccdna in cell culture systems. (Korean J Hepatol 2008;15:15-24) Key words: Hepatitis B virus; Lentivirus; MicroRNAs; RNA interference; sirna Received September 3, 2008; revised February 2, 2009; accepted February 17, 2009 Abbreviations: HBV, hepatitis B virus; HBx, hepatitis B x protein; PCR, polymerase chain reaction; RNAi, RNA interference; shrna, short hairpin RNA; sirna, small interfering RNA Corresponding author: Jin-Wook Kim, kimjw@snubh.org; Phone: 031) ; Fax: 031) 주소 : 경기도성남시분당구구미동 300, 분당서울대학교병원소화기내과 ( 우 ) This work was supported by The GlaxoSmithKline Research Fund of the Korean Association for the Study of the Liver (2005 GlaxoSmithKline Academic Scholarship of the Korean Association for the Study of the Liver)

2 The Korean Journal of Hepatology : Vol. 15. No 서론 RNA interference(rnai) 는세포내에서 RNA 를매개로하여염기서열에특이적으로표적유전자의발현을조절하는기전이다. 두가닥의 RNA (double stranded RNA) 가 RNaseIII enzyme Dicer 에의하여 21개의염기로이루어진 small interfering RNA(siRNA) 로처리된후 RNaseH core enzyme argonaute와결합하여 RNA-induced silencing complex(risc) 를형성하며, 이는상보적염기서열의전령 RNA(messenger RNA) 를분해함으로써특이적으로표적유전자의 posttranscriptional gene silencing(ptgs) 을유도한다. 1 B형간염바이러스 (hepatitis B virus; HBV) 는세포내증식과정중역전사과정을거치며, 역전사의주형이되는 RNA intermediate 는 sirna 의표적이될수있으리라추론할수있다. 실제로세포배양및생쥐모델에서 sirna가 HBV RNA를분해함으로써 HBV의증식을억제할수있음이여러보고에서확인되었다. 2-6 초기의 HBV 에대한 RNAi 관련연구는대부분합성 sirna(double stranded RNA oligonucleotide) 를이용하였는데, 합성 sirna 를이용한 RNAi 는시험관내에서표적염기서열에대한 dsrna를직접세포에핵산전달감염 (transfection) 시킴으로써단시간내에특정핵산서열에의한유전자발현억제효과를스크리닝할수있다는장점이있으나, 반감기가짧아유전자발현억제효과가 2~3일간정도만유지되므로지속적인항바이러스효과를나타내기위해서는다량의합성 dsrna 를반복주입하여야하는문제점이있다. Short hairpin RNA(shRNA) 를이용한 RNAi 의경우, 합성 dsrna 를직접주입하는대신 hairpin 구조의단일가닥 RNA를전사하는플라즈미드 DNA 를이용하며세포안으로주입된 DNA로부터전사된 shrna 는 microrna 와유사한처리과정을거쳐최종적으로 sirna 로변환된다. 7,8 세포내에주입된 DNA가잔존하는동안계속적으로 shrna 의전사가일어나므로 sirna 보다오래 RNAi가유지되지만, naked plasmid 로부터 shrna가전사되려 면표적세포의핵으로 plasmid 가이동하여야하므로활발히분열하는세포에서만 plasmid 의핵내전달이가능하다. 또한, 주입된 foreign DNA는다양한경로로세포내에서비활성화되어장기적인발현을기대하기어렵다. 렌티바이러스 (lentivirus) 는 retroviral vector 의일종으로분열하지않는세포도형질도입 (transduction) 이가능하며주입된유전자는수개월이상발현이가능하므로, 9 RNAi를장기간유지시키는데유리한장점을가진다. 10 본연구에서는렌티바이러스벡터를이용하여 HBV x protein 유전자 (HBx) 를표적으로하는 shrna 를세포내에발현시킨후, 유발된 RNAi 에의하여 HBV의증식이억제되는지를알아보고자하였다. 대상과방법 1 HBx gene에대한 shrna의제작 HBx 유전자염기서열을표적으로하는 21개핵산의 sirna 서열은 Ambion사 (Austin, Tx, USA) 의 web-based program 을이용하여스크리닝하였으며 (sirna Target Finder, techlib/misc/sirna_finder.html), 이중기존의보고 11,12 에서효과적으로 HBV를억제하였던두개의염기서열 ( , TGCACTTCGCTTCACCT CTGCACGT , AACGACCGACCTTG AGGCCTA) 을선택하였다 ( 표 1, 그림 1). 2. shrna를발현하는렌티바이러스벡터의제작각각의표적염기서열에대한 short hairpin RNA(shRNA) expression cassette는 polymerase chain reaction(pcr) 으로합성하였다. 10,13,14 Human U6 promoter sequence 를가지는 ptz U6+1 plasmid를 template로하여 5 U6 universal primer(5 - ATAAGAATGCGGCCGCCCCGGGGATCCA AGGTCGGG-3 ) 와표적염기서열을포함하는 3 primer( 표 1) 를사용하여기존의보고와동일한방법으로증폭하였다. 10,15 증폭된 PCR product 를 1%

3 Jin-Wook Kim, et al. Lentivirus-mediated short haipin RNA against HBx Table 1. Primer sequences for the generation of shrna-expressing cassettes against HBX gene Name Sequence Location* Scrambled shrna 46 sh sh GGAAGATCTAGAAAAAAGCACCTATAACAACGGTAGCTACACAAACTACCG TTGTTATAGGTGCCGGTGTTTCGTCCTTTCCACAAG-3 5 -GGAAGATCTAGAAAAAATGCACTTCGCTTCACCTCTGCACGTTCTCTTGAA ACGTGCAGAGGTGAAGCGAAGTGCACCGGTGTTTCGTCCTTTCCACAAG-3 5 -GGAAGATCTAGAAAAAACGACCGACCTTGAGGCCTACTACACAAATAGGCC TCAAGGTCGGTCGCCGGTGTTTCGTCCTTTCCACAAG Underlined nucleotides indicate sirna sequences (sense) for scrambled control and target area in HBX gene. Italicized nucleotides indicate loop sequence of shrna. *Nucleotide numbering is based on the reference sequence AF Figure 2. HIV7 lentiviral backbone plasmid. PCR-amplified shrna shuttle cassettes are cloned into the polylinker area. Figure 1. Organization of the HBV genome with respect to shrna sequences targeting HBV RNA. The four arrows indicate major open reading frames, and vertical bars indicate the initiation sites of each transcript of HBV. The target sequences of two shrnas (sh-1580 and sh-1685) are marked on the X gene area. agarose gel에서전기영동으로분리하여 3세대렌티바이러스 backbone plasmid(phiv7-gfp PL, 그림 2) 10 의 NotI / XbaI restriction enzyme site에클로닝하였으며, 염기서열분석을통하여해당 sh- RNA expression cassette 가삽입되었음을확인하였다. 합성된재조합렌티바이러스 backbone plasmid 는 core packaging plasmid(pmdlg/prre, prsv- Rev) 와 envelope plasmid(pmd2.vsvg) 와함께 calcium phosphate 를이용하여 293FT packaging cell line(invitrogen, Carlsbad, CA, USA) 에핵산전달감염시켰으며, 16 16시간이경과한후배양액을교환하여 24시간동안추가로배양한후상청액을 얻어 real-time reverse transcriptase(rt)-pcr 법으로렌티바이러스 genomic RNA titer를정량하였다. 17 요약하면, 배양상청액 100 µl로부터 Trizol(Invitrogen) 1 ml를이용하여 RNA를추출한후 10 µl의증류수에녹였다. Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) 에대한 primer(wpre1277f, 5 -CCGT TGTCAGGCAACGTG-3; WPRE1361R, 5 -AGC TGACAGGTGGTGGCAAT-3 ) 와 probe(wpre- 1314P, 5 -FAM-TGCTGACGCAACCCCCACTG T-TAMRA-3) 17 를사용하여 one-step real-time RT-qPCR 을시행하였으며, 18 PCR 반응의조성 (20 µl) 은다음과같다 : ABI real time PCR master mix(1x, Applied Biosystems, Foster City, USA), forward and reverse primer 800 nm, probe

4 대한간학회지제 15 권제 1 호 2009 nm, RNase OUT 1 U/µL, SuperScript III RT (Invitrogen) 5 U/µL, RNA template 2 µl. PCR cycle 은역전사과정을 50 에서 30분, 95 10분으로시행하였으며, 이후 PCR 증폭을 40 cycle(95 15 초, 60 1분 ) 시행하였다. 3. In vitro model of HBV replication and transduction of lentiviral vectors in HepAD38 cells 시험관내 HBV 증식의모델로는 HepG2 세포를기반으로 tetracycline-responsive CMV-IE promoter로조절받는 HBV genome을가지는 Hep- AD38 cell 19 을이용하였다. 배양액은 Dulbecco s modified Eagle s/f-12 medium(gibco Invitrogen) 을이용하였고 10% fetal bovine serum, 50 µg/ml penicillin, 50 µg/ml streptomycin, 0.3 µg/ ml tetracycline, 400 µg/ml G418(Invitrogen) 을첨가하였다. 12-well tissue culture plate에 /ml 의세포를분주하고 7일동안배양한후 2 개의 60 mm tissue culture dish에계대배양하였으며, 이때 dish 당 개의 lentiviral particle 을 polybrene(4 µg/ml, Sigma Aldrich Chemical Co., St. Louis, MI) 과함께배양액에첨가하였다. 다음날부터 5일간배양액에서 tetracycline 을제거하여 HBV replication을유도하였다. 형광현미경으로 green fluorescent protein(gfp) 발현을확인하였으며, 200배시야에서전체세포중형광을보이는세포를비교하여핵산전달효율을확인하였다. 한개의 tissue culture dish 로부터 genomic DNA extraction kit(bioneer, 대전, 대한민국 ) 를이용하여 DNA를분리, 20 µl의증류수에녹인후 1 µl를 total HBV DNA 정량에이용하였다. 나머지한 dish로부터 HepAD38 cell의세포핵에서단백질과결합된 DNA 분획을 Hirt extraction 20,21 을이용하여제거하여단백과결합하지않은 HBV covalently closed circular DNA(HBV cccdna) 분획을분리하였다. Plasmid-safe DNase(Epicentre Biotechnologies, Madison, WI, USA) 를이용하여 contaminating chromosomal DNA를제거한 후 20 µl의증류수에녹여 1 µl를 HBV cccdna 정량에이용하였다. HBV에대한렌티바이러스매개 shrna 의장기적억제효과를확인하기위하여, 2주간 HBV 발현을유도시킨 HepAD38 세포를 96-well tissue culture plate에 well당 개씩분주한후곧이어 sh1580 렌티바이러스를 particles/well의농도로넣어 transduction 시켰으며, tetracycline 이포함된배양액에서 4주간계대배양하였다. Lentiviral transduction 자체가 HepAD38 세포의성장에미치는영향을확인하기위하여동일한수 ( /dish) 의 sh1580 주입 HepAD38 세포와 control HepAD38 세포를 60 mm tissue culture dish 에분주한후 1주간배양하였으며, trypsin 처리로세포를얻어 trypan blue염색후 total / vialble cell number 를구하였다. Trizol 을이용하여 RNA를분리한후 3 µg의 RNA를 random hexamer 를시발체로하여 SuperScriptIII RT로역전사하였으며, 60 ng에해당하는 cdna를이용하여아래에기술된 HBS gene real-time quantitative PCR로 HBV RNA를정량하였고, GAPDH로보정하여상대적 cdna 양을계산하였다. GAPDH 정량에이용한 primer / probe는다음과같다 : forward(500 nm), 5 -GAAGGTGAAGGTCGGAGTC-3; reverse(500 nm), 5 -GAAGATGGTGATGGGATTTC-3; probe 5 -FAM-CAAGCTTCCCGTTCTCAGCC-3 -TA MRA. HBV relaxed circular DNA와 HBV cccdna의정량은 Applied Biosystems 7500 Real-Time PCR System(Applied Biosystems, Foster City, CA, USA) 을이용하여 real-time quantitative PCR assay로측정하였다. 세포내 HBV DNA의총량은 HepAD38 cell 로부터분리한총 DNA를이용하여 HBs gene 부위에대한 real-time quantitative PCR을시행하였으며, 22 사용된 primer와 fluorescent probe 의염기서열은다음과같다 : HBV rcdna-forward, 5 -CACATCAGGATTCCTAG GACC-3; HBV rcdna-reverse, 5 -GGTGAGT GATTGGAGGTTGG-3; probe, 5 -FAM-CAGA

5 김진욱외 5 인. 렌티바이러스매개 short hairpin RNA 의항 HBV 효과 Figure 3. Green fluorescent protein (GFP) expression in HepAD38 cells transduced with shrna-encoding lentivirus. Fluorescence images were superimposed on light-microscopy images to assess transduction efficiency. Control cells without lentiviral transduction showed no fluorescence (A), whereas cells transduced with lentivirus encoding scrambled shrna (B), sh-1580 (C), and sh-1685 (D) exhibited uniform cytoplasmic expression of GFP, demonstrating a lentiviral transduction efficiency of more than 95% (magnification 200 ). The images are representative of three independent experiments. GTCTAGACTCGTGGTGGACTTC-TAMRA-3. 반응조건은총 20 µl의반응액으로맞추어 Taq- Man Universal PCR Master Mix(1x, Applied Biosystems), template 1 µl, forward / reverse primer 500 nm, probe 200 nm로사용하였다. 반응 cycle은 50 C에서 2분, 95 C에서 10분동안반응시킨후 95 C에서 20초, 60 C에서 1분으로 45 cycle 증폭하였다. HBV sequence를가지는 pam6 plasmid(american Type Culture Collection, Manassas, VA, USA) 를 10 4, 10 6, 10 8, /ml 의농도로만들어 standard로이용하였으며, 정량에이용된 DNA의총량 ( 이용된세포의수 ) 을보정하기위하여 β-globin에대한 real-time PCR을동시에시행하였다 : 23 β-globin-forward, 5 -GTGCACCTGA CTCCTGAGGAGA-3 (final 900 nm); β-globinreverse, 5 -CCTTGATACCAACCTGCCCAG-3 (final 900 nm); β-globin-probe, 5 -FAM-AAGG TGAACGTGGATGAAGTTGGTGG-TAMRA-3 (final 200nM). HBV cccdna의정량은 chimeric primer를이용한기존의보고대로시행하였다. 24 요약하면, chimeric primer(5 -tcgctttcgggtccctcatgcaacgtgc-3 ) 를이용하여 HBV DNA(+) strand 에대한상보적 DNA를합성하였으며반응조건은다음과같다 : 10 µl reaction당 1 PCR reaction buffer, 500 nm chimeric primer, 200 nm each dntp, 1 U Hot- StarTaq DNA polymerase(qiagen Korea, 서울, 대한민국 ), 1 µl DNA template. 94 에서 7분간 initial denaturation시킨후 94 에서 20초, 50 에서 20초, 72 에서 45초로 15 cycle 증폭시켰다. 1 차반응의산물 3 µl를이용하여 real-time quantitative PCR을시행하였으며반응조건은다음과같다 : 10 µl reaction당 TaqMan Universal PCR Master Mix(1x, Applied Biosystems), forward primer 5 -tcgctttcgggtccct-3 (500 nm), reverse primer 5 -GCACCTCTCTTTACGCGGT C-3 (500 nm), probe 5 -FAM-CCCGTCTGTGCCTTCTC ATCTGCCG-3 -TAMRA(250 nm). 반응 cycle은

6 The Korean Journal of Hepatology : Vol. 15. No A B Figure 4. Quantification of HBV DNA in HepAD38 cells transduced with shrna-encoding lentivirus. Real-time quantitative PCR was performed to measure the total HBV DNA (A) and HBV cccdna (B). Final results are normalized against β- globin, which was measured simultaneously to ensure an identical DNA input for each group. Data are mean and SD values of triplicate samples from two independent experiments. *P<0.05 vs. scrambled shrna. 50 C에서 2분, 95 C에서 10분동안반응시킨후 93 C에서 10초, 62 C에서 35초로 45 cycle 증폭하였다. 통계분석은 independent t-test를이용하였으며, MedCalc(version , MedCalc Software, Mariakerke, Belgium) 을사용하여분석하였다. 결과 1. HepAD38 cell에서 shrna-encoding lentivirus 의형질도입효율 shrna 를발현하는렌티바이러스를 HepAD38 cell에형질도입시킨후 5일째에형광현미경을이용하여 GFP 발현을확인하였을때렌티바이러스를처리하지않은대조세포에서는형광신호를관찰할수없었으나 scrambled shrna 및 HBV에대한 shrna를 encoding하는렌티바이러스를첨가한 culture dish 에서는대부분세포의세포질에서 GFP 발현을확인할수있었다 ( 그림 3). 2. 렌티바이러스를매개로주입된 HBx-targeting shrna 가 HBV의증식에미치는영향 Lentivirus를매개로 HBx에대한 shrna를형질도입한 HepAD38 cell 로부터핵산을분리하여 정량적 PCR로 HBV DNA의발현을측정하였을때세포내총 HBV DNA는 scrambled shrna 와비교하여 2.9%(sh1580) 및 12.0%(sh1685) 로감소하였다 (P<0.05, 그림 4A). 세포핵으로부터분리한 HBV cccdna 를정량적 PCR로측정한결과, HBV cccdna 역시 scrambled shrna 투여군과비교하였을때 HBV에대한 shrna 를발현시킨세포에서 19.7%(sh1580) 및 25.5%(sh1685) 로감소하였다 (P<0.05, 그림 4B). sh1580의장기적항 HBV 효과를 lentiviral transduction 후 5주째에 real-time RT-PCR법으로평가하였을때, sh1580을주입한 HepAD38 세포에서는 HBV RNA의발현이대조군에비하여유의하게억제되었다 (100% vs 48.5%, P=0.005, 그림 5). Trypan blue염색후계수한세포수는대조군과 sh1580 주입군간에차이가없었으며 ( vs , P=0.685), non-viable cell도두군모두 1% 미만으로차이를보이지않았다. 고찰본연구에서는렌티바이러스벡터를이용하여 HBV에대한 shrna를 HepAD38 cell에서발현시켰을때 HBV의증식을효과적으로억제할수있

7 Jin-Wook Kim, et al. Lentivirus-mediated short haipin RNA against HBx Figure 5. Quantification of HBV RNA in HepAD38 cells at 5 weeks after transduction with the sh1580-encoding lentivirus. Real-time quantitative RT-PCR was performed to measure the total HBV RNA. Data are mean and SD values of triplicate samples. *P<0.05 vs. control. 음을확인하였다. 시험관내실험과동물실험결과 RNAi가여러가지바이러스를효과적으로억제할수있음이알려지면서새로운항바이러스치료제로응용될가능성이제시되었다. 25 현재 HIV-1 등몇몇바이러스질환에대한핵산기반치료 (nucleic acid-based therapy) 의임상시험이진행중이며 HBV의경우 shrna를 encoding하는 plasmid 를이용한제1상임상시험이시작되어, 25 RNAi를이용한 HBV 억제에대한연구는향후임상적응용가능성이매우높은 transitional research 분야이다. 하지만 RNAi 가임상적으로바이러스질환의치료에이용되기위해서는안전성과효율성면에서아직해결되어야할과제가많다. 안전성면에서는목표로하는유전자이외의다른유전자들의발현에영향을미치는소위 off-target effect 를고려하여야하며, 유사한염기서열의유전자억제, 인터페론시스템활성화, 세포내 microrna pathway 의포화에의한영향등이 off-target effect의원인으로제시되었다. 26,27 또한, RNAi 를만성바이러스간염의치료에응용하려면간세포로의전달효율을높여야하는데, 1) 외부에서주입된핵산치료제가표적장기 ( 간 ) 의모든세포에충분한양이효과적으로전달되어야하며, 2) 간세포내 최종작용부위까지 ( 핵또는세포질 ) 분해되지않고이동되어야하고, 3) HBV 감염을치료하는경우 cccdna가희석, 제거될때까지장기간치료효과가유지되어야하기때문이다. HBV에대한 sirna 를이용한 RNAi 관련기존보고들은대부분 sirna 주입후 2~3일이내에표적 mrna를측정하였으며, 3,28 이는 sirna 의작용기간이수일정도로짧기때문이다. sirna 의화학적구조를변형시켜서반감기를늘이고약력학적지표를개선시킬수있으나, 29 유전자발현억제효과가감소하며, 30 장기적인반복주사가필요한점은여전히현실적인제한요소가된다. shrna를이용한 RNAi의경우, RNA polymerase III promoter로조절되는플라즈미드가표적세포의핵에서 pre-mirna 와유사한루프를가지는단일가닥 RNA로전사된후 Exportin-5에의하여세포질로이동하여 Dicer 에의하여처리과정을거치면서 sirna 로변환된다. 25 HBV에대한 shrna 를이용한기존의보고의경우시험관내핵산전달에는 calcium phosphate 4,5 혹은 liposome 12,31,32 을이용하였으며, 동물실험에서는정맥주입시일시에높은압력을가하여간세포로핵산전달을유도하는 hydrodynamic injection법이이용되었다. 4,32 하지만이러한핵산전달방법은모두임상적으로적용할수있는방법이아니며, 플라즈미드단독주입으로는효율적인핵산전달을기대하기어렵다. 설령성공적으로핵안으로플라즈미드가전달되었다하더라도, sirna 보다는작용시간이길지만 HBV를근치할정도의장기적인발현을기대하기힘들다. 33 유전자치료에사용되는바이러스벡터를 RNAi 에응용한다면생체내에서핵산전달의효율을높일수있을것이기대되는바, 레트로바이러스, 34 아데노바이러스, 11,35 adeno-associated virus 36,37 등의벡터를이용한 RNAi가효과적임이보고되었다. HBV의경우 prototype foamy virus, 38 아데노바이러스, 39 adeno-associated virus 38 등을이용하여수주에서수개월까지 RNAi에의한억제효과가유지될수있었다

8 대한간학회지제 15 권제 1 호 2009 렌티바이러스벡터는기존의레트로바이러스벡터와는달리분열하지않는세포에도높은효율로유전자전달이가능하며, 전달된유전자를장기간발현시킬수있다는장점이있다. 9,10,40 또한 cisacting element를분리하여별도의플라즈미드로전달하는방법을채용함으로써 replication competent lentiviral vector 의생성을최소화하였으며, 3세대이후의렌티바이러스는스스로불활성화되는 (self-inactivating) 특징이있어역전사후 proviral DNA의복제가불가능하게되어안전성면에서도기존의레트로바이러스벡터보다현저히개선되었다. 40 HIV 감염환자를대상으로렌티바이러스벡터를이용한유전자치료의제1상임상시험에서특별한부작용은관찰되지않았으며, 41 현재제2 상임상시험이진행중이다 ( co.uk/genmed/clinical/). 렌티바이러스를이용하여 shrna 를세포내에전달한경우표적유전자가 3주이상억제됨이보고되어, 42 RNAi 를장기간유지시키기에적합한특성을가지고있다. 본연구에서는형질주입후 5일까지 shrna 에의한항HBV 효과가유지됨을확인하여통상의 sirna oligonucleotide 보다긴작용시간을보였으며, 계대배양결과 5주까지 HBV의증식억제효과를관찰할수있었다. 렌티바이러스를이용하여 HBV에대한 antisense RNA와 hammerhead risozyme 를전달함으로써 HBV의증식을억제한보고가있었으나, 43 렌티바이러스를매개로하는 HBV에대한 RNAi 는아직보고되지않았다. 본연구에서정립한렌티바이러스매개 shrna 모델은 HBV에대한장기적인 RNAi의효과를규명하는연구에응용될수있으며, 향후유전자이입에의한항HBV 치료의전임상및임상시험을계획하는경우이론적인근거로서이용될수있다. 본연구에서는 total intracellular DNA 및 cccdna를정량하여 shrna 의항HBV 효과를평가하였으며, HepAD38 세포는염색체에 HBV genome 을포함하고있으므로 genomic DNA에의한 contamination 의가능성을생각해볼수있다. 하 지만, 연구자의실험결과 HepAD38 cell에서 HBV relaxed circular DNA / HBV cccdna ratio 가 10 2 ~10 4 정도이므로 ( 자료미제시 ) 세포당 HBV ccc- DNA가 1 copy 이상임을고려하면 genomic DNA 의오염에의한영향은미미한것으로판단된다. 기존에 lipofectamine 을이용하여 shrna expression cassette를 Huh7 세포에 transduction시킨연구결과에서는 HBsAg 분비를대조군의 5% 미만으로감소시킴을보고하였는바, 11 본연구에서도 2.9% 로서유사한정도의 HBV 억제효과를보였다. 하지만 HBV RNA를정량하였을때에는대조군의 35% 수준으로억제되었으며, 11 본연구에서도보다장기간배양효과이지만 48.5% 의억제효과를관찰하여, RNA 수준과 downstream의 relaxed circular DNA 및단백수준의억제효과간에는차이가있을것으로예상된다. 장기간 shrna 투여로인하여 HBV genome 의돌연변이가유발될가능성을생각해볼수있으며, 이에대해서는추가연구가필요하다. 본연구에서선택한 HBV X protein 유전자 (HBx) 부위는전사, 신호전달, 세포주기, 단백분해, 세포자멸등다양한기능을나타내는조절인자로알려져있다. 하지만 HBV의 4개의 open reading frame 으로부터전사되는 major transcript 는모두공통의 poly A 부위에서끝나게되어 3 말단부위에동일한염기서열을공유하고본연구에이용된 shrna 는모두이공통서열부위를표적으로하므로 ( 그림 1), 본연구에서의 HBV DNA 억제효과가 X 유전자 transcript 에작용하였기때문인지, 혹은 HBV genome 역전사의주형으로작용하는 pregenomic RNA에작용하여나타났는지는본연구결과만으로는확인이불가능하여추가연구가필요한부분이다. 흥미롭게도, 본연구결과 HBV에대한 shrna 는 relaxed circular DNA뿐아니라 cccdna의양도유의하게감소시킴을확인할수있었다. HBV 에대한 shrna 가 cccdna를억제하는기전으로는 shrna 가세포질내 HBV RNA에작용하여 viral nucleocapsid 의생성을억제함으로써세포핵

9 김진욱외 5 인. 렌티바이러스매개 short hairpin RNA 의항 HBV 효과 으로의 recycling 과정을차단하였기때문으로생각되나, 염색체에삽입된 HBV 유전자로부터전사되는 mrna에직접작용하여 HBV pregenonmic RNA를감소시켰을가능성도고려할수있다. Viral nucleocapsid 로부터 HBV cccdna의재공급이차단된상태에서 HepAD38 cell이지속적으로분열하게되면세포당 HBV cccdna의개수는희석, 감소하게된다. 44 최근한연구에서 HBV에대한 sirna 를 encoding 하는플라즈미드를주입하여 4일째에약 50% 의 HBV cccdna를감소시킬수있음이보고되었으며, 45 저자는 nuclear localizing signal의억제가 HBV genome 의핵내이동을차단하여 cccdna 의감소를초래하였을것으로제시하였다. shrna 에의한 HBV cccdna 감소효과의기전과의미에대해서는추가연구가필요하다. 요약배경 / 목적 : RNA interference 는 double stranded RNA가상보적인 mrna 를억제하는세포내방어기전으로서, small interfering RNA가 HBV RNA 를억제할수있음이알려졌다. 바이러스벡터를이용하여전달된 shrna 는 sirna 에비하여보다지속적인 RNAi를유도할수있다. 렌티바이러스벡터를이용한 RNAi는높은효율로장기적인유전자억제효과를나타낸다. 본연구에서는렌티바이러스를이용하여전달된 shrna 가 HBV의증식을억제할수있는지를알아보고자하였다. 대상및방법 : HBx 유전자에대한두종류의 shrna 를렌티바이러스벡터에삽입하여 HepAD38 cell에전달한후 real-time PCR로 HBV DNA를정량하였다. 결과 : HBV에대한 shrna 를 encoding 하는렌티바이러스벡터는효율적으로 HepAD38 cell을감염시켰다. HBV에대한 shrna 는세포내총 HBV DNA를 2.9~12% 로감소시켰으며, HBV cccdna 또한 19.7~25.5% 로유의하게억제하였다. 결론 : 렌티바이러스를매개로하는 RNAi는세포내에서효과적으로 HBV의증식을차단할수있다. 색인단어 : B형간염바이러스, 렌티바이러스, micro- RNAs, RNA interference, sirna 참고문헌 1. Hammond SM. Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett 2005;579: Giladi H, Ketzinel-Gilad M, Rivkin L, Felig Y, Nussbaum O, Galun E. Small interfering RNA inhibits hepatitis B virus replication in mice. Mol Ther 2003;8: Hamasaki K, Nakao K, Matsumoto K, Ichikawa T, Ishikawa H, Eguchi K. Short interfering RNA-directed inhibition of hepatitis B virus replication. FEBS Lett 2003; 543: McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, et al. Inhibition of hepatitis B virus in mice by RNA interference. Nat Biotechnol 2003;21: Shlomai A, Shaul Y. Inhibition of hepatitis B virus expression and replication by RNA interference. Hepatology 2003;37: Ying C, De Clercq E, Neyts J. Selective inhibition of hepatitis B virus replication by RNA interference. Biochem Biophys Res Commun 2003;309: Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296: McManus MT, Petersen CP, Haines BB, Chen J, Sharp PA. Gene silencing using micro-rna designed hairpins. RNA 2002;8: Kafri T, Blomer U, Peterson DA, Gage FH, Verma IM. Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 1997;17: Li MJ, Rossi JJ. Lentiviral vector delivery of recombinant small interfering RNA expression cassettes. Methods Enzymol 2005;392: Carmona S, Ely A, Crowther C, Moolla N, Salazar FH, Marion PL, et al. Effective inhibition of HBV replication in vivo by anti-hbx short hairpin RNAs. Mol Ther 2006;13: Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, et al. Stable inhibition of hepatitis B virus expression and replication by expressed sirna. Biochem Biophys Res Commun 2005;335: Castanotto D, Li H, Rossi JJ. Functional sirna expression from transfected PCR products. RNA 2002;8: Scherer LJ, Yildiz Y, Kim J, Cagnon L, Heale B, Rossi JJ. Rapid assessment of anti-hiv sirna efficacy using PCRderived Pol III shrna cassettes. Mol Ther 2004;10: Kim JW, Zhang YH, Zern MA, Rossi JJ, Wu J. Short hairpin RNA causes the methylation of transforming

10 The Korean Journal of Hepatology : Vol. 15. No growth factor-beta receptor II promoter and silencing of the target gene in rat hepatic stellate cells. Biochem Biophys Res Commun 2007;359: Follenzi A, Naldini L. Generation of HIV-1 derived lentiviral vectors. Methods Enzymol 2002;346: Lizee G, Aerts JL, Gonzales MI, Chinnasamy N, Morgan RA, Topalian SL. Real-time quantitative reverse transcriptase-polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Hum Gene Ther 2003;14: Geraerts M, Willems S, Baekelandt V, Debyser Z, Gijsbers R. Comparison of lentiviral vector titration methods. BMC Biotechnol 2006;6: Ladner SK, Otto MJ, Barker CS, Zaifert K, Wang GH, Guo JT, et al. Inducible expression of human hepatitis B virus (HBV) in stably transfected hepatoblastoma cells: a novel system for screening potential inhibitors of HBV replication. Antimicrob Agents Chemother 1997;41: Hirt B. Selective extraction of polyoma DNA from infected mouse cell cultures. J Mol Biol 1967;26: Zhang YY, Summers J. Low dynamic state of viral competition in a chronic avian hepadnavirus infection. J Virol 2000;74: Takehara T, Suzuki T, Ohkawa K, Hosui A, Jinushi M, Miyagi T, et al. Viral covalently closed circular DNA in a non-transgenic mouse model for chronic hepatitis B virus replication. J Hepatol 2006;44: Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, et al. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 1998;62: Jun-Bin S, Zhi C, Wei-Qin N, Jun F. A quantitative method to detect HBV cccdna by chimeric primer and real-time polymerase chain reaction. J Virol Methods 2003; 112: Haasnoot J, Westerhout EM, Berkhout B. RNA interference against viruses: strike and counterstrike. Nat Biotechnol 2007;25: Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR, et al. Fatality in mice due to oversaturation of cellular microrna/short hairpin RNA pathways. Nature 2006;441: Martin SE, Caplen NJ. Applications of RNA interference in mammalian systems. Annu Rev Genomics Hum Genet 2007;8: Konishi M, Wu CH, Wu GY. Inhibition of HBV replication by sirna in a stable HBV-producing cell line. Hepatology 2003;38: Morrissey DV, Lockridge JA, Shaw L, Blanchard K, Jensen K, Breen W, et al. Potent and persistent in vivo anti-hbv activity of chemically modified sirnas. Nat Biotechnol 2005;23: Czauderna F, Fechtner M, Dames S, Aygun H, Klippel A, Pronk GJ, et al. Structural variations and stabilising modifications of synthetic sirnas in mammalian cells. Nucleic Acids Res 2003;31: Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, et al. Inhibition of hepatitis B virus replication by stably expressed shrna. Biochem Biophys Res Commun 2003;311: Wu HL, Huang LR, Huang CC, Lai HL, Liu CJ, Huang YT, et al. RNA interference-mediated control of hepatitis B virus and emergence of resistant mutant. Gastroenterology 2005;128: Chen Y, Cheng G, Mahato RI. RNAi for treating hepatitis B viral infection. Pharm Res 2008;25: Barton GM, Medzhitov R. Retroviral delivery of small interfering RNA into primary cells. Proc Natl Acad Sci U S A 2002;99: Arts GJ, Langemeijer E, Tissingh R, Ma L, Pavliska H, Dokic K, et al. Adenoviral vectors expressing sirnas for discovery and validation of gene function. Genome Res 2003;13: Tomar RS, Matta H, Chaudhary PM. Use of adenoassociated viral vector for delivery of small interfering RNA. Oncogene 2003;22: Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, et al. Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8- delivered short hairpin RNA. Gene Ther 2007;14: Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO. Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors. J Gene Med 2005;7: Uprichard SL, Boyd B, Althage A, Chisari FV. Clearance of hepatitis B virus from the liver of transgenic mice by short hairpin RNAs. Proc Natl Acad Sci U S A 2005;102: Cockrell AS, Kafri T. Gene delivery by lentivirus vectors. Mol Biotechnol 2007;36: Levine BL, Humeau LM, Boyer J, MacGregor RR, Rebello T, Lu X, et al. Gene transfer in humans using a conditionally replicating lentiviral vector. Proc Natl Acad Sci U S A 2006;103: Abbas-Terki T, Blanco-Bose W, Deglon N, Pralong W, Aebischer P. Lentiviral-mediated RNA interference. Hum Gene Ther 2002;13: Nash KL, Alexander GJ, Lever AM. Inhibition of hepatitis B virus by lentiviral vector delivered antisense RNA and hammerhead ribozymes. J Viral Hepat 2005;12: Dandri M, Petersen J. Hepatitis B virus cccdna clearance: killing for curing? Hepatology 2005;42: Li GQ, Gu HX, Li D, Xu WZ. Inhibition of Hepatitis B virus cccdna replication by sirna. Biochem Biophys Res Commun 2007;355: Shin D, Kim SI, Kim M, Park M. Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice. Virus Res 2006;119: