05.fm

Size: px

Start display at page:

Download "05.fm"

정헌 양
6 years ago
Views:

pissn 1229-1153 / eissn 2465-9223 J. Food Hyg. Saf. Vol. 31, No. 1, pp. 28~35 (2016) http://dx.doi.org/10.13103/jfhs.2016.31.1.28 Journal of Food Hygiene and Safety Available online at http://www.

1 pissn / eissn J. Food Hyg. Saf. Vol. 31, No. 1, pp. 28~35 (2016) Journal of Food Hygiene and Safety Available online at 국내에서유통되는 8 종의식육감별을위한 multiplex PCR 법개발 허은정 고은경 1 윤향진 1 김연화 1 김영조 박현정 위성환 1 문진산 1 * 식품의약품안전처, 1 농림축산검역본부동물약품관리과 Development of Multiplex PCR Assay for Identification of Eight Species from Meats in Korea Eun-Jeong Heo, Eun-Kyung Ko 1, Hyang-Jin Yoon 1, Yeon-Hwa Kim 1, Young-Jo Kim, Hyun-Jung Park, Sung-Hwan Wee 1, and Jin-San Moon 1 * Ministry of Food and Drug Safety, Cheong-ju 28159, Korea 1 Veterinary Pharmaceutical Management Division, Animal and Plant Quarantine Agency, Anyang 14089, Korea (Received September 11, 2015/Revised January 8, 2016/Accepted February 18, 2016) ABSTRACT - Species identification of animal tissues in meat products is an important issue to protect the consumer from illegal and/or undesirable adulteration; for economic, religious and health reasons. In this reason, accurate analytical methods are needed for the labeling of meat products with requiring simple and fast procedure. Recently, applications of PCR in food analysis have been increased because of their simplicity, specificity and sensitivity. Therefore, in this study, a multiplex PCR assay was developed for the simultaneous identification of eight species of cow, pig, chicken, duck, goat, sheep, horse and turkey from raw meats. The primers were designed in different regions of mitochondrial 16S RNA after alignment of the available sequences in the GenBank database. Two multiplex primer sets were designed as Set 1 (cow, pig, chicken, duck) and Set 2 (goat, sheep, horse, turkey), respectively. Total 274 samples from cow (n = 55), pig (n = 30), chicken (n=30), and duck (n = 30), goat (n = 40), sheep (n = 33), horse (n = 41), and turkey (n = 15) were tested. The primers generated specific fragments of 94, 192, 279, 477 bp (pig, chicken, cow, duck), 670, 271, 152, 469 bp (goat, sheep, horse, turkey) lengths for eight species, respectively. The animal species specificity was 100% in all eight samples in the multiplex PCR assay. The detection limit of the multiplex PCR assay showed from 100 fg to 1 pg of template DNA from extracted from raw meats. When applying multiplex PCR assays to sample from pork/beef and pork/chicken, beef/chicken tested raw mixed meats and heat-treated (83 o C for 30min, 100 o C for 20min, and 121 o C for 10min) mixtures, detection limit was 0.1% level beef, pork and pork in beef and chicken in pork and 1.0% level pork in chicken. This study suggest that the developed multiplex PCR assay can be used for rapid and simultaneous species identification of cow, pig, chicken, duck, goat, sheep, horse and turkey from meats. Key words : raw meat, meat processed products, differentiation of meat species, PCR 소, 돼지, 닭, 오리고기는우리나라에서주로유통되고있는육류이다. 염소, 양, 말, 칠면조는외국인이민자및유학생등이주민들이최근에많아지면서그소비량이점차적으로증가하고있는추세이다 15). 최근값싼식품원료를사용하거나표시사항을허위로기재하여소비자를기만하는가짜식품 (Economically Motivated Adulteration: EMA) *Correspondence to: Jin-San Moon, Veterinary Pharmaceutical Management Division, Animal and Plant Quarantine Agency, Anyang 14089, Korea Tel: , Fax: moonjs727@korea.kr 의제조 유통으로인하여이에대한소비자의불안감이높아지고있다. 이러한가짜식품은건전한식품유통질서를어지럽히는주범이기때문에국가적차원에서의식육안전관리가필요하다. 특히, 종교적이유및일부특정육류에대한알러지반응등의문제로정확한육제품의표기는국내외에서중요한사회적문제로대두되고있다 5,8,16,23). 미국식품의약품안전청 (Food and Drug Administration, FDA) 과영국식품기준청 (Food Standard Agency, FSA) 에서도최근에늘어나는가짜식품, 가짜의약품, 가짜화장품등에대한관리를강화하고있으며, 유럽에서는가짜원료가혼입되어있는식품으로부터소비자를보호하기위 28

2 Development of Multiplex PCR Assay for Identification of Eight Species from Meats in Korea 29 하여식품안전과이력추적제도에관련된 European Union regulation을설정하였다 4,13). 국내에서도식육가공품의종류가다양화되고세분화되고있는가운데육가공제조업체에서저가의고기가고가의육류로둔갑되어유통되거나가공육제품의원료로사용될경우에축산식품의표시사항을허위로기재하거나비의도적으로잘못표시하는등, 저가의육류를부정하게혼합된제품등에대한검증과부정유통을예방할수있는신속하고정확한식육감별법의개발이필요한실정이다 11,23). 현행축산물의가공기준및성분규격에는식육감별을위한검사법으로서이화학적방법, 혈청학적검사법, 효소면역학적검사법, 유전자검사법이있다 20). glycogen검사법, 지방검사법및자비법은식육감별기준이모호하거나매우주관적이고, DNA hybridization법과혈청학적검사법인면역혈청침강반응, 미량겔확산법그리고한천겔확산법은근연종에서교차반응이발생하며, 히스티딘디펩타이드법은두가지이상의혼합육에서는식육을감별할수없는단점이있다 11,16). 식육품종감별에있어서최근에국내외여러연구자가식육감별을위하여 12S rrna, 16S rrna, 그리고 cytochrome b (cyt b) 와같은미토콘드리아 DNA (mt DNA) 유전자에기반을둔 PCR 검사를활용하고있다. 이검사법은신속성, 민감성, 특이성에서우수하기때문에반추류 ( 소, 면양, 산양, 사슴 ), 가금류 ( 닭, 칠면조, 오리, 거위 ), 개, 고양이, 그리고돼지와같은축종을감별하는데가장널리쓰이고있다 9,14,17,18,22,24,29). 특히, mt DNA 유전자는핵내 DNA보다세포당수천개의 copy number가있어열변성에의해야기된 DNA 단편으로부터적절한크기로증폭될수있고, 다양한축종에서보고된염기서열의유용성뿐만아니라동물 mt DNA 유전자구성에관한방대한정보를가지고있다. 또한 PCR 증폭을위한축종별특이 primer를쉽게설계할수있고, mt DNA의큰변이성때문에혼합물에서신뢰성있는축종감별이가능하다는장점을지니고있는것으로보고되었다 6,16,21,25,30). 최근에는국내외에서두가지이상의혼합된축산물에대하여동시에신속하고간편하게감별해낼수있는장점이있는 multiplex PCR 방법이개발되었다 4,7,10,19,30). 국내에서는 Park 등 (2012) 23) 이 12S rrna와 16S rrna 유전자를활용하여 10종의축종에대한 single PCR법을개발한바있다. 또한, Ko 등 (2011) 16) 도 12S rrna와 16S rrna 유전자를활용하여소, 돼지, 닭, 오리 4종과가금류 4종 ( 닭, 오리, 거위칠면조 ) 에대한 multiplex PCR법을개발하여각축종별 1개의시료를대상으로 121 o C의 30 분열처리조건에서적용하여평가한바있다. 또한, Multiplex PCR법을충족시키기위해서는축종별특이적인 primer 의 PCR 온도조건의일치, 증폭산물의적절한크기, 표적유전자간에교차반응을제거해야하는등여러가지조 건이만족되어져야한다고보고하였다 16). 이러한이유로그동안국내에서는식육감별을위한 multiplex PCR법개발및식육또는일부축산물가공품에대하여전처리조건및적용여부등제한된내용의연구와평가가이루어진실정이다 16,23). 이에본연구에서는국내에서가장널리유통되고있는소, 돼지, 닭, 오리, 염소, 양, 말, 칠면조 8종의식육, 혼합육, 열처리가공육에대하여동시에신속하게감별할수있는 multiplex PCR법을개발하였다. 이를위하여미토콘드리아 16S RNA에서종특이부위를선발하고각종에대한특이도를높이기위하여인위적인미스매치를주어프라이머를제작하여국내대표식육인소, 돼지, 닭, 오리의 4종식육과염소, 양, 말, 칠면조의 4종식육을동시에감별할수있는두 set의 multiplex PCR법을각각개발하였다. Materials and Methods 시료 2012년 1월부터 12월까지 8종식육의 274개시료 ( 소 55, 돼지 30, 닭 30, 오리 30, 염소 40, 말 41, 양 33, 칠면조 15두 ) 를 1년동안도축장및식육판매업체에서채취하였다. 식육검사법의축종특이도와검출한계를평가하기위하여혼합육제조및열처리조건은다음과같이실시하였다. 즉, 인위적으로쇠고기와돼지고기, 돼지고기와닭고기, 쇠고기와닭고기등 3종으로각각혼합하여쇠고기, 돼지고기, 닭고기를비율별로 9:1로혼합하였다. 또한, 쇠고기, 돼지고기, 닭고기혼합육에대하여식육가공품의가공조건을고려하여, 83 o C에서 30분, 100 o C에서 20분, 121 o C 에서 10분으로각각열처리하였다. 식육에대한축종확인을위하여미국식육감별법으로등재되어있는 Biokits raw species identification test kit TM 및 Biokits cooked species identification test kit TM (BioKits, USA) 로검사하여키트의검사결과와일치한시료만채택하여 PCR 검사에사용하였다 11). DNA 추출및농도측정 8종의식육으로부터 DNA의추출및정제는 Dneasy Blood & Tissue kit (Qiagen GmbH, Hiden, Germany) 를사용하여실시하였다. 추출및정제한게놈 DNA의정량분석은 Spectrophotometer AND-1000 (Nanodrop, USA) 을이용하였으며, nm에서흡광도를측정하여 DNA의농도와순도를확인하였다. 멸균증류수를이용하여모두 5ng/uL로보정한후실험사용전까지 20 o C에보관하였다. 프라이머설계및 PCR 반응조건미국의 NCBI (National Center for Biotechnology Infor-

3 30 Eun-Jeong Heo et al. Table 1. DNA sequences of the oligonucleotide primer for identification of the eight animal species in this study Item Animal Primer sequences (5 3) Conc. (pmole/rxn) Size (bp) Cow F : CCCTCTCGACTAAACAACCAAG R : GAAAAATAGATGAGTTAGTTTTTGG set Pig Chicken F : TCTCTTAAAAATACATTGGAATTTAGGGgTTT R : tcgagctgggtgatagctgg F : CGAGCTGaacGATAGCTGGTT R : TGCGGGGAGGGGTGATTA Duck F : CCCCTCAAAGTGCTAATAGTGACC R : GTAGCTTACTATTGTTGTTTGTGGCAT Horse F : TCCTCTAGCTGGAAATGTGGCG R : TTTGATATTGGGATAGATCCGGT set Sheep Goat F : AACATCACCTCCAGCgcCCtTA R : TGGTGGTTGAATTTATTTTCCTTGAGT F : CCCAACAATAGTACAACTAACTCCTAGgCC R : GGATCAATAAGCGATAATTTaATTTGAC Turkey F : GTTTGCCCTCCCGAAACC R : ATAATGTGTTAATGTAAGTTTACGCTGCG mation) 에등록된소, 돼지, 닭, 오리, 말, 양, 염소, 칠면조의미토콘드리아 DNA (16S RNA) 염기서열정보를바탕으로상동성을검사하여축종별종특이적인염기서열을갖는부분을선발하였다. 각각의구간에서증폭하였을때각기다른크기의 PCR 증폭산물이생성될수있는프라이머를제작한후 8종의축종에대한감별력이있는것을최종마커후보도선발하도록최종선발된소, 돼지, 닭, 오리 4종의프라이머셋트와말, 양, 염소, 칠면조 4종에대한각각의마커는 150 bp이상에서 700 bp이하의각기다른크기의 PCR 증폭산물이생성될수있도록설계하였다 (Table 1). 본연구에서는국내에서축산물로소비되고있는 8종의식육중주요식품인소, 돼지. 닭, 오리와나머지 4종의축종으로구분하여검사비용및비특이문제를해결하여검사의정확도를높이고자 Two set의 Primer를이용하여 multiplex PCR법을개발하였다. 즉, Set 1은소, 돼지, 닭, 오리검출용으로, Set 2는양, 말, 염소, 칠면조를한번에 Table 2. PCR reaction and condition of multiplex PCR for for identification of the eight animal species Amplification reaction Amplification condition 2X PCR premix 10.0 μl 95 o C 15min 1 Primer F(10p) 1.0 μl 95 o C 30sec Primer R(10p) 1.0 μl 60 o C 30sec 35 Template (5 ng/μl) 2.0 μl 72 o C 1min D W 6 μl 72 o C 3min 1 Total 20 μl 10 o C forever 검출할수있는용도로구분하여각각 4종개체씩섞인게놈 DNA를이용하였으며, 음성대조군 (negative control) 으로는증류수를사용하여교차오염의여부를확인하였다. 각각의 primer sequence와 multiplex PCR을위한 DNA 농도는 Table 1과같다. Multiplex PCR 반응에는 Veriti 96 well Thermal Cycler (ABI, USA) 를사용하였고, PCR 반응조건은 95 o C에서 15 분간전-변성 (pre-denaturation) 을실시한후 95 o C에서 30초간변성 (denaturalization), 58 o C에서 30초간어닐링 (annealing), 72 o C에서 1분간연장 (extention) 을 35 사이클로수행한후, 마지막으로 72 o C에서 3분간최종연장과정을수행하였다 (Table 2). PCR 증폭산물은증폭된단편의크기가예상된대립유전자크기범위내에존재하는지와, PCR 조건의적정성여부를확인하기위하여 EtBr (ethidium bromide) 이포함된 3% 아가로스젤에전기영동하고 UV상에서관찰하였다. Multiplex PCR법의특이도및민감도조사 Multiplex PCR법의특이도및검출한계의조사를위해생육을포함하여인위적으로제조한국내대표식육인소, 돼지, 닭고기혼합하고, 식육가공품의가공조건을고려하여열처리하였다. 즉, 쇠고기와돼지고기, 돼지고기와닭고기, 쇠고기와닭고기등 3종으로각각혼합하였다. 혼합비율은두종류의비율이각각 99.9%, 99%, 90%, 70%, 50%, 30%, 10%, 1%, 0.1% 가되도록혼합하였다. 또한, 쇠고기, 돼지고기, 닭고기혼합육에해당하는식육가공품의가공조건을고려하여, 83 o C에서 30분, 100 o C에서 20분, 121 o C에서 10분으로각각열처리한다음축종감별의특이

4 Development of Multiplex PCR Assay for Identification of Eight Species from Meats in Korea 31 도와민감도 ( 검출한계 ) 를조사하였다. Results and Discussion Multiplex PCR법의최적화프라이머의디자인은 PCR 진단법의특이성을결정하는데있어서가장중요한요소이다 19). 또한, 가공식품의경우고압, 살균과같은가공처리과정을거치면서단백질변성및수용성단백질프로파일의변화가일어나기때문에최근에단백질보다상대적으로안정성이유지되는 DNA 분석을통해신속정확하고신뢰도높은 PCR 기술로원료성분을분석하는방법을사용하고있는추세이다 1). 또한, 제조공정중가열, 압력등에의하여세포에존재하는유전자가손상되어 PCR 방법을적용하기위해서는 PCR 산물의크기는가능한 200 bp 이내로프라이머를디자인해야한다 2,27). 또한, single PCR법의경우에식육품종이많을경우에감별실험진행시각품종별프라이머를사용해야하는번거로움이있다. multiplex PCR법의경우감별하고자하는품종을동시에진단할수있어실험과정의번거러움이줄어좀더신속하게품종감별이용이한장점이있어서국내외에서식육감별목적으로적용되었다 4,12,16). 식육감별을위한 Multiplex PCR법의민감도는축종, 유전자, 증폭유전자의길이등에의해서차이를나타낸다 12). 이러한점을고려하여본연구에서는민감도및특이도가높은 multiplex PCR법을개발하고자미국의 NCBI에등록된소, 돼지, 닭, 오리, 말, 양, 염소, 칠면조 8종의미토콘드리아 16S RNA 염기서열정보를바탕으로소 29개, 돼지 13개, 닭 18개, 오리 10개, 말 22개, 양 9개, 염소 5 개, 칠면조 15개의마커를일차적으로선발하였다. 선발된마커를이용하여프라이머를제작한후증폭시켰을때소, 돼지, 닭, 오리의경우에는 50~500 bp 이하로, 말, 양, 염소, 칠면조의경우에는 150~700 bp 이하의각기다른크기의 PCR 증폭산물이생성될수있도록, 그리고다른축종에교차반응을보이지않도록프라이머를제작한다음축종별 10두씩 genomic DNA를추출하여검사를실시한결과소, 오리, 말, 칠면조 4종의각프라이머의경우에는다른종에서는증폭되지않는것을확인할수있었다. 이에반하여돼지, 양, 염소, 닭의 4종각프라이머는다른종에결합하는비특이밴드를형성하였다. 그리하여특이도를향상시키기위해야생형 (wild type) 의염기위치에인위적인미스매치 (mismatch) 염기를삽입하여비특이밴드가증폭되지않도록하였다. 프라이머이외에 multiplex PCR 검사법의충족시키기위해서는 PCR 온도조건의일치, 증폭산물의적절한크기, 표적유전자간에교차반응을제거해야하는등여러가지조건이만족되어져야한다 16,28,31). 이에본연구에서는이러한점을감안하여최종선발된종특이적전방향 및역방향프라이머셋트에대해 PCR 증폭산물의강도를고려하여반응당해당프라이머의농도를 Table 1에서와같이조절하고, PCR 반응조건을평가하였다. 그결과검사시료인 DNA (5 ng/ul) 2 ul와프라이머믹스 2 ul, 2 X PCR premix 10 ul, 증류수 6uL를첨가하여 95 o C에서 15분간전-변성을실시한후 95 o C에서 30초간변성, 60 o C 에서 30초간어닐링, 72 o C에서 1분간연장을 35사이클수행한후마지막으로 72 o C에서 3분간최종연장과정을수행할때가장적절한반응조건을보이는것으로나타났다 (Table 2). Multiplex PCR법의축종별민감도및특이도최종선발된축종별 PCR 프라이머를이용하여증폭된단편의크기가예상된대립유전자의크기범위내에존재하는지와 PCR 조건의적정성을재평가하기위하여본연구에서 8종의식육 274개시료를대상으로특이도를조사하였다. 그결과프라이머 Set 1( 소, 돼지, 닭, 오리 ) 에서는소, 돼지, 닭, 오리 4종의모든시료의축종에서 Fig. 1에서와같이각각 279, 94, 192, 477 bp의특이유전자증폭산물을확인할수있었다. 또한, 소, 돼지, 닭, 오리의 DNA 를혼합한시료의경우각각의축종특이적인 PCR 증폭산물이검출되었다 (Fig. 2). 동일한시료를대상으로프라이머 Set 2( 말, 양, 염소, 칠면조 ) 에적용한바, 말에서는 152 bp, 양은 271 bp, 염소는 670 bp, 칠면조는 469 bp에서뚜렷한 PCR 유전자산물이확인되었지만, 소, 돼지, 닭, 오리의시료에는반응하지않는것으로나타났다 (Fig. 3). 또한, 말, 양, 염소, 칠면조와소, 돼지, 닭, 오리의 DNA 를혼합한시료에서도위와동일한결과를나타내었다 (Data not shown). 또한, 본연구에서개발된 Multiplex PCR법의검출한계를조사하기위하여축종별로 DNA를 10 ng/µl으로정량한후혼합물을 10배씩단계희석하여반응여부를조사한결과, 소, 돼지, 오리에서 100 fg/ul 까지검출되었고, 닭에서는 1 pg/ul 까지검출됨을확인할수있었다 (Fig. 4). 이러한결과는국내에서 Ko 등 (2011) 16) 이식육감별을위하여미토콘드리아 12S rrna와 16S rrna 유전자종특이적 BSGA multiplex PCR기법의검출한계조사에서돼 Fig. 1. PCR products for animal species identification of four meats (cow, pork, chicken and duck), respectively. M: 100 bp ladder, 1: chicken, 2: duck, 3: negative control, 4: cow, 5: pig, 6 mixed sample (cow, pork, chicken and duck).

32 Eun-Jeong Heo et al. Fig. 2. Specificity test of 4 primer pairs (cow, pig, chicken and duck) for other four animals (goat, sheep, horse and turkey), respectively. Fig. 3.

M: 100 bp ladder, 1: cow, 2: pig; 3: chicken, 4: duck, 5: horse, 6: sheep, 7: goat, 8: turkey, 9: mixed sample (cow, pork, chicken, duck), 10: mixed sample (horse, sheep, goat, turkey), 11 and 12:

5 32 Eun-Jeong Heo et al. Fig. 2. Specificity test of 4 primer pairs (cow, pig, chicken and duck) for other four animals (goat, sheep, horse and turkey), respectively. Fig. 3. PCR products for animal species identification of eight meats and mixed meats of eight types (Cow, Pig, Chicken, Duck, Horse, Sheep, turkey, goat), respectively. M: 100 bp ladder, 1: cow, 2: pig; 3: chicken, 4: duck, 5: horse, 6: sheep, 7: goat, 8: turkey, 9: mixed sample (cow, pork, chicken, duck), 10: mixed sample (horse, sheep, goat, turkey), 11 and 12: negative control. 지, 오리에서의 검출한계(1 pg/ul)및 소와 닭고기에서의 검 출한계 100 fg/ul와 비교해 볼 때 닭을 제외한 나머지 축 종에서 민감성이 더 높은 것으로 나타났다. 또한, Hou 등 (2015)12)이 소, 닭, 오리, 거위에서 multiplex PCR 검사법 의 검출한계 0.05ng과 He 등(2015)10)이 소, 돼지, 양, 오리 고기에서 multiplex PCR 검사법의 검출한계 0.1 ng과 Ali 등(2015)4)이 고양이, 개, 돼지, 원숭이, 쥐의 식육에서의 검 출한계 ng를 보인 성적과 비교할 때 본 연구에 서 개발된 검사법의 검출한계가 우수한 것으로 나타났다. 한편, 본 연구에서 개발된 multiplex PCR법을 적용하여 국내에서 혼합육에 주로 사용되는 소와 돼지, 돼지와 닭, 소와 닭의 혼합 비율을 각각 99.9%, 99%, 90%, 70%, 50%, 30%, 10%, 1%, 0.1%의 비율로 혼합하여 검출한계를 조 사하였다. 그 결과 모든 혼합육에서 마지막 단계의 희석 비율인 0.1% 농도에서도 증폭산물이 검출되었다(Fig. 5A). 또한, 혼합육을 식육가공조건을 고려하여 83oC 20분, 100oC 30분, 121oC 10분 동안 각각 열처리한 다음 축종별 검출 한계를 조사한 결과, 소, 돼지고기에서는 0.1% 농도에서, 닭고기에서는 1% 농도에서도 증폭산물이 검출되었다(Fig. 5B). 이러한 결과는 Ha 등(2006)9)이 12S rrna-trnaval-

The sensitivity of the assay was determined by amplifying 10-fold serial dilutions of DNA from cattle, pig, chicken and duck. Lanes 1 to 8, genomic DNA 7 fold diluted from 10 ng to 10fg.

6 Development of Multiplex PCR Assay for Identification of Eight Species from Meats in Korea 33 Fig. 4. Detection limit of multiplex PCR assay for four species (cow, pig, chicken and duck) with specific primer sets, respectively. The sensitivity of the assay was determined by amplifying 10-fold serial dilutions of DNA from cattle, pig, chicken and duck. Lanes 1 to 8, genomic DNA 7 fold diluted from 10 ng to 10fg. Lanes: (M) l kb (Qiagen); (1) 10 ng; (2) 1 ng; (3) 100 pg; (4) 10 pg; (5) 1 pg; (6) 100 fg. Fig. 5. Comparison of detection limit of mixed raw meats (A) and mixed raw meats were treated at 121 o C for 10min (B) of cow, pig and chicken by multiplex PCR assay, respectively. 16S rrna 부위로소, 산양, 면양그리고사슴을검출하고감별하기위해서동일한 annealing 온도에서 99~108 bp 범위의 PCR 산물이증폭되어가열처리된식육에대해서감별이가능하였고, 혼합된시료에서검출한계가 0.05% 로조사된성적과 Ko 등 (2011) 16) 이돼지및소고기혼합육과가열처리육에서식육감별을위하여미토콘드리아 12S rrna와 16S rrna 유전자종특이적 BSGA multiplex PCR기법으로 0.1% 조사한성적과유사하였다. 또한 Martín 등 (2007a) 17) 이닭, 칠면조, 오리그리고거위를감별하기위해서 64~122 bp안의범위에서각기다른 single PCR 온도조건에서 12S rrna 유전자를증폭하였고, 각각의혼합시료에서의검출한계가 0.1% 를나타내었다. 또한 Hou 등 (2015) 12) 도소, 돼지고기로부터닭, 오리, 거위혼합식육의검출한계가 0.1% 를나타내어본연구결과도이와비슷하게나타났다. Pegels 등 (2012) 26) 이 TaqMan real time PCR 법으로닭, 칠면조, 오리, 거위에서의검출한계가 0.1%-1% 로보고된성적과비교시유사한결과를나타내었다. 위와같이본연구에서개발되어진소, 돼지, 닭, 오리의 4종식육과염소, 양, 말, 칠면조의 4종식육을동시에감별할수있는두종류 set의 multiplex PCR법은분쇄육등혼합식육과열처리혼합식육에있어서국내대표식육 8종을감별하는데있어서유용하며, 특이도및민감도에있어서도우수한것으로평가되었다. 향후다양한축산물가공품을대상으로축종감별에대한종합적인평가가이루어진다면제품의원재료표시제를비롯하여식육감별을위한효과적인방법으로제시될수있을것으로사료된다. Acknowledgment 본연구는 2012 년도농림축산검역본부의연구개발사업

7 34 Eun-Jeong Heo et al. 의연구비지원에의해수행되었으며, 이에감사드립니다. 국문요약 본연구에서는국내대표식육인소, 돼지, 닭, 오리의 4종식육과염소, 양, 말, 칠면조의 4종식육을동시에신속하게감별할수있는 2 set의 multiplex PCR법을개발하고자미토콘드리아 16S RNA에서종특이부위를선발하고각종에대한특이도를높이기위하여인위적인미스매치를주어프라이머를제작한후 8종식육의 274개시료를대상으로특이도와민감도를조사하였다. 그결과소, 돼지, 닭, 오리모든시료에서각각 279, 94, 192, 477 bp 의증폭산물이, 말, 양, 염소, 칠면조의모든시료에서각각 152 bp, 271 bp, 670 bp, 469 bp에서뚜렷한 PCR 유전자산물이확인되어모든축종에서 100% 의특이도를나타내어축종별감별력이우수한것으로나타났다. 8종의축종별로 DNA를 10 ng/µl으로정량한후혼합물을 10배씩단계희석하여반응여부를조사한결과, 소, 돼지, 오리에서는 100 fg까지, 닭에서는 1pg까지검출됨을확인할수있었다. 소, 돼지, 닭, 오리고기를 99.9%, 99%, 90%, 70%, 50%, 30%, 10%, 1%, 0.1% 의비율로혼합한식육과 83 o C 20분, 100 o C 30분, 121 o C 10분에서각각열처리한가열혼합육에대하여검출한계를조사한결과마지막단계의희석비율인모든혼합육의 0.1% 에서검출이가능하였으며, 열처리혼합육에서는닭에서는 1% 농도에서소와돼지의혼합육에서 0.1% 농도에서검출되어민감도가높음을확인할수있었다. 본연구에서개발된 multiplex PCR법은특이도및민감도에있어서국내대표식육을감별하는데있어서유용한것으로평가된다. References 1. Aida, A.A.: Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication. Meat Sci., 69, (2005). 2. Ali, M.E., Hashim, U., Mustafa, S., Man, Y.C., Dhahi, T.S., Kashif, M.K., Uddin, and Hamid, S.A.: Analysis of pork adulteration in commercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by TaqMan probe real-time polymerase chain reaction. Meat Sci., 91, (2012). 3. Ali, M.E., Razzak, M.A., and Hamid, S.B.A.: Multiplex PCR in species authentication: probability and prospects. Food Anal. Methods., 7, (2014). 4. Ali, M.E., Razzak, M.A., Hamid, S.B.A., Rahman, M.M., Al Amin, M., and Rashid, N.R.A.: Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods. Food Chem., 177, (2015). 5. Ballin, N.Z.: Authentication of meat and meat products. Meat Sci., 86, (2010). 6. Bottero, M.T., and Dalmasso, A.: Animal species identification in food products: evolution of biomolecular methods. Vet. J., 190, (2011). 7. Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati, S., and Bottero, M.T.: A multiplex PCR assay for the identification of animal species in feedstuffs. Mol. Cell Probes., 18, (2004). 8. Floren, C., Wiedemann, I., Brenig, B., Schütz, E., and Beck, J.: Species identification and quantification in meat and meat products using droplet digital PCR (ddpcr). Food chemistry., 173, (2015). 9. Ha, J.C., Jung, W.T., Nam, Y.S., and Moon, T.W.: PCR identification of ruminant tissue in raw and heat-treated meat meals. J. Food Prot., 69, (2006). 10. He, H., Hong, X., Feng, Y., Wang, Y., Ying, J., Liu, Q., Qian Y., Zhou X., and Wang, D.: Application of Quadruple Multiplex PCR Detection for Beef, Duck, Mutton and Pork in Mixed Meat. Journal of Food and Nutrition Research, 3, (2015). 11. Heo, E.J., Ko, E.K., Seo, K.H., Kim, Y.J., Park, H.J., Wee, S.H. and Moon, J.S.: Validation of PCR and ELISA test kits for identification of domestic animal pecies in raw meat and meat products in Korea. J. Fd. Hyg. Safety., 29, (2014). 12. Hou, B., Meng, X., Zhang, L., Guo, J., Li, S., and Jin, H.: Development of a sensitive and specific multiplex PCR method for the simultaneous detection of chicken, duck and goose DNA in meat products. Meat Sci., 101, (2015). 13. Kane, D.E., and Hellberg, R.S.: Identification of species in ground meat products sold on the US commercial market using DNA-based methods. Food Control., 59, (2016). 14. Kesmen, Z., Gulluce, A., Sahin, F., and Yetim, H. (2009) Identification of meat species by TaqMan-based real-time PCR assay. Meat Sci., 82, Kim, S.E.: A study on livestock products preference and purchasing behaviors. Korean Journal of Human Ecology, 15, (2006). 16. Ko., B. R. D., Kim, J.Y., Na, H.M., Park, S.D. and Kim., Y.H.: Development of species-specific multiplex PCR assay of mitochondrial 12S rrna and 16S rrna for the identification of animal species. Korean J. Vet. Serve., 34, (2011). 17. Martín, I., García, T., Fajardo, V., López-Calleja, I., Rojas, M., Pavón, M.A., Hernández, P.E., González, I., and Martín, R.: Technical note: detection of chicken, turkey, duck, and goose tissues in feedstuffs using species-specific polymerase chain reaction. J. Anim. Sci., 85, (2007a). 18. Martín, I., García, T., Fajardo, V., Rojas, M., Hernández, P.E., González, I., and Martín, R.: Technical note: Detection of cat, dog, and rat or mouse tissues in food and animal feed using species-specific polymerase chain reaction. J. Anim. Sci., 85, (2007b). 19. Matsunaga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., Yamada, Y., and Shinmura, Y.: A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci., 51, (1999).

8 Development of Multiplex PCR Assay for Identification of Eight Species from Meats in Korea MFDS (Ministry of Food and Drug Safety). Standards for processing and ingredients specifications of Livestock products (MFDS notice ). 21. Montiel-Sosa, J.F., Ruiz-Pesini, E., Montoya, J., Roncalés, P., López-Pérez, M.J., and Pérez-Martos, A.: Direct and highly species-specific detection of pork meat and fat in meat products by PCR amplification of mitochondrial DNA. J. Agric. Food Chem., 48, (2000). 22. Park, J.K., Shim, K.H., Shin, S.C., Chung, K.Y. and Chung, E.R.: Identification of meat species using species-specific PCR-RFLP fingerprint of mitochondrial 12S rrna gene. Korean J. Food Sci. Anim Res., 27, (2007). 23. Park, Y.C., Ahn, C.Y., Jin, S.O., Lim, J.Y., Kim, K.H., Lee, J.H., Cho, T.Y., Lee, H.J., Park, K.S., and Yoon, H.S.: Identification of raw materials in processed meat products by PCR using species-specific primer. J. Fd Hyg. Safety 27, (2012). 24. Patil, M.R., Bannalikar, A.S., and Arora, A.V.: Identification of chicken and dog meat by mitochondrial 12S rrna gene PCR-RFLP. J. Cell. Tissue. Res., 15, (2015). 25. Paul, D.N., Hebert, A.C., Shelley, L.B., and Jeremy, R.D.: Biological identifications through DNA Barcodes. Proc. R. Soc. Lond. B., 270, (2003). 26. Pegels, N., González, I., López-Calleja, I., Fernández, S., García, T., and Martín, R.: Evaluation of a TaqMan real-time PCR assay for detection of chicken, turkey, duck, and goose material in highly processed industrial feed samples. Poult Sci., 91, (2012) 27. Rahman, M.M., Ali, M.E., Hamid, S.B.A., Mustafa, S., Hashim, U., and Hanapi, U.K.: Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. Meat Sci., 97, (2014). 28. Sint, D., Raso, M., and Traugott, M.: Advances in multiplex PCR: Balancing primer efficiencies and improving detection success. Methods Ecol. Evol., 3, (2012). 29. Tanabe, S., Miyauchi, E., Muneshige, A., Mio, K., Sato, C., and Sato, M.: PCR method of detecting pork in foods for verifying allergen labeling and for identifying hidden pork ingredients in processed foods. Biosci. Biotechnol. Biochem., 71, (2007). 30. Tobe, S.S., and Linacre, A.M.: A multiplex assay to identify 18 European mammal species from mixtures using the mitochondrial cytochrome b gene. Electrophoresis., 29, (2008). 31. Weissenberger, M., Reichert, W., and Mattern, R.: A Multiplex PCR assay to differentiate between dog and red fox. Forensic Sci Int Genet., 5, (2011).

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥