Microsoft Word - 3-김민지.doc

Transcription

1 Journal of Bacteriology and Virology Vol. 39, No. 2 p DOI /jbv Molecular Genetic Characterization of Shiga Toxin-producing E. coli Isolated from Diarrhea Patients and Cattle in Gwangju Area, Korea Min Ji Kim 1*, Sun Hee Kim 1, Tae Sun Kim 1, Hye-young Kee 1, Jin-jong Seo 1, Eun-Sun Kim 1, Jong-Tae Park 1, Jae Keun Chung 1, Bok Kwon Lee 2 and Jaeil Lee 3 1 Health & Environment Institute of Gwangju, Gwangju, Korea 2 Center for Infectious Diseases, National Institute of Health, Seoul, Korea 3 Department of Veterinary Medicine, Chonnam National University, Gwangju, Korea Shiga toxin-producing Escherichia coli (STEC) can cause a broad spectrum of human illness ranging from symptomfree to hemolytic uremic syndrom (HUS). Associations between known or putative virulence factors of STEC and diseases in human were investigated. PCR analyses showed that 33 (78.6%) isolates carried an ehxa enterohemolysin gene and 6 (14.3%) isolates possessed an saa autoaggutinating adhesin gene, and 31 (73.8%) isolates carried an eae intimin gene (7 isolates with type β, 16 with type γ, and 3 with type ε). Twenty-nine (69%) isolates from patients carried eae+, ehxa+, saa- (genotype A) and 68 (86%) isolates from asymptomatic outbreaks and 4 (36%) isolates from bovine possessed eae-, ehxa+, saa+ (genotype C). Neither the bundle-forming pilus gene nor the enteropathogenic E. coli adherence factor plasmid was found. In HEp-2 cell adherence assay, isolates carrying eae gene exhibited a localized adherence phenotype, the other isolates carrying saa showed LC (loose clusters of bacteria) and IS (isolated bacteria). In conclusion, most STEC isolated from cattle feces in Gwangju, Korea showed characteristics different from those isolated from patients. But these results may be useful information for pathogenesis judgement of STEC. Key Words: Shiga toxin-producing Escherichia coli, saa, ehxax, eae, HEp-2 cell adherence assay 서론 시가독소생성대장균 (shiga toxin-producing E. coli, STEC) 은무증상에서수양성설사, 혈성설사, 출혈성장염, 용혈성요독증후군 (hemolytic uremic syndrome, HUS) 등에이르기까지다양한임상증상을나타낸다. HUS는급성신부전, 혈소판감소증, 미세혈관병성용혈성빈혈이특징인증후군으로써혈성설사를시작한지 1주일후특징 Received: March 25, 2009/ Revised: April 7, 2009 Accepted: April 20, 2009 * Corresponding author: Min Ji Kim. Health & Environment Institute of Gwangju, 898 Hwajung-dong, Seo-gu, Gwangju , Korea. Phone: , Fax: vetmj@korea.kr ** This research was performed as a part of the laboratory surveillance of acute diarrhea, managed by the National Institute of Health, Republic of Korea. 적인증상이나타나고소아급성신부전등의원인으로사망률이매우높다. 또한출혈성장염은복통과물설사후에하부위장관출혈과유사한혈변이발생하는질환으로발열이있지만혈액내백혈구수의증가가없는것이다른염증성장염과차이가있다. 이러한임상증상은 O157:H7에서전형적으로나타나며, non-o157:h7과는정도의차이가있을뿐이지임상적으로특별하게구별되지는않는다 (1). 병원성이높은 STEC 균주는 enterohemorrhagic E. coli (EHEC) 로명명되고있으며 (2), O157 이외에도여러가지혈청형이알려져있지만, 시가독소유전자를가진 STEC 균주가모두시가독소를생산하는것은아니기때문에독소생산여부를반드시검사해야한다. 또한시가독소를생산하는대장균에서도 Stx1만을생산하는것과 Stx2만을생산하는것그리고모두를동시에생산하는것으로분류하고있는데, 실제로어느시가독소를 79

2 80 MJ Kim, et al. 생산하느냐에따라서병원성의정도에차이가있다 (3). STEC는시가독소외에장관상피세포의세포질막에부착하여장관의미세융모를소멸시키고, actin을축적시켜세포골격을변화시키는특징적인장관병변즉 "attaching and effacing lesion" (A/E lesion) 또한 STEC의중요한병소이다 (4). 이와같은 A/E 병변에필수적인 eae 유전자는 LEE (locus of enteocyte effacement) 로알려져있는 35.5 kb 크기의염색체상의병원성섬 (pathogenicity island, PAI) 에위치하고있으며, 94~97 kda 크기의외막단백질인 intimin을지령한다 (5). LEE는 intimin 이외에도제3형분비계 (type III secretion system, TTSS) 와그것에의해분비되는 Tir (translocated intimin receptor), Esp (EPEC-secreted protein) 등병원성에관련된여러종류의단백질을지령하고있다. Intimin을가진 STEC와임상증상과의연관관계는이미밝혀졌지만, 이것이반드시필수적인병원성인자는아니다. Adhesin과 pili와같은부착인자들이 eae 음성인균주에서도확인되었고 (6, 7), 이들균주와특정혈청형을가진 STEC가혈변및 HUS와관계가있다고보고되었다 (8). 하지만이러한 intimin이결여된 STEC들의병원성기작에대한연구는아직미비하다. 이외에도 enterohemolysin 유전자인 ehxa, catalase peroxidase katp, 제2형분비계와관련있는 etp 유전자그리고 secreted serine protease (EspP) 등이 EHEC의병원성과연관이있다고보고되었다 (9~12). STEC는미국, 영국, 캐나다뿐만아니라일본, 인도, 중국등아시아지역에서도보고되고있지만, 일본이외의아시아지역에서분리된균주들에대한특성은잘밝혀져있지않으며 (13). 이들에대한연구가대부분 HUS 와같은심각한임상증상이나타난환자에서분리된균주를대상으로한결과로, 실제무증상이나경미한설사만을일으키는균주를대상으로한병원성기작에대한연구는미흡한실정이다. 또한국내에서소분리주 STEC 특성에대한연구도전무한상태이다. 따라서본연구에서는설사환자분리주와무증상집단감염주, 소분변으로부터분리된 STEC를대상으로병원성유전자의특징을비교검토하였다. 그리고지역내유행하는시가독소생성대장균의유형파악및병인기작을밝혀이를바탕으로장출혈성대장균감염증제어를위한대책을수립하는데기초자료를마련하고자하였다. 재료및방법시가독소생성대장균병원성관련유전자검출설사환자분리주와무증상집단감염분리주및소분변유래분리주간의상관관계를살펴보기위해 PCR을이용하여병원성유전자를검출하였다. saa, ehxa, eae 유전자 multiplex PCR 실험균주설사환자및접촉자그리고식중독으로의뢰된검체에서분리된 STEC 42주와 2004년 J 초등학교무증상집단감염으로부터분리된 STEC 79주및소분변유래 STEC 11주를실험에사용하였다. 양성대조균주로는 ATCC (EDL 933) 를사용하였다. STEC 분리주는 TSA (Tryptic soy agar, Oxoid, Hampshire, UK) 에계대배양한다음, 미량의균체를멸균증류수 500 μl에현탁시켜 10분간끓는물에서중탕하고 14,000 rpm 에서 10분간원심분리한후상층액을 DNA template로이용하였다. Premix 제조및 PCR 조건 saa, ehxa, eae 유전자검출에사용된 primer는 Paton (14) 등에의한것으로 Table 1과같다. PCR 반응액조성은 200 mm dntp, 각각의 primer 250 nm, 5 mm MgCl 2 가포함된 10 buffer, 1 U의 Taq DNA polymerase (Bioneer, Daejeon, Korea) 그리고멸균증류수로 50 μl의반응혼합액을제조하였다. PCR 조건은 1차반응에서 95 /5분간 denaturation 후, 95 /1분, 65 /2분, 72 /1분 30초의 cycle을 10회실시하였고, 2차반응에서 95 /1분, 60 /2분, 72 /1분 30초의 cycle을 15회실시한후, 95 /1분, 60 /2분, 72 /2분 30 초의 cycle을 10회로 3차반응을실시하였다. 마지막으로 72 에서 2분 30초간반응시켰다. PCR을수행한후 5 μl 의 PCR 산물을 2% agarose gel에전기영동한후 EtBr에염색하여 UV하에서확인하였다. LEE 관련유전자검출실험균주설사환자및접촉자그리고식중독으로의뢰된검체에서분리된 STEC 42주와 2004년 J 초등학교무증상집단발병으로부터분리된 STEC 중위의 saa, ehxa, eae 유형별로분리한 14주 ( 식품유래분리주 2주포함 ) 및소분변유래 STEC 11주를대상으로 PCR을실시하였고양성

3 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 81 대조군으로 ATCC (EDL 933) 를사용하였다. STEC 분리주각각을 TSA에계대배양한다음, 미량의균체를멸균증류수 500 μl에현탁시켜 10분간끓는 물에서중탕하고 14,000 rpm에서 10분간원심분리한후상층액을 DNA template로이용하였다. 각각의유형분석에사용된 primer에대한목록은 Table 1과같다. Table 1. PCR primers to amplify specific fragments from the various pathogenic genes in STEC PCR primer Target gene (s) Sequence (5'-3') Size of product (bp) Reference SAADF saa CGTGATGAACAGGCTATTGC SAADR ATGGACATGCCTGTGGCAAC eaeaf eae GACCCGGCACAAGCATAAGC eaear CCACCTGCAGCAACAAGAGG hlyaf ehxa GCATCATCAAGCGTACGTTCC hlyar AATGAGCCAAGCTGGTTAAGCT B73 eae α TACTGAGATTAAGGCTGATAA B138 GACCAGAAGAAGATCCA B73 eae β TACTGAGATTAAGGCTGATAA B137 TGTATGTCGCACTCTGATT B73 eae γ TACTGAGATTAAGGCTGATAA B74 AGGAAGAGGGTTTTGTGTT Intδ eae δ TACGGATTTTGGGGCAT Int-Ru TTTATTTGCAGCCCCCCAT SK1 eae ε CCCGAATTCGGCACAAGCATAAGC 2,069 9 LP5 AGCTCACTCGTAGATGACGGCAAGCG Tir-F tir CATTACCTTCACAAACCGAC 1, Tir-R CCCCGTTAATCCTCCCAT ESPAa espa CACGTCTTGAGGAAGTTTGG ESPAb CCGTTGTTAATGTGAGTGCG ESPB-F espb GCCGTTTTTGAGAGCCAGAAT ESPB-R ATCATCCTGCGCTCTGCGAAC ESPD-F espd CGCTGGATTTACAACTGGTTA ESPD-R CCAGCTCAACCTTCGCACTCT ESPPa espp AAACAGCAGGCACTTGAACG ESPPb AGACAGTTCCAGCGACAACC K260 Disrupted selc GAGCGAATATTCCGATATACTGGTT K255 GGTTGAGTCGATTGATCTCTGG K260 Intact selc GAGCGAATATTCCGATATACTGGTT K261 CCTGCAAATAAACACGGCGCAT BFP1 bfp GATTGAATCTGCAATGGTGC BFP2 GGATTACTGTCCTCACATAT EAF1 EAF plasmid CAGGGTAAAAGAAAGATGATAA EAF25 TATGGGGACCATGTATTATCA

4 82 MJ Kim, et al. eae 유전자의유형분석을위한 multiplex PCR eae 유전자에대하여 α, γ 그리고 β 유형결정을위한 multiplex PCR을실시하였다 (15, 16). PCR 반응액조성은 template DNA 5 μl, 2.5 mm dntp 5 μl, 5 mm MgCl 2 가포함된 10 buffer 5 μl와각각의 primer 0.5 μl씩, 1 U의 Taq DNA polymerase와멸균된증류수로최종 50 μl로맞추었다. α, γ 그리고 β 유형을결정하기위한 primer는 B73을 forward primer로, 각각의유형에따라 B138, B74그리고 B137을 reverse primer로사용하였다 (Table 1). PCR 조건은 94 에서 5분간의 cycle을 1회, 94 /30초, 50 /30초, 72 /30초의 cycle을 30회실시하고 72 /5분간반응시켰다. δ와 ε 유형을결정하기위한 PCR 방법은 Pradel 등 (9) 에의한방법으로 δ의 PCR 조건은 94 /2분간의 cycle 을 1회, 94 /1분, 45 /1분, 72 /1분의 cycle을 30회실시하고 72 /5분간반응시켰다. ε는 94 /2분간의 cycle을 1 회, 94 /1분, 55 /1분, 72 /2분의 cycle을 30회실시하고 72 에서 5분간반응시켰다. PCR을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr에염색하여 UV하에서확인하였다. tir, espa, espb, espd 유전자분석을위한 PCR PCR 반응액조성은 template DNA 5 μl, 2.5 mm dntp 5 μl, 5 mm MgCl 2 가포함된 10 buffer 5 μl와각각의 primer 0.5 μl씩, 1 U의 Taq DNA polymerase와멸균된증류수로최종용량을 50 μl로맞추었다. 각각의유전자증폭을위한 Primer는 Table 1과같다. tir 유전자증폭을위한 PCR 조건은 94 /5분간의 cycle을 1회, 94 /40초, 57 /60초, 72 /75초의 cycle을 30회실시하고마지막 cycle 후 72 에서 5분간반응시켰다. espa 유전자증폭을위한 PCR 조건은 94 /5분간의 cycle을 1회, 94 /45초, 57 /45초, 72 /90초의 cycle을 30회실시하고마지막 cycle 후 72 /5분간반응시켰다. espb와 espd 유전자의 PCR 조건은 annealing 온도가각각 63 /45초, 60 /45초이며나머지조건은 espa 유전자 PCR 조건과동일하다. PCR을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr에염색하여 UV하에서확인하였다. espp 유전자검출을위한 PCR PCR 반응액조성은 template DNA 5 μl, 2.5 mm dntp 5 μl, 5 mm MgCl 2 가포함된 10 buffer 5 μl와각각의 primer 1 μl씩, 1 U의 Taq DNA polymerase와멸균된증류수로최종 50 μl를맞추었다. PCR 조건은 94 /5분간의 cycle을 1회, 94 /45초, 59 /45초, 72 /90초의 cycle을 30회실시하고마지막 cycle 후 72 /10분간반응시켰다 (17). PCR을수행한후 5 μl 의 PCR 산물을 2% agarose gel에전기영동한후 EtBr에염색하여 UV하에서확인하였다. LEE 삽입여부확인 PCR STEC의 selc 유전자상에 LEE 삽입여부를확인하기위하여 McDaniel 등 (18) 의방법에따라 multiplex PCR을실시하였다. PCR 반응액조성은 template DNA 5 μl, 2.5 mm dntp 5 μl, 5 mm MgCl 2 가포함된 10 buffer 5 μl와각각의 primer 0.5 μl, 1 U의 Taq DNA polymerase와멸균된증류수로최종 50 μl 맞추었다. Primer는 K260을 forward로그리고, 각각의유형에따라 K255과 K261을 reverse primer로사용하였다 (Table 1). PCR 조건은 94 /5분간의 cycle을 1회, 92 /2분, 50 /2분, 72 /3분의 cycle을 30회실시하고마지막 cycle 후 72 /5분간반응시켰다. PCR을수행한후 5 μl PCR 산물을 2% agarose gel에전기영동한후 EtBr에염색하여 UV 하에서확인하였다. 이때 LEE 말단에위치한 K255와 selc의 downstream primer인 K260을사용하여 418 bp에서증폭되는경우는 LEE가 selc의 ORF 394 region에삽입된것을나타내며, E. coli K-12의 selc 부위의 upstream 과 downstream primer인 K261과 K260 primer에의하여 529 bp에서증폭되는경우는 LEE가삽입되지않은온전한 selc 유전자를가지는것으로분석하였다. HEp-2 세포부착능시험 Cravioto 등 (23) 의방법에따라, STEC 분리주에대한 HEp-2 (Human epithelioma type 2 cell-line) 세포부착형태를조사하였다 (Fig. 1). HEp-2 세포의배양및처리 HEp-2 세포는 penicillin과 streptomycin, 그리고 10% fetal bovine serum (FBS) 이포함된 DMEM (Dulbecco's modified Eagle medium, Gibco, Gaithersberg, MD, USA) 으로 37 5% CO 2 배양기 (Forma, Marietta, OH, USA) 에서배양하였다. 24 well tissue culture plate (Nalge Nunc, Rochester, NY, USA) 에직경 13 mm Thermanox TM Coverslip (Nalge Nunc) 을깔고, HEp-2 세포를 cell/ml이되도록희

5 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 83 HEp-2 cell seeding on 24 well plate DMEM with penicillin/streptomycin and 10% FBS Media change with DMEM 37, 5% Co 2 / 24 hr DMEM without penicillin/streptomycin and FBS Inoculation of bacteria suspension Washing with PBS, 5 times Washing with PBS, 3 times 37, 5% Co 2 / 1.5 hr 37, 5% Co 2 / 2.5 hr Table 2. Distribution of the virulence factor-encoding genes according to symptoms of the STEC isolates a No. (%) of isolates Gene b Asymptomatic Diarrhea patients P value c saa 70 (88.6) 6 (14.3) < eae 4 ( 5.1) 31 (73.8) < ehxa 74 (93.7) 33 (78.6) NS (0.7803) espp 6 (50) 26 (62) NS (0.5173) a The bfp gene and EAF plasmid were absent from all strains tested. b The presence of the genes was determined by PCR. c A p value of <0.05 was considered statistically significant. p values for the genes were determined by the Fisher exact test. NS, not significant. Fixing with 100% cold methanol, 6 min Staining with 10% Giemsa, 10 min Light microscopy (1,000X) Figure 1. The procedure of HEp-2 cell adherence assay. 석하여 1 ml 접종하였다. 접종된 plate는 37, 5% CO 2 배양기에서 24시간배양하여단층을형성하도록하였다. 70% 정도의단층이이루어지면, FBS가첨가되지않은 DMEM으로배지를교환하였다. HEp-2 세포부착능시험분리동정된 STEC는 1% D-mannose가포함된 Luria broth (Difco, Detroit, MI, USA) 5 ml 접종하여 37, 16시간동안배양한후, 각각의배양액 150 μl FBS가첨가되지않은 DMEM 3 ml 넣은후 37, 2시간동안배양하였다. 배양액각각의균액 100 μl HEp-2 세포단층이형성된 plate의 2~3개 well씩접종하여 37, 5% CO 2 배양기에서 1시간 30분배양한다음, PBS로 5회세척한후 37, 5% CO 2 배양기에서 2시간 30분동안배양하였다. 그후 PBS로 3회세척하고 100% cold methanol을각 well에 1 ml 넣고 6분간고정한후, 10% Giemsa 염색액으로 20분간염색을시행하였다. 멸균증류수로한번세척하여건조시킨후, coverslip을 well로부터분리하여 slide glass 위에고정시키고광학현미경 (Carl Zeiss, Oberkochen, Germany) 으로관찰하였다. bfpa 및 EAF 유전자에대한 PCR 시험 bfpa 및 EAF 유전자검출에사용된 primer는각각 Wieler 등 (21) 과 Franke 등 (22) 에의한것으로 Table 1과같다. PCR 반응조성은 template DNA 5 μl, 2.5 mm dntp 5 μl 5 mm MgCl 2 가포함된 10 X buffer 5 μl 각각의 primer 0.5 μl씩, 1 U의 Taq DNA polymerase와멸균된증류수로최종용량을 50 μl로맞추었다. bfpa 유전자확인을위한 PCR 조건은 94 /5분간의 cycle을 1회, 94 /1분, 57 /45초, 72 /1분의 cycle을 30회실시하고마지막 cycle 후 72 /5분간반응시켰다. EAF 유전자검출을위한조건은 annealing 단계에서 60 /2분이며나머지는 bfpa 유전자증폭조건과같았다. PCR을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr에염색하여 UV하에서확인하였다. 통계분석 PCR 결과에따라 GraphPad InStatversion 3.0 (GraphPad Software, Inc., La Jolla, CA, USA) 을이용하여 Fisher exact test로유전자보유여부에따른통계학적유의성을검정하였으며 p 값이 0.05 미만인경우통계적유의성이있다고판정하였다. 결과 saa, ehxa, eae 유전자 multiplex PCR 결과설사환자분리주와무증상집단감염분리주및소분

6 84 MJ Kim, et al. Figure 2. Distribution of the STEC genotype by multiplex PCR. A: eaea+, ehxa+, saa-, B: eaea+, ehxa-, saa-, C: eaea-, ehxa+, saa+, D: eaea-, ehxa+, saa-, E: eaea-, ehxa-, saa+, F: eaea-, ehxa-, saa- (+: gene present; -: gene absent). Figure 3. Multiplex PCR analysis of the saa (119 bp), eae (384 bp), the ehxa (534 bp) genes. M: 100 bp ladder, lane 1: genotype A (isolate GJ ), lane 2: genotype C (isolate Jinwol-SBM), lane 3: genotype D (isolate bovine 20), lane 4: genotype A (isolate GJ ), lane 5: genotyep F (isolate bovine 31), lane 6: negative control, lane 7: positive control (EDL 933). 변유래분리주간의상관관계를살펴보기위해 PCR을실시한결과, eae 유전자는설사및식중독환자유래 STEC에서 31주 (73.8%), 무증상집단감염 STEC에서 4주 (5.1%) (p < ), 소분변유래 STEC에서 1주 (9.1%) 가확인되었고, saa 유전자는설사및식중독환자유래 STEC에서 6주 (14.3%), 무증상집단감염 STEC에서 70주 (88.6%) (p < ), 소분변유래 STEC에서 4주 (36.4%) 가확인되었다. ehxa 유전자는설사및식중독환자유래 STEC에서 33주 (78.6%), 무증상집단감염 STEC에서 74 주 (93.7%) (p = NS), 소분변유래 STEC에서 6주 (54.5%) 에서관찰되었다 (Table 2). 이들세유전자의조합으로살펴보면설사환자분리주에서는 eae+, ehxa+, saa- (genotype A) 인 group이 29명 (69%), 무증상집단발병분리주에서는 eae-, ehxa+, saa+ (genotype C) 인 group이 68명 (86%) 으로가장많은비중을차지하였다. 또한소분변유래분리주에서도 eae-, ehxa+, saa+ (genotype C) 인 group이 4주 (36%) 로가장우세하였다 (Fig. 2, 3). STEC 분리주의 "attaching and effacing" 병변에관여하는유전자의특성 eae 유전자의유형을결정하기위하여 eae 유전자를가진소분변유래 STEC 분리주 1주, 설사및식중독환자유래 STEC 분리주 31주, 무증상집단감염 STEC 분리주 1주및양성대조군으로 ATCC (ELD 933) 을사용하였다. Figure 4. PCR result for the detection of eae β (520 bp), eae γ (778 bp) and eae ε (2,069 bp) genes. M: 100 bp ladder, lane 1: eae β + (isolate GJ ), lane 2: eae γ + (isolate GJ ), lane 3: eae ε + (isolate GJ ), lane 4: positive control (EDL 933), lane 5: negative control. eae 유전자의 α, β, γ, δ 그리고 ε 유형에대한 PCR 결과, 설사및식중독환자유래 STEC 에서 7주 (22.6%) 는 eae β 유전자형, 16주 (51.6%) 는 eae γ 유전자형, 그리고 3 주 (9.7%) 는 eae ε 유전자형으로나타났다. 그러나설사및식중독환자유래 STEC 5주, 소분변유래 STEC 1주, 그리고무증상집단감염 STEC 1주에서는밴드를확인할수없었다 (Fig. 4). 혈청형별로살펴보면 eae β 유전자형은 O26 4주, O157, O168, NT (non-typeable) 가각각 1주씩확인되었고, eae γ 유전자형은 O157과 O111 이각각 7주, O145, O166이 1주, eae ε 유전자형은 O103이 2주, O145가 1주확인되었다.

7 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 85 Strain Origin Age Sex Disease Association a Table 3. Virulence factors of the 67 STEC strains tested Sero Group b Sorbitol stx1 stx2 RPLA saa ehxa Eaec tir espa espb espd espp bfpa EAF SelC d Adherence pattern 27-1 Bovine NT I AA 128 Bovine NT ND IS 153 Bovine O I LC 126 Bovine O ND IS 20 Bovine O I NA 27 Bovine O D DA 174 Bovine O D IS 31 Bovine O D NA 171 Bovine O I IS 180 Bovine O (UT) D IS 189 Bovine O D NA GJ Human 1 M D NT (β) ND LA GJ Human 7 M D O (UT) D LA GJ Human 2 M D O (UT) ND LA GJ Human 2 F D O (UT) I LA GJ Human 9 F D O (γ) I LC GJ Human 1 M D O (γ) I LA GJ Human 0 M D O (γ) I LA GJ Human 1 M D O (γ) I NA GJ Human 5 M D O (γ) I IS GJ Human 1 M D O (γ) I LA GJ Human 1 M D O (γ) I LC GJ Human 0 F D O112ac ND IS Molecular Genetic Characterization of Shiga Toxin-producing E. coli 85

8 86 MJ Kim, et al. Strain Origin Age Sex Disease Association a Table 3. Continued Sero Group b Sorbitol stx1 stx2 RPLA saa ehxa Eaec tir espa espb espd espp bfpa EAF SelC d Adherence pattern GJ Human 1 F D O (UT) I LA GJ Human 8 M D O I IS GJ Human 2 M D O (β) ND AA GJ Human 5 M D O I NA GJ Human 2 F D O (γ) I LA GJ Human 1 F D O (ε) I IS GJ Human 1 F D O (γ) ND IS GJ Human 1 M D O (γ) D IS GJ Human 2 M D O (γ) ND IS GJ Human 1 F D O (γ) I LA GJ Human 1 F D O (γ) ND NA GJ Human 67 M D O (γ) D IS GJ Human 2 M D O (γ) ND IS GJ Human 8 M D O (β) D IS GJ Human 1 F D O (β) I LA GJ Human 2 M D O (β) ND LC GJ Human 4 F D O (UT) I LA GJ Human 3 F D O (β) ND LA GJ Human 44 F D O (β) ND LA GJ Human 6 M D O I IS GJ Human 11 M D O ND LC Gwangsan 3 Human - F SF NT ND LC Jinwol 1071 Human - - SF NT ND IS 86 MJ Kim, et al.

9 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 87 Strain Origin Age Sex Disease Association a Table 3. Continued Sero Group b Sorbitol stx1 stx2 RPLA saa ehxa Eaec tir espa espb espd espp bfpa EAF SelC d Adherence pattern Yongdoo 29 Human - - SF O (ε) I LA KBM Human - M SF O (ε) I LC Jinwol 1682 Human - - SF O I LC Yongdoo 26 Human - - SF O ND NA Jinwol 457 Human - - SF O I IS Jinwol 1692 Human - - SF O D NA KIW Human - F SF O (γ) D IS Jinwol 242 Human - - SF O ND NA DG3 Human - F SF O I NA Gwangsan5 Human - F SF O I IS Jinwol 41 Human - - SF O (UT) ND LA Yongdoo 30 Human - - SF O ND NA Gwangsan3-2 Human - F SF O D LC Jinwol-SBM Human - F SF O D IS Jinwol 9 Human - - SF O D IS Jinwol 13 Human - - SF O D LC Jinwol 1222 Human - - SF O D IS Jinwol 1269 Human - - SF O D IS Jinwol 1672 Human - - SF O ND AA pork food NT I IS beef food O ND IS a D; Diarrhea, SF; symptom free, b NT; nontypeable, c UT; untypeable, d ND; not detected Molecular Genetic Characterization of Shiga Toxin-producing E. coli 87

10 88 MJ Kim, et al. Figure 5. PCR result for the detection of espa (299 bp), espb (633 bp), espd (939 bp) and tir (1,550 bp) genes. M: 100 bp ladder, lane 1~4: espa +, espb +, espd +, tir + (isolate GJ ), lane 5: negative control, lane 6~9: positive control (EDL 933). Figure 7. Multiplex PCR to distinguish an intact selc locus from one disrupted by LEE. M: 100 bp ladder, lane 1: disrupted selc (418 bp, isolate GJ ), lane 2: Intact selc (527 bp, isolate GJ ), lane 3: ND (not detected). espp 유전자 PCR 결과설사및식중독환자유래 STEC에서 26주 (62%), 무증상집단감염 STEC에서 6주 (50.1%) (p = 0.339), 소분변유래 STEC에서 3주 (18%) 가확인되었고, 식품분리주중 1건 (50%) 에서확인되었다 (Fig. 6). Figure 6. PCR analysis of the espp (301 bp)genes. M: 100 bp ladder, lane 1: espp + (isolate GJ ), lane 2: negative control, lane 3: positive control (EDL 933). tir 유전자는소분변유래 STEC에서는확인되지않았으나, 설사및식중독환자유래 STEC 분리주에서는 17 주 (54.8%), 무증상집단감염 STEC 분리주 1주 (100%) 에서확인되었다. tir 유전자를가진분리주는모두 eae 유전자를보유하고있었으며유형별로는 eae β 가 5주 (27.8%), eae γ 가 7주 (38.9%), eae ε 3주 (16.7%), UT (untypeable) 이 3주 (16.7%) 였다. espa, espb, espd 유전자를모두가지고있는균주는 9주 (29%) 로모두설사및식중독환자유래분리주였다. espb 유전자는설사및식중독환자유래 STEC 24주 (77.4%) 와무증상집단감염 STEC 1주 (100%) 에서확인되었고, espd는 espb 유전자를가진설사및식중독환자유래 STEC 1주를제외하고동일하게관찰되었다 (Fig. 5 와 Table 3). LEE의염색체상의삽입여부 PCR 결과 Chromosome 내의 LEE 삽입위치를결정하기위해 PCR 을실시한결과설사및식중독환자유래 STEC 31주중 5주 (16%) 만이 selc 염색체에삽입되어있었고, 16주 (52%) 는 selc 이외의염색체에삽입되어있었으며, 10주 (32%) 는밴드를확인할수없었다. 또한 selc에삽입되어있는 STEC 중 O111이 7주로가장많이차지하고있었다 (Fig. 7). HEp-2 세포부착능시험결과각분리주들의부착에관련된유전자와조직세포에서의실제부착유형과의상관관계를살펴보기위하여 HEp- 2 세포에대한부착능시험을실시하였다. 표기방법은세포에세균이매우밀집되어부착되어있는형태를 LA (localized adherence) 로표기하였고, LA 에서보여지는밀집된형태와는달리보다느슨하게형성된군집과산발적으로흩어져부착된형태를 LC (loose clusters of bacteria) 로표기하였다. 또한세균끼리의군집을형성하지않고독립적으로세포에부착하는양상을

11 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 89 A B C D E F Figure 8. Adherence patterns of STEC in HEp-2 cell culture. A: LA pattern, isolate GJ , B: LC pattern, isolate Jinwol 9, C: IS pattern: isolate Jinwol SBM, D: DA pattern, isolate bovine 27, E: AA pattern, isolate GJ , F: Negative control. IS (isolated bacteria), LA처럼세포한쪽에밀집된형태로부착되는것이아니고세포표면전체에부착되어있는모양을 DA (diffuse adherence), 세포가아닌곳에서도세균끼리뭉쳐서막대모양을형성하고세포표면에도동일한모양을형성하는것을 AA (aggregative adherence) 로표현하였다. 마지막으로세균의부착이관찰되지않은것을 NA (not adherent) 로표기하였다 (Fig. 8). 소분변유래 STEC 분리주중 4주 (36.4%) 에서 IS (isolated bacteria), AA, DA, LC가각각 1주씩관찰되었다. 설사및식중독환자유래 STEC에서는 16주 (38.1%) 에서 LA 표현형을, 13주 (31%) 에서 IS 표현형, 7주 (16.7%) 에서 LC 표현형그리고 1주 (2.4%) 에서는 AA 표현형을확인하였다. 무증상집단감염 STEC에서는 6주 (50%) 에서 IS 표현형을, 2주 (16.7%) 에서 LC 표현형, 각각 1주 (8.3%) 에서 LA와 AA 표현형을확인하였다. 고찰본연구에서는 STEC의병인기작및임상증상과관련된병원성인자를밝히고자광주지역에서분리된설사환자, 무증상감염그리고소분변으로부터분리된 STEC 를대상으로병원성과관련된유전자발현의차이를관찰하였다. eae, ehxa, saa 유전자에대한 multiplex PCR을실시한결과, 설사환자및식중독환자유래 STEC 40주중에서 31주 (73.8%) 가 eae 유전자를, 6주 (14.3%) 가 saa 유전자를보유하였으며, 무증상집단감염 STEC는 saa 유전자를 4주 (5.1%) 가 eae 유전자를, 70주 (88.6%) 가 saa 유전자를보유하고있었다. 소분변유래분리주에서도 eae 는 1주 (9.1%) 에서만확인되었으며, saa는 4주 (36.4%) 에서확인되어무증상집단감염분리주와비슷한유전자패턴을나타내었다. 따라서 STEC의임상증상과 eae 유전자및 saa 유전자 (p < ) 의통계학적유의성을확인할수있었다. 또한 eae 유전자를가진균주는모두 saa 유전자를보유하고있지않아 Paton 등 (14) 의결과와일치함을알수있었다. Schmidt 등 (11) 이 ehxa 유전자가 STEC의병원성인자로서의중요성을언급하였지만, 그이후스위스 (8) 와프랑스 (9) 의연구결과에서는병원성균주와의연관관계를찾을수없었다. 본연구에서도 hemolysin 유전자인 ehxa는증상유무나집단간에유전자보유여부가통계적으로유의성이없었으며, saa나 eae 유전자보유유무와상관없이 50% 이상의 STEC에서확인되었다. 또한 genotype A (eaea+, ehxa+, saa-), genotype B (eaea+, ehxa-, saa-), genotype C (eaea-, ehxa+, saa+), genotype D (eaea-, ehxa+, saa-), genotype E (eaea-, ehxa-, saa+),

12 90 MJ Kim, et al. genotype F (eaea-, ehxa-, saa-) 로유전형을구분하였을때, 설사및식중독환자유래 STEC는 genotype A group이 29명 (69%), 무증상집단발병분리주에서는 genotype C인 group이 68명 (86%), 소분변유래분리주에서도 genotype C인 group이 4주 (36%) 로가장우세하였다. 또한주요혈청형인 O157 (7주), O26 (6주), O111 (7주) 이모두 genotype A에포함되어있었다. 이로써환자분리주와무증상집단감염분리주와의유전형의차이를확인하였고, 무증상집단감염주와소분리주와의유전자형분포는비슷함을알수있었다. eae 유전자와 saa 유전자모두병원성 STEC에서서로다른기전으로부착에관여하는중요한유전인자로알려져있지만 (8), 본연구에서는 saa 유전자와병원성과의상관관계는규명하기어려웠다. LEE가결여된 STEC의 plasmid에존재하는 saa 유전자는 (24) 세포의외막에위치한자가응집부착단백질이다. E. coli K-12에 saa 유전자를형질변환한결과반국소적부착형태를보였으며, 1998년남호주아델레이드지역의 HUS 집단발병환자로부터분리된 O113:H21 STEC (98NK2) 균주에서최초로분리되었다 (25). 그리고최근 ToxB, Sfp (sorbitol fermentating enterohemorrhagic E. coli fimbriae) 및 Iha (adherence-conferring protein similar to Vibrio cholerae IrgA) 등과같은 STEC 부착인자와함께중요성이부각되고있다 (26). 그러나각나라나지역에따라분리주들간의유전자보유여부가상이하므로, 이러한병원성유전자에의한단백질발현유무나발현정도의차이를통해, 실제세포수준에서의상호작용에대한추가연구가필요할것으로생각된다. STEC는 eae 유전자에의해장점막에특징적인 A/E lesion을형성하는데이는숙주세포의미세융모제거와세균과상피세포막사이의긴밀한부착으로특징지어지며, 부착된세균의바로밑에는세포내골격의현저한변화를보이고때때로 pedestal-like 구조를형성한다. 이러한조직병리학적부위를 "attaching and effacing" (A/E) lesion이라명명하였다 (27). 최초로 EPEC의감염에서관찰되어졌으며 EHEC와일부 Hafnia alvei에대해실시된동물및배양세포에서도이모양이관찰되어졌다. 그이후 Adu-Bobie 등 (28) 에의해분류된 intimin α, β, γ, δ 중 intimin δ가 intimin β의아형임이밝혀졌다 (29). iintimin의 N 말단부위는잘보존된반면, Tir과결합하는 C 말단부위는매우다양하며숙주조직세포의친화성과연관이깊다 (30). 주요유전자형은 α, β, ε, γ이며 (29), Iintimin α 는 EPEC에서주로확인되는반면, γ, ε은 EHEC, intimin β 는 EPEC와 EHEC 모두에서관찰된다 (31). 따라서 STEC 병원성인자에대한규명을할때 intimin 존재여부나그들의유전자형에대한분석은이루어지고있지만, STEC 가 HUS나 HC와같은임상증상을일으키는데있어서 intimin의역할에대한의견은매우다양하다 (31). 본연구에서는 China 등 (15) 과 Pradel 등 (9) 의방법에따라, 광주지역설사환자에서분리된 STEC에서 eae 유전자형을분석한결과, eae γ 형이 16주 (51.6%) 로가장우세하였으며, O157, O111, O26 혈청형이모두이유전자형에속하였다. 또한 3주에서 eae ε 형이확인이되었으며, 혈청형은 O103 2주, O145 1주였다. 이와같은결과는프랑스에서 HUS 환자로부터분리된 STEC의 eae 유전자형이 eae γ, eae β, eae ε 순으로검출되었으며 (29), 설사환자에서분리된 STEC 균주에대해 DNA hybridization과 PCR 방법을이용하여 intimin 유전자의유형을분류한결과에서는 eae β1, eae ε, eae γ 순으로검출됨이보고되어나라마다차이가있음을확인하였다 (32). 숙주및특정혈청형과 intimin type의연관성에대하여, intimin α는 classical serotypes (O55:H6, O125:H6, O127:H6 그리고 O142:H34) 에속하는 STEC 균주에서특이적으로발현되는반면에, intimin ε는사람에게서드물게분리되는 STEC O103과 O121 혈청형에서만확인되었다. Intimin γ 역시 O157, O111, O145, O157:H40 그리고 I128:H8과같은 nonclassical EPEC serotype과연관이있고 intimin β는가장흔한유형으로서, 사람뿐만아니라가축과야생동물등에서분리된 EPEC와 EHEC 모두에서확인된다 (29). 본연구결과에서도 γ형에 O157, O111, O26, ε형에 O103, O145가확인되어 intimin의유형에따라혈청형과의상관관계가매우높음을알수있었지만, 소분변분리주에서는 intimin 유형이결정되지않아분리숙주에따른차이점은확인할수없었다. 또한 A/E 병변의기둥다리구조 (pedestal like structure) 형성을유도하여세포막 actin 구조의붕괴를일으키는데, 이때 Tir, EspB 그리고 EspD는 TTSS와 EspA에의해구조적변형을일으켜숙주세포안으로이동한다. 숙주세포안으로이동한 EspB와 EspD 단백질은숙주세포의세포질막안으로삽입되어세균과숙주세포간에통로를형성한후다른분자들을숙주세포내로분비하여숙주세포손상을유도하여설사를유발한다 (33). 이러한단백질을암호화하고있는 tir, espa, espb, espd 유전자보유

13 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 91 여부를검토한결과, intimin과결합하는 receptor를지령하는 tir 유전자를보유하고있는 17주모두 eae, espb, espd 유전자를가지고있었으며 espa 유전자를보유하고있는 9주에서는모두 espb와 espd도확인되었다. 이는 espa, espb, espd는같은 promotor로부터번역되는데기인된결과이다 (17). 하지만 espa가존재하지않고 espb, espd만을가지고있거나, 이러한 TTSS 단백질을암호화하고있는유전자없이 eae만가지고있는, 즉 LEE profile 이온전하지않은균주들도확인할수있었다. 이는스페인에서사람과동물로부터분리된 STEC와 EPEC 균주를가지고 microarray를이용하여 eae, tir, espa, espb, espd 유전자의유형을분석한결과와유사하였고 (33), Yuste 등 (34) 이설사또는건강한소, 양, 염소로부터분리한 12개의 STEC에서 PCR을통해 eae, tir, espa, espb, espd 유전자를분석한결과에서도 LEE profile이온전하지않은균주들이확인되어본연구와일치함을알수있었다. 또한 intimin, Tir, EspA, EspB, EspD 등의단백질의상호작용으로 A/E lesion을형성하므로하나또는두개이상의단백질의결여는숙주세포에불완전하게부착하거나 A/E lesion이형성되지않아서, 이들유전자를모두가진균주보다는병원성이약할것으로추측된다. 다른 Esp 단백질 (EspA, EspB, EspD) 과는다르게 secreted serine protease 인 EspP는 plasmid 유래이다. Schmidt 등 (35) 은 in vitro에서 EspP가 human coagulation factor V를파괴시키며, 실제 EHEC에감염된 6명의아이들중 5명의혈청에서이단백질이분리하였다. 또한 Pradel 등 (9) 이프랑스 HUS 환자로부터분리한 STEC에서는 Esp, KatP (catalse-peroxidase), intimin이 STEC 임상증상과매우관계가깊음을보고하였다. 하지만 sorbitol 분해능이있는 O157 분리주에서는 espp 유전자가결여되었다는연구결과도있다 (36). 이처럼지역분리주에따라이들이병원성인자로서의역할은아직규명되지않았다. 본연구에서도설사및식중독환자유래 STEC 26주 (62%) 와무증상집단감염 STEC 6주 (50.1%) (p = 0.339) 에서 espp 유전자가확인되었으나임상증상의차이에따른통계학적유의성은없었다. STEC 균주간의상관관계에접근하기위한분자적실험중의하나가 LEE 삽입부위에대한결정이다. trna 유전자부위의많은변형때문에이러한유전자의삽입부위가균주간의유전자전달및동일계통임을확인하는데사용되어진다. 하지만 PCR 방법은분리균주간의클 론성상관관계에대한정보를제공하지만 LEE가삽입되어진 locus를규명하는데는 ribotyping과같은추가적인방법이필요하다 (9). Ribotyping도다양한혈청형사이에서그들의유전학적거리를측정하기는유용하지만동일혈청형에서는규명하기어렵다. 하지만 plasmid profile 분석법은같은혈청형에속해있는 STEC 분리주들의분자역학적상관관계를확인하는데사용되는방법이다 (37). 본실험에서도 LEE 삽입부위에대한 PCR 결과그들의계통학적상관관계나유전자전달에대한정보를파악하기는어려웠다. 따라서그것에대한정확한정보를알기위해서는 PFGE (pulsed field gel electophoresis) 나 phage typing이수행되어야할것이다. 설사를일으키는병원성대장균의진단에있어서가장유용한표현형적진단방법은 HEp-2 세포부착능시험이다. HEp-2 세포에대한부착은주로 3가지의형태, 즉국소적부착 (LA, localized adherence), 집합적부착 (AA, aggregative adherence) 그리고확산적부착 (DA, diffuse adherence) 으로나뉜다. 그러나 Vieira 등 (38) 은부착형태를보다세분화하여, 세포의표면에다양한크기로느슨하게뭉쳐서세균덩어리와개개의세균이산재된부착형태가함께존재할경우를 LC (loose clusters of bacteria) 라표기하고, 보다느슨하게뭉쳐진것과아주밀집되어뭉쳐진채로부착된세균덩어리가공존할경우를 LCC (loose and compact bacterial clusters), 그리고세균이뭉쳐있지않고개별적으로부착된세포에존재할경우, 이를 IS (isolated bacteria) 라고명명하였다. 이러한표기법은단지연구된균주들의부착형태의차이를나타내기위한목적으로, 세분화한것으로각각의실험자마다다를수있으며, 설사등의임상증상과직접적인상관관계는없다. EPEC에있어서 HEp-2 세포에대한 LA 표현형의형성과 bfpa 유전자및 EAF plasmid (EPEC adherence factor plasmid) 사이에는높은일치성을갖는것이일반적인경향이었으나, EAF plasmid가없으면서 LA를형성하는 EPEC 균주의존재도보고되었다 (39, 40). 이러한균주들에 BFP (bundle forming pili) 와유사한다른부착소가존재하는지는알려진바없으나, EAF plasmid가결여된균주들에서염색체상의 intimin을암호화하는 eae 유전자의증가된발현이 HEp-2 세포상에서 LA를유도할수있는것으로보여진다 (41). 이렇듯 EPEC의부착유형이나인자에대한연구는그들자체가병원성을나타낸다는많은보고가있지만, STEC는아직도이들에대한논란이

14 92 MJ Kim, et al. 많아부착형태에대한연구가미비하다. 또한 EPEC나 STEC 둘다 LEE locus에의해 A/E lesion을형성하지만조절기전이나분비되는단백질이많이다르다 (42). 즉장점막에이들이부착되어진후 EPEC는 BFP나 flagella에의해집합을형성하여다른세균들을부착하게하여미세군락을형성하지만 (43, 44), STEC 또한 BFP나 EPEC 의다른부착인자들과기능적으로유사한구조를가진단백질들의존재로장점막에군락을형성한다 (42). 본연구에서증상과무증상환자에서분리된 STEC 균주간의 eae와 saa 유전자발현의차이가뚜렷하여, saa 유전자를가진무증상 STEC 분라주의세포부착능이미비하거나없을것이라는가정하에실험을실시하였지만, eae 유전자를가진 STEC 대부분이 LA 형태를보였으며 saa 유전자를가진 STEC는 LC나 IS 형태가확인되어부착형태에따른차이만관찰할수있었다. 따라서 eae나 saa 두가지유전자만으로부착형태와연관짓기는어려우며 EPEC의부착형태에 LEE locus에위치한유전자이외에 BFP나 flagella가작용하는것처럼 ToxB, Sfp, Iha, Efa1 (EHEC factor for adherence) LPF (lomg polar fimbriae) 와같은 STEC와관련있는부착인자들에대한연구가종합적으로이루어져야할것이라고판단된다 (45~50). 본연구에서는광주지역설사환자분리주와무증상감염주를대상으로시가독소이외에병원성과관련있는 LEE 유전자, 용혈소등의병원성인자보유및변이체에대한유전학적특징 ( 병원형 ) 을비교검토하여시가독소생성대장균의병인기작을밝혀이를바탕으로장출혈성대장균감염증제어를위한대책을수립하는데기초자료를마련하고자하였다. 그결과설사환자분리주에서는 eae 유전자가, 무증상집단감염주에서는 saa 유전자가우세한것으로확인되어, LEE가결여된 STEC에서 saa가용혈성요독증후군과같은심각한임상증상을일으킨다는연구결과 (6) 와는상이하였지만, 분리원에따른분리주의유전자보유여부에차이가있으므로향후 STEC의병원성여부를판단할때참고자료로유용할것으로생각된다. 또한 eae 유전자형을관찰한결과 eae γ 형이가장많았으나, eae β 형과 eae ε 형및유전자유형이결정되지않은균주들도상당부분있어서이들균주들간의유전적다양성이높은것으로사료되어지며 ζ, η, θ, ι와같은새로운 eae 유전자형 (51) 에대한추가검사도요구되어진다. 더해서병원성과비병원균주를비교함으로써시가독소이외에다른핵심병원성인자의확인을시도하였으 나, 이는지역이나나라별분리주들간의병원성인자들에대한통계학적유의수준정도가매우다양하게나타나명확한결론을내리기는어려웠다. STEC 인체감염의가장중요한감염원인소분리주와의비교연구에서도혈청형, 독소형, 유전자형이사람분리주와는많은차이가있었다. 따라서소에서분리된 STEC가모두사람에서병원성을나타내는것이아니며, 비록병원성이약하거나없더라도균주들간의유동성 DNA 전달을통해후천적으로병원성을획득할가능성이우려되므로소이외의가축등에서 STEC의감염실태에대한연구와지속적인감시체계가필요할것으로생각된다. Acknowledgements The authors give their best thanks to the staffs of the hospitals in Gwangju city for their kind contribution and help. 참고문헌 1) Griffin PM, Tauxe RV. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli. and the associated hemolytic uremic syndrome. Epidemiol Rev 1991;13: ) Levine MM, Xu JG, Kaper JB, Lior H, Prado V, Tall B, Nataro J, Karch H, Wachsmuth K. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J Infect Dis 1987;156: ) Gyles CL. Escherichia coli cytotoxins and enterotoxins. Can J Microbiol 1992;38: ) Finlay BB, Rosenshine I, Donnenberg MS, Kaper JB. Cytoskeletal composition of attaching and effacing lesions associated with enteropathogenic Escherichia coli adherence to Hela cells. Infect Immun 1992;60: ) Jerse AE, Yu J, Tall BD, Kaper JB. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci USA 1990;87: ) Paton AW, Srimanote P, Woodrow MC, Paton JC. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun 2001; 69:

15 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 93 7) Srimanote P, Paton AW, Paton JC. Characterization of a novel type IV pilus locus encoded on the large plasmid of locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun 2002; 70: ) Boerlin P, McEwen SA, Boerlin-Petzold F, Wilson JB, Johnson RP, Gyles CL. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol 1999;37: ) Pradel N, Bertin Y, Martin C, Livrelli V. Molecular analysis of Shiga toxin-producing Escherichia coli strains isolated from hemolytic uremic syndrome patients and dairy samples in France. Appl Environ Microbiol 2008;74: ) Brunder W, Schmidt H, Karch H. KatP. a novel catalaseperoxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology 1996; 142: ) Schmidt H, Henkel B, Karch H. A gene cluster closely related to type II secretion pathway operons of gram-negative bacteria is located on the large plasmid of enterohemorrhagic Escherichia coli O157 strains. FEMS Microbiol Lett 1997;148: ) Brunder W, Schmidt H, Karch H. EspP, a novel extracellular serine protease of enterohaemorrhagic Escherichia coli O157: H7 cleaves human coagulation factor V. Mol Microbiol 1997; 24: ) Kim Y-B. Studies on virulence factors and application of arbitrarily-primed polymerase chain reaction analysis to epidemiological of Escherichia coli O157:H7. J Bacteriol Virol 2001:31: ) Paton AW, Paton JC. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxa, and saa. J Clin Microbiol 2002;40: ) China B, Goffaux F, Prison V, Mainil J. Comparison of eae, tir, espa and espb genes of bovine and human attaching and effacing Escherichia coli by multiplex polymerase chain reaction. FEMS Microbiol Lett 1999;178: ) Goffaux F, China B, Janssen L, Mainil J. Genotypic characterization of enteropathogenic Escherichia coli (EPEC) isolated in Belgium from dogs and cats. Res Microbiol 2001;151: ) McNally A, Roe AJ, Sompson S, Thomson-Carter FM, Hoey DE, Currie C, Chakraborty T, Smith DG, Gally DL. Differences in levels of secreted locus of enterocyte effacement proteins between human disease-associated and bovine Escherichia coli O157. Infect immun 2001;69: ) McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci USA 1995;92: ) Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaea, enterohemorrhagic E. coli hlya, rfbo111, and rfbo157. J Clin Microbiol 1998;36: ) Kobayashi H, Shimada J, Nakazawa M, Morozumi T, Pohjanvirta T, Pelkonen S, Yamamoto K. Prevalence and characteristics of Shiga toxin-producing Escherichia coli from healthy cattle in Japan. Appl Environ Microbiol 2001;67: ) Wieler LH, Vieler E, Erpenstein C, Schlapp T, Steinruck H, Bauerfeind R, Byomi A, Baljer G. Shiga toxin-producing Escherichia coli strains from bovines: association of adhesion with carriage of eae and other genes. J Clin Microbiol 1996; 34: ) Franke J, Franke S, Schmidt H, Schwarzkopf A, Wieler LH, Baljer G, Beutin L, Karch H. Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol 1994;32: ) Cravioto A, Gross RJ, Scotland SM, Rowe B. An adhesive factor found in strains of Escherichia coli belonging to the traditional infantile enteropathogenic serotypes. Curr Microbiol 1979;3: ) Paton AW, Srimanote P, Woodrow MC, Paton JC. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun 2001;69: ) Paton AW, Woodrow MC, Doyle RM, Lanser JA, Paton JC. Molecular characterization of a Shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of hemolytic-uremic syndrome. J Clin Microbiol 1999; 37: ) Toma C, Martinez Espinosa E, Song T, Miliwebsky E, Chinen I, Iyoda S, Iwanaga M, Rivas M. Distribution of putative adhesins in different seropathotypes of Shiga toxin-producing Escherichia coli. J Clin Microbiol 2004;42:

16 94 MJ Kim, et al. 27) Moon HW, Whipp SC, Argenzio RA, Levine MM, Giannella RA. Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect Immun 1983;41: ) Adu-Bobie J, Frankel G, Bain C, Goncalves AG, Trabulsi LR, Douce G, Knutton S, Dougan G. Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol 1998:36: ) Oswald E, Schmidt H, Morabito S, Karch H, Marche's O, Caprioli A. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect Immun 2000; 68: ) Frankel G, Candy DC, Fabiani E, Adu-Bobie J, Gil S, Novakova M, Phillips AD, Dougan G. Molecular characterization of a carboxy-terminal eukaryotic-cell-binding domain of intimin from enteropathogenic Escherichia coli. Infect Immun 1995;63: ) Gyles CL. Shiga toxin-producing Escherichia coli: An overview. J Anim Sci 2007;85(13 Suppl.):E ) Bertin Y, Boukhors K, Livrelli V, Martin C. Localization of the insertion site and pathotype determination of the locus of enterocyte effacement of Shiga toxin-producing Escherichia coli strains. Appl Environ Microbiol 2004;70: ) Garrido P, Blanco M, Moreno-Paz M, Briones C, Dahbi G, Balnco J, Balnco J, Parro V. STEC-EPEC oligonucleotide microarray: A new tool for typing genetic variants of the LEE pathogenicity island of human and animal Shiga toxinproducing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) strains. Clin Chem 2006;52: ) Yuste M, Orden JA, De La Fuente R, Ruiz-Santa-Quiteria JA, Cid D, Martinez-Pulgarin S, Dominquez-Bernal G. Polymerase chain reaction typing of genes of the locus of enterocyte effacement of ruminant attaching and effacing Escehrichia coli. Can J Vet Res 2008;72: ) Schmidt H, Zhang WL, Hemmrich U, Jelacic S, Brunder W, Tarr PI, Dobrindt U, Hacker J, Karch H. Identification and characterization of a novel genomic island integrated at selc in locus of enterocyte effacement-negative, Shiga toxinproducing Escherichia coli. Infect Immun 2001;69: ) Karch H, Bielaszewska M. Sorbitol-fermenting shiga toxinproducing Escherichia coli O157:H(-) strains: epidemiology, phenotypic and molecular characteristics, and microbiological diagnosis. J Clin Microbiol 2001;39: ) Pradel N, Boukhors K, Bertin Y, Forestier C, Martin C, Livrelli V. Heterogeneity of Shiga toxin-producing Escherichia coli strains isolated from hemolytic-uremic syndrome patients, cattle, and food samples in central France. Appl Environ Microbiol 2001;67: ) Vieira MA, Andrade JR, Trabulsi LR, Rosa AC, Dias AM, Rames SR, Frankel G, Gomes TA. Phenotypic and genotypic characteristics of Escherichia coli strains of nonenteropathogenic E. coli (EPEC) serogroups that carry EAE and lack the EPEC adherence factor and Shiga toxin DNA probe sequence. J Infect Dis 2001;183: ) Bokete TN, Whittam TS, Wilson RA, Clausen CR, O'Callahan CM, Moseley SL, Fritsche TR, Tarr PI. Genetic and phenotypic analysis of Escherichia coli with enteropathogenic characteristics isolated from Seattle children. J Infect Dis 1997; 175: ) Scotland SM, Smith HR, Rowe B. Escherichia coli O128 strains from infants with diarrhea commonly show localized adhesion and positivity in the fluorescent-actin staining test but do not hybridize with an enteropathogenic E. coli adherence factor probe. Infect Immun 1991;59: ) Gordillo ME, Reeve GR, Pappas J, Mathewson JJ, DuPunt HL, Murray BE. Molecular characterization of strains of enteroinvasive Escherichia coli O143, including isolates from a large outbreak in Houston, Texas. J Clin Microbiol 1992;30: ) Roe AJ, Hoey DE, Gally DL. Regulation, secretion and activity of type III-secreted proteins of enterohaemorrhagic Escherichia coli O157. Biochem Soc Trans 2003;31: ) Tobe T, Sasakawa C. Role of bundle-forming pilus of enteropathogenic Escherichia coli in host cell adherence and in microcolony development. Cell Microbiol 2001;3: ) Knutton S, Shaw RK, Anantha RP, Donnenberg MS, Zorgani AA. The type IV bundle-forming pilus of enteropathogenic Escherichia coli undergoes dramatic alterations in structure associated with bacterial adherence, aggregation and dispersal. Mol Microbiol 1999;33: ) Tatsuno I, Horie M, Abe H, Miki T, Makino K, Shinagawa H, Taguchi H, Kamiya S, Hayashi T, Sasakawa C. toxb gene on po157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun 2001;69: ) Brunder W, Khan AS, Hacker J, Karch H. Novel type of

17 Molecular Genetic Characterization of Shiga Toxin-producing E. coli 95 fimbriae encoded by the large plasmid of sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H(-). Infect Immun 2001;69: ) Tarr PI, Bilge SS, Vary JC Jr, Jelacic S, Habeeb RL, Ward TR, Baylor MR, Besser TE. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect Immun 2000;68: ) Nicholls L, Grant TH, Robins-Browne RM. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol 2000;35: ) Doughty S, Sloan J, Bennett-Wood V, Robertson M, Robins- Browne RM, Hartland EL. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect Immun 2002;70: ) Torres AG, Giron JA, Perna NT, Burland V, Blattner FR, Avelino-Flores F, Kaper JB. Identification and characterization of lpfabcc'de, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect Immun 2002;70: ) Zhang WL, Kohler B, Oswald E, Beutin L, Karch H, Morabito S, Caprioli A, Suerbaum S, Schmidt H. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol 2002;40: