Microsoft Word - 04-박동욱.DOC

Size: px
Start display at page:

Download "Microsoft Word - 04-박동욱.DOC"

Transcription

1 대한생식의학회지 : 제 37 권제 3 호 2010 관동대학교의과대학제일병원분자종양학연구실 1, 관동대학교의과대학제일병원생식생물학및불임연구실 2, 관동대학교의과대학제일병원산부인과 3 이창세 1 박동욱 2 * 박찬우 3 김태진 3 Role of HOXA Gene in Human Endometrial Decidualization Chang Se Lee 1, Dong Wook Park 2 *, Chan Woo Park 3, Tae Jin Kim 3 1 Laboratory of Molecular Oncology, 2 Laboratory of Reproductive Biology and Infertility, 3 Department of Obstetrics and Gynecology, Cheil General Hospital, Kwandong University College of Medicine, Seoul, Korea Objective: This study was performed to clarify the role of HomeoboxA (HOXA) and its related signaling molecules in the decidualization of primary cultured endometrial cells. Methods: Human endometrial tissues were obtained by curettage of hysterectomy specimens from patients with conditions other than endometrial diseases. Tissues were minced and digested with Trypsin-EDTA for 20 min, 37. Cells were cultured with DMEM/F12 medium in 37, 5% CO 2 incubator for 24 hrs. Cells were treated with HOXA10 sirna and added transforming growth factor (TGF)-β1 (10 ng/ml) for 48 hrs to induces decidualization in vitro. Reverse transcription polymerase chain reaction analysis was accomplished to observe the expression of HOXA10, prolactin, cyclooxygenase (COX)-2, peroxisome proliferatoractivated receptor (PPAR)-γ, and wingless-type MMTV integration site family (Wnt). Results: HOXA10 expression was increased (1.8 fold vs. non-treated control) in TGF-β1 treated cells. Decidualization marker, prolactin, was significantly increased in TGF-β1 treated cells compared with HOXA10 sirna treated cells. Endometrial cell differentiation marker, COX-2 was down-regulated by HOXA10 sirna even if cells were treated with TGF-β1. Wnt4 was down-regulated by treated with HOXA10 sirna, this expression patters was not changed by TGF-β1. Expression of PPAR-γ was down regulated by TGF-β1 in regardless of HOXA10 sirna treatment. Conclusion: TGF-β1 which is induced by progesterone in endometrial epithelial cells may induces stromal cell decidualization via HOXA10 and Wnt signaling cascade. [Korean. J. Reprod. Med. 2010; 37(3): ] Key Words: HOXA, Wnt, Decidualization, Endometrium 인간자궁내막은생리주기에따라생리 (menstruation), 증식및착상기자궁내막으로의분화를 접수일 : 2010 년 6 월 7 일, 수정일 : 2010 년 7 월 26 일게재확정일 : 2010 년 8 월 3 일주관책임자 : 박동욱, 우 ) 서울특별시중구묵정동 1-19, 관동대학교의과대학제일병원생식생물학및불임연구실 Tel: (02) , Fax: (02) gypsyroad@empal.com * 이논문은 2008 년도정부 ( 교육과학기술부 ) 의재원으로한국연구재단의지원을받아수행된기초연구사업임 (No E00320). 반복하는조직이다. 이중자궁내막기질세포의탈락막화 (decidualization) 는생리주기중후기분비기 (late secretory phase) 에 progesterone의영향에의하여일어나며세포의형태학적, 분자생물학적분화를수반하는것으로알려져있다. 1,2 탈락막으로분화된자궁내막세포는 prolactin (PRL), relaxin, cyclooxygenase (COX)-2 등을발현시키는것으로알려져있으며이중 PRL은일반적으로사용되는

2 대한생식의학회지 탈락막화표지인자다. 3 Transforming growth factor (TGF)-β는영장류의자궁내막조직에서 sex steroid hormone에의한생리주기에따라그발현양상이변화하며이는 TGF-β가 sex steroid hormone의자궁내막착상환경조절에중요한역할을함을시사한다. 4 In vitro에서자궁내막세포를탈락막화시키기위하여는 progesterone, camp 또는 TGF-β1 등을외부에서첨가하여탈락막화를유도할수있다. 이중 TGF-β1은 3차원자궁내막공배양을이용한연구에서 progesterone 첨가에의하여자궁내막상피세포에서분비되는것으로알려져있으며분비된 TGF-β1은자궁내막기질세포에서발현되는 TGF-β 수용체와이와연결된일련의세포내신호전달시스템에의하여기질세포의탈락막화를유도하는것으로보고된바있다. 5 이러한 TGF-β1에의한자궁내막의탈락막화는 peroxisome proliferator-activated receptor (PPAR)-γ 에의하여억제되는것으로알려져있다. 3 Homeobox (HOX) 유전자는진화론적으로종간에매우잘보전되어있으며배발생에있어서형태형성및분화를조절하는것으로알려져있다. 6,7 포유류에서는 39개의 HOX 유전자가 HOXA, B, C, D 와같은 4개의유전자집단 (cluster) 에속하는것으로보고되고있으며각 cluster는각기다른염색체에위치하여 9~11개의유전자들을포함하는것으로알려져있다. 7 Taylor 등 8 은 paramesonephric duct 의발생과정에서 HOXA9의경우에는수란관으로발달될부분에서주로발현하며 HOXA10의경우자궁으로발달될부분, HOXA11은자궁저부및자궁경부, HOXA13은질 (vagina) 로발달될부분에 HOX 유전자 cluster가일렬로발현되는것을보고한바있다. 이러한 HOXA 유전자는이후성체시기에임신및착상에중요한역할을하는것으로알려져있다. HOXA 유전자는 sex steroid hormone 에의하여그발현이조절되는것으로알려져있다. 9 백서 (mouse) 의자궁내막에서 HOXA10은착상기자궁내막의해부학적표지인자인 pinopod의발현을조절하는것으로보고되었으며, 10 이와더불어 pinopod 내부를채우고있는 leukemia inhibitory factor (LIF) 의발현을조절하는것으로알려져있다. 11 따라서 HOXA10은착상기자궁내막으로의분화에중요한역할을하는것으로결론지을수있다. 이와더불어 HOXA11의경우자궁내막기질세포주에서 PRL의발현을증가시키는것으로보고되었다. 12 따라서본연구에서는 TGF-β1을첨가하여배양된자궁내막기질세포를탈락막화시키는과정에있어서 HOXA10 유전자및이와연관된것으로알려져있는유전자들의역할을관찰하고자하였다. 연구대상및방법 1. 자궁내막조직의획득자궁내막조직은관동의대제일병원산부인과를내원한환자중자궁내막질환이외의양성질환 ( 자궁근종 ) 으로인해전자궁적출술을시행한환자들을대상으로하였다. 이들은모두생리일을기준으로중기및후기분열기인여성들이었으며적출된자궁후저부로부터자궁내막조직을획득하였다. 모든조직은본원기관윤리위원회의심의및환자의동의하에시행하였으며최소 3인의환자의자궁내막조직을사용하였다. 2. 면역세포화학염색배양된세포를 3.7% formaldehyde 용액으로상온에서 15분간고정시켰다. Phospate buffered solution (PBS) 로세척하여남아있는고정액을제거한후일차항체를 500:1로희석하여 4시간동안반응시킨후통상적면역세포화학적염색을수행하였다. 면역조직화학에사용한일차항체는다음과같다. 이들을 diaminobenzidine (DAB)-chromogen으로발색시킨후 PBS를 culture dish에부어세포가건조되는것을방지한상태에서 phase contrast inverted microscope (Diaphot 300, Nikon Co., Tokyo, Japan) 를이용하여염색정도를확인하였다. HOXA10 및 PRL 일차항체는모두 Santa Cruz (California, CA,

3 제 37 권제 3 호, 2010 이창세 박동욱 박찬우 김태진 USA) 사로부터구입하여사용하였으며 2차항체처리및발색 kit는 DAKO (Glostrup, Denmark) 사의 LSAB kit을구입하여사용하였다. 3. 자궁내막조직세포배양적출된자궁검체로부터획득한자궁내막조직을 PBS가들어있는 conical tube (Falcon, California, USA) 에담아무균실험대로운반하였고, PBS로여러번세척하여혈액을제거하였다. 자궁내막조직을 PBS가들어있는 dish에서잘게자른후원심분리하여상층액을제거하고, trypsin-edta (Gibco, Grand Island, NY, USA) 10 ml을첨가하여 37 에서 30분동안반응을시켰다. 반응후 fetal bovine serum (FBS) 1 ml을첨가하여효소반응을정지시키고, 원심분리하여상층액을제거하였다. 다시 PBS 5 ml을첨가하여현탁시킨후원심분리하여상층액을제거하고 DMEM F/12 (10% FBS) 10 ml을첨가하여재현탁시킨후상층액 8 ml (stromal fraction) 을 100 mm 배양접시 (Corning, Corning, NY, USA) 에분주한후하룻밤동안배양하였다. 부유하는세포및적혈구를 PBS로씻어내고 2회계대배양하였다. 실험에사용한세포는 DMEM F/12 (10% FBS; 1 nm E2; 100 nm P4) 조건하에서배양하였으며, 실험목적에따라 10 ng/ml의 TGF-β1 (Sigma, St. Louis, MO, USA) 을첨가하고, 48시간동안배양하여탈락막화를유도하였다. 4. Small interfering RNA (sirna) 에의한 HOXA10 유전자의 silencing Lipofectamine 2000 (Invitrogen, Gaithersburg, MD, USA) transfection reagent를이용하여 sirna를 transfection하였다. 자궁내막세포에 20 nmol의 HOXA10 sirna oligonucleotides (Dharmacon, ON- TARGETplus SMARTpool M ) 를 transfection하였고, sirna를 transfection한후 24시간뒤에 TGF-β1 (Sigma) 을첨가하여 48시간동안배양하였다. 5. Reverse transcription polymerase chain reaction (RT-PCR) 및통계처리실험목적에따라배양된세포에서 TRIZOL reagent (Invitrogen) 를이용하여 total RNA를추출하였다. 추출된 total RNA 2 μg으로 M-MLV reverse transcriptase (Promega, Madison, WI, USA) 를이용하여 cdna를합성하였다. 합성된 cdna를주형으로하여각유전자에대한 PCR을수행하였다. 합성된 cdna를주형으로각유전자에대한 primer (Table 1) 를제작하여 PCR을수행하였다. PCR 결과증폭 Table 1. Gene specific primer sequence Gene name Forward primer (5' to 3') Reverse primer (5' to 3') HOXA10 GCCCCTTCCGAGAGCAGCAAAG AGGTGGACGCTGCGGCTAATCT IGFBP1 CTCTCCATGTCACCAACATCAA CCCATTCCAAGGGTAGACGC PRL AAAGCTGTAGAGATTGAGGAGCA CGATTTTATGTGAATCCCTGCGT COX-2 CCCTTGGGTGTCAAAGGTAA GCCCTCGCTTATGATCTGTC PPAR-γ CTCATGAAGAGCCTTCCAACTCC ACCCTTGCATCCTTCACAAGC Wnt3 GACCACATGCACCTCAAATG GATGCAGTGGCATTTTTCCT Wnt4 ACCTGGAAGTCATGGACTCG GCCTCATTGTTGTGGAGGTT HOX, homeobox; IGFBP, insulin-like growth factor-binding protein; PRL, prolactin; COX, cyclooxygenase; PPAR, peroxisome proliferator-activated receptor; Wnt, wingless-type MMTV integration site family

4 대한생식의학회지 A B Figure 1. (A) Immunocytochemical images of cultured human endometrial cells. Over 95% of cultured endometrial cells express HOXA10. Immunological resulting in a brownish stain and counterstained with Mayer's hematoxyline ( 200). HOXA10 sirna eliminates HOXA10 expression in endometrial cells. (B) RT-PCR analysis for HOXA10 expression in cultured human endometrial cells. TGF-β1 (10 ng/ml, for 48 hr) upregulated HOXA10 mrna expression, these effect was diminished by treatment of HOXA10 sirna. HOX, homeobox; sirna, small interfering RNA; RT-PCR, reverse transcription polymerase chain reaction; TGF, transforming growth factor. 된유전자는통상적인 agarose 전기영동을수행하였으며 GeneFlash imaging system (Syngene, Frederick, MD, USA) 을이용하여 band의강도를측정하였다. 데이터는대조군을 1로하여증감을값으로나타내었으며각기독립적인 3번의실험을수행하였다. ANOVA test를이용하여통계를수행하였다. p값이 0.05 미만일경우대조군과비교하여통계적으로유의한변화로인정하였다. 결과 HOXA10 sirna의효과를알아보기위하여배양된자궁내막 HOXA10 sirna를 72시간처리하여 HOXA10 단백질및 mrna의발현을면역세포화학적방법및 RT-PCR 을이용하여확인하였다. 확인결과 HOXA10 sirna를처리한세포에서 90% 이상의세포가 HOXA10 단백질을발현하지않았으며 (Figure 1A), mrna의발현에있어서도 HOXA10 sirna를처리한군에있어서 HOXA10 mrna의발현이 50% 이상감소하는것을확인할수있었

5 제37권 제3호, 2010 이창세 박동욱 박찬우 김태진 A B Figure 2. Effect of HOXA10 sirna on and IGFBP-1 expression. TGF-β1 (10 ng/ml, for 48 hr) upregulated PRL and IGFBP1 mrna (A) and PRL protein (B) expression, these effect were inhibited by treatment of HOXA10 sirna. Values are the mean intensity (± standard deviation) from three independent experiments. Immunological resulting in a brownish stain and counterstained with Mayer's hematoxyline ( 200). *indicates p<0.05 vs. control. HOX, homeobox; sirna, small interfering RNA; PRL, prolactin; IGFBP-1, insulin-like growth factor-binding protein-1; TGF, transforming growth factor. 다. 또한 48시간 동안 10 ng/ml의 농도로 TGF-β1 수 없었다. 이와 더불어 또 하나의 탈락막 표지인 을 처리한 군에 있어서도 HOXA10 mrna의 발현 자로 알려진 IGFBP1 역시 TGF-β1를 처리한 군에 이 50% 가량 감소하는 것을 알 수 있었다 (Figure 서 1.9±0.38배 (p<0.05) 증가하는 양상을 보였으며 1B). 따라서 본 연구에 사용한 HOXA10 sirna는 대조군 및 HOXA sirna를 처리한 군 및 HOXA 효과적으로 HOXA10의 mrna와 그 산물 단백질 sirna와 TGF-β1만을 처리한 군에서는 그 발현양 의 발현을 효과적으로 억제함을 알 수 있었다. 의 변화를 관찰할 수 없었다 (Figure 2A, 2B). 또한 HOXA10 sirna에 의한 PRL의 발현 억제를 관 cyclooxygenase (COX)-2의 발현 역시 TGF-β1에 의 찰하기 위하여 48시간 동안 10 ng/ml의 TGF-β1을 하여 1.82±0.2배 (p<0.05) 증가하는 양상을 보였으 처리함과 동시에 HOXA10 sirna를 처리하여 PRL 나 sirna를 이용하여 HOXA10 유전자의 발현을 단백질 및 mrna의 발현을 RT-PCR 및 면역세포 억제한 군에 있어서는 증가를 관찰할 수 없었다 화학적 염색법으로 관찰하였다. 실험 결과 TGF-β1 (Figure 3). 을 처리한 군에서 PRL의 발현양이 처리하지 않은 이와 더불어 TGF-β의 세포 내 신호전달과 관계 대조군에 비하여 2.6±0.42배 (p<0.05) 증가하였으 있는 것으로 알려진 wingless-type MMTV integration 나 HOXA10 sirna를 동시에 처리한 군에 있어서 site family (Wnt)13의 발현양을 비교하였다. 실험 결 는 TGF-β1의 처리와는 상관없이 그 증가를 관찰할 과 Wnt3의 경우 TGF-β1의 처리에 의하여 발현양

6 대한생식의학회지 Figure 3. Effect of HOXA10 sirna on COX-2 expression. TGF-β1 (10 ng/ml, for 48 hr) upregulates PRL mrna expression. These effect was inhibited by treatment of HOXA10 sirna. Values are the mean intensity (± standard deviation) from three independent experiments. *indicates p<0.05 vs. control. HOX, homeobox; sirna, small interfering RNA; COX, cyclooxygenase; TGF, transforming growth factor; PRL, prolactin. Figure 4. Effect of HOXA10 sirna on Wnt3 and Wnt4 expression. TGF-β1 (10 ng/ml, for 48 hr) upregulates Wnt3 mrna expression. This effect was inhibited by treatment of HOXA10 sirna. Expression of Wnt for was not upregulated by TGF-β1, but it diminished by HOXA10 sirna. Values are the mean intensity (± standard deviation) from three independent experiments. *indicates p<0.05 vs. control. HOX, homeobox; sirna, small interfering RNA; Wnt, wingless-type MMTV integration site family; TGF, transforming growth factor. 이 1.6±0.2배 (p<0.05) 가량증가하였으나 HOXA10 sirna의처리에의하여 mrna의발현양에유의한차이를관찰할수없었다. 그러나, Wnt4 발현의경우 TGF-β1의처리에영향을받지는않았으나 HOXA10의발현을억제했을경우그발현이 0.4배가량감소함을확인할수있었다 (Figure 4). PPAR-γ의경우 TGF-β1 처리에의하여 0.48± 0.2 (p<0.05) 로그발현이감소되었으며, TGF-β1과 HOXA10 sirna를동시에처리한군에서는 0.47± 0.15 (p<0.05) 정도로발현이감소하였다. 그러나 HOXA10 sirna만단독으로처리한군에있어서는감소되거나증가하는양상을관찰할수없었다 (Figure 5)

7 제 37 권제 3 호, 2010 이창세 박동욱 박찬우 김태진 Figure 5. Effect of HOXA10 sirna on peroxisome PPAR-γ expression. TGF-β1 (10 ng/ml, for 48 hr) inhibited PPARγ mrna expression. These effects were not affected by treatment of HOXA10 sirna. Values are the mean intensity (± standard deviation) from three independent experiments. *indicates p<0.05 vs. control. HOX, homeobox; sirna, small interfering RNA; PPAR, peroxisome proliferator-activated receptor; TGF, transforming growth factor. 고찰백서의자궁내막에서 HOXA10의발현을억제시켰을경우배란이정상적으로이루어져도정상적인착상이일어나지않는다. 14 이는 HOXA 유전자산물이자궁내막의분화및착상환경 (endometrial receptivity) 구현에중요한역할을하는것을의미하는것으로볼수있다. 따라서본연구에서는인간자궁내막의분화중탈락막화과정에있어서 HOXA10의역할및이와관련된유전자들의발현을관찰하고자하였다. 본연구에서자궁내막기질세포의탈락막화를유발하는것으로알려진 TGF-β1을처리한경우 HOXA10의발현이유의하게증가함을볼수있었다 (Figure 1B). 현째까지 TGF-β에의한 HOX 유전자발현조절에관한보고는그리많지않다. 그러나 Gamer 등 15 은닭의사지 (limb) 발달에있어서 TGF-β의상위족 (superfamily) 인 GDF11이일부 HOX 유전자의발현을조절함을보고한바있다. 따라서본연구에서도자궁내막분화인자인 TGF-β 가배양된자궁내막세포의 HOXA10의발현을유도하는것으로생각된다. 배양된자궁내막세포에 서 PRL 및 COX-2의발현은 HOXA10을 knockdown 시켰을경우 TGF-β1의처리와상관없이발현양의증가를보이지않았다 (Figures 2, 3). 이러한연구결과는 hcg를처리한배양된자궁조직에서 HOXA- 10의발현이증가된다는최근의보고 16 와도일치하는것으로초기착상에있어서 HOXA10이중요한역할을할것을의미한다. 또한영장류를이용한자궁내막증모델연구 17 에서밝힌바와같이 HOXA- 10은자궁내막에서탈락막화를조절하는인자중하나라는것을증명하는결과로생각된다. Wnt 유전자는초파리의체절분화와연관되어있으며다양한 glycoprotein의발현과연관되어있는것으로알려져있다. 인간과백서에서 Wnt족유전자들은 19개그룹의신호전달분자들의분비와관련되어있으며이들은세포의세포간상호작용, 생장및분화에관계하는것으로알려져있다. 18 백서를이용한착상및임신모델에서 Wnt는난소로부터분비되는 steroid hormone에의하여그발현이조절되며임신및착상에관여하는것으로보고되었다. 19 따라서본연구에서도인간자궁내막의탈락막화과정에 Wnt가관여할것으로가정하였다. 연구결과 Wnt3의경우 TGF-β1의처리에의하여

8 대한생식의학회지 Figure 6. A schematic drawing of human endometrial stromal cell decidualization. TGF, transforming growth factor; HOX, homeobox; PPAR, peroxisome proliferatoractivated receptor; Wnt, winglesstype MMTV integration site family. Chang Se Lee. Role of HOXA Gene in Human Endometrial Decidualization. Korean J Reprod Med 그발현이증가하였으나 HOXA10의발현을억제한군에있어서는그발현의변화를관찰할수없었다. 그러나 Wnt4의경우에는 TGF-β1의첨가에의하여그발현양이증가하지는않았으나 HOXA10의발현을 knockdown시킨자궁내막세포에있어서는그발현양이감소하는것을관찰할수있었다 (Figure 4). 반면에 Wnt-6, -7, -5b, -10b 및 -3a의경우 HOXA10 sirna 및 TGF-β1의처리에의하여발현양의변화를관찰할수없었다 (data not shown). 현재까지다양한 Wnt 유전자들이인간자궁내막에서생리주기중증식및분비기에발현하는것으로알려져있다. 20 이중 Wnt4는포배의착상에중요한역할을하는것으로보고되었으며인간과백서의자궁내막에서탈락막화과정중그발현이증가하는것으로알려져있다. 배양된백서자궁내막을이용한연구에서 TGF-β의상위족인 BMP2가 Wnt4를하위타깃으로하여탈락막화를유발한다는연구결과 21 에서나타내는바와같이본연구에서도인간자궁내막세포의탈락막화과정에있어서도 TGF-β의하위타깃으로 Wnt4가작용함을알수있었다. 이러한연구결과로미루어 TGF-β에의한자궁내막세포의탈락막화과정은 TGF-β에의하여인산화된 smad2/3가핵으로이동하여 Wnt4의발현을조절하며이결과탈락막화가진행되는것으로가정할수있으며이에대한추가적인연구가필요하다고생 각된다. PPAR는 nuclear hormone receptor 족의일원으로서기질의존적전사요소 (ligand-dependent transcription factors) 로알려져있다. 현재까지세종류의 PPAR 이알려져있으며 (PPARα, β, γ) 이중 PPARγ 는세포의생장, 분화, 사멸및염증반응과같은다양한생체반응을조절하는것으로보고되고있다. 이와더불어 PPARγ 를인간간암세포에서과발현시켰을경우 TGF-β1에의한 Smad 활성을억제하는것으로알려져있다. 22 Chang 등 3 은 TGF-β1에의한자궁내막세포의탈락막화과정은 PPARγ 에의해서억제됨을보고한바있다. 본연구에서도 TGF-β1 을처리한세포에서 PPARγ mrna의발현이현저하게감소하는것을관찰할수있었다. 그러나 HOXA10의발현억제에따라그발현양의변화는관찰되지않았다 (Figure 5). 이러한결과로미루어 TGF-β1와 PPARγ간에는음의상관관계가있는것으로보이며이러한과정은 HOXA10의발현과는무관하게진행되는것으로생각된다. 본연구진은이전의연구결과에서자궁내막기질세포의탈락막화과정은 progesterone에의한직접적인영향보다는 progesterone에의하여자궁내막상피세포에서분비된 TGF-β가기질세포에발현된 TGF-β 수용체와결합함으로써일어남을증명하였으며이와같은일련의과정은 PPARγ에의하여

9 제 37 권제 3 호, 2010 이창세 박동욱 박찬우 김태진 억제됨을보고한바있다. 3,5 본연구에서는이러한일련의탈락막화과정에 TGF-β 이외에도 HOXA10 및 Wnt 역시관여함을관찰하였다. 결론적으로, 성호르몬에의하여착상기로분화되는자궁내막에서 progesterone에의하여자궁내막상피세포로부터분비된 TGF-β에의한자궁내막기질세포의탈락막화과정은 HOXA10과 Wnt를통한세포내신호전달과정을거치는것으로결론지을수있다 (Figure 6). 또한이러한세포내신호전달과정및각분자들간의정확한상관관계를증명하기위한추가적인분자생물학적인연구가필요할것으로생각된다. 참고문헌 1. Takekida H. Autoradiographic studies on the nucleic acid and protein synthesis and the decidualization of endometrium in early pregnancy of rat. Acta Obstet Gynaecol Jpn 1971; 18: Tamaya T, Fujimoto J, Arabori K, Wada K, Kato Y, Okada H. The biologic role of sex steroid receptors in the decidualization of human endometrium. Asia Oceania J Obstet Gynaecol 1985; 11: Chang HJ, Lee JH, Hwang KJ, Kim MR, Chang KH, Park DW, et al. Transforming growth factor (TGF)-beta1-induced human endometrial stromal cell decidualization through extracellular signal-regulated kinase and Smad activation in vitro: peroxisome proliferator-activated receptor gamma acts as a negative regulator of TGF-beta1. Fertil Steril 2008; 90: Sachdeva G, Patil V, Katkam RR, Manjramkar DD, Kholkute SD, Puri CP. Expression profiles of endometrial leukemia inhibitory factor, transforming growth factor beta2 (TGFbeta2), and TGFbeta2 receptor in infertile bonnet monkeys. Biol Reprod 2001; 65: Kim MR, Park DW, Lee JH, Choi DS, Hwang KJ, Ryu HS, et al. Progesterone-dependent release of transforming growth factor-beta1 from epithelial cells enhances the endometrial decidualization by turning on the Smad signalling in stromal cells. Mol Hum Reprod 2005; 11: Pinsonneault J, Florence B, Vaessin H, McGinnis W. A model for extradenticle function as a switch that changes HOX proteins from repressors to activators. EMBO J 1997; 16: Lemons D, McGinnis W. Genomic evolution of Hox gene clusters. Science 2006; 313: Taylor HS, Vanden Heuvel GB, Igarashi P. A conserved Hox axis in the mouse and human female reproductive system: late establishment and persistent adult expression of the Hoxa cluster genes. Biol Reprod 1997; 57: Taylor HS. The role of HOX genes in human implantation. Hum Reprod Update 2000; 6: Bagot CN, Kliman HJ, Taylor HS. Maternal Hoxa10 is required for pinopod formation in the development of mouse uterine receptivity to embryo implantation. Dev Dyn 2001; 222: Quinn CE, Detmar J, Casper RF. Pinopodes are present in Lif null and Hoxa10 null mice. Fertil Steril 2007; 88: Lynch VJ, Brayer K, Gellersen B, Wagner GP. HoxA-11 and FOXO1A cooperate to regulate decidual prolactin expression: towards inferring the core transcriptional regulators of decidual genes. PLoS One 2009; 4: e Guo X, Wang XF. Signaling cross-talk between TGF-beta/ BMP and other pathways. Cell Res 2009; 19: Satokata I, Benson G, Maas R. Sexually dimorphic sterility phenotypes in Hoxa10-deficient mice. Nature 1995; 374: Gamer LW, Cox KA, Small C, Rosen V. Gdf11 is a negative regulator of chondrogenesis and myogenesis in the developing chick limb. Dev Biol 2001; 229: Fogle RH, Li A, Paulson RJ. Modulation of HOXA10 and other markers of endometrial receptivity by age and human chorionic gonadotropin in an endometrial explant model. Fertil Steril 2010; 93: Kim JJ, Taylor HS, Lu Z, Ladhani O, Hastings JM, Jackson KS, et al. Altered expression of HOXA10 in endometriosis: potential role in decidualization. Mol Hum Reprod 2007; 13: Polakis P. The many ways of Wnt in cancer. Curr Opin Genet Dev 2007; 17: Hayashi K, Erikson DW, Tilford SA, Bany BM, Maclean JA 2nd, Rucker EB 3rd, et al. Wnt genes in the mouse uterus: potential regulation of implantation. Biol Reprod 2009; 80:

10 대한생식의학회지 20. Tulac S, Nayak NR, Kao LC, Van Waes M, Huang J, Lobo S, et al. Identification, characterization, and regulation of the canonical Wnt signaling pathway in human endometrium. J Clin Endocrinol Metab 2003; 88: Li Q, Kannan A, Wang W, Demayo FJ, Taylor RN, Bagchi MK, et al. Bone morphogenetic protein 2 functions via a conserved signaling pathway involving Wnt4 to regulate uterine decidualization in the mouse and the human. J Biol Chem 2007; 282: Han C, Demetris AJ, Liu Y, Shelhamer JH, Wu T. Transforming growth factor-beta (TGF-beta) activates cytosolic phospholipase A2alpha (cpla2alpha)-mediated prostaglandin E2 (PGE)2/ EP1 and peroxisome proliferator-activated receptor-gamma (PPAR-gamma)/Smad signaling pathways in human liver cancer cells. A novel mechanism for subversion of TGFbeta-induced mitoinhibition. J Biol Chem 2004; 279: = 국문초록 = 목적 : Small interfering RNA (sirna) 를이용하여 homeobox (HOXA) 10 유전자의발현이억제된일차배양자궁내막세포를이용하여자궁내막탈락막화 (decidualization) 에 HOXA유전자를포함한세포내신호전달기전을분석하고자하였다. 연구방법 : 본원산부인과에서자궁내막질환이외의이유로전자궁적출술을받은환자의자궁내막조직을채취한다. 37 에서 20분간 Trypsin-EDTA를처리하여단일세포로분리한후 10% fetal bovine serum이첨가된 DMEM/F12 배지를이용하여 24시간동안 37 5% CO 2 배양기안에서배양한다. 배양된자궁내막세포를 HOXA10 sirna로첨가한후 TGF-β1을 10 ng/ml 농도로 48시간첨가하여탈락막화를유도한다. 배양된자궁내막세포에서 reverse transcription polymerase chain reaction을이용하여 HOXA10, prolactin, cyclooxygenase (COX)-2, peroxisome proliferator-activated receptor (PPAR)-γ 및 wingless-type MMTV integration site family (Wnt) 의발현을관찰하였다. 결과 : HOXA10의경우 transforming growth factor (TGF)-β1과 HOXA10 sirna를처리하지않은대조군에비하여 TGF-β1을처리한군에서약 1.8배가량발현양의증가를보였다. 자궁내막탈락막표지인자로알려져있는 prolactin 의경우 TGF-β1을처리한경우대조군에비하여유의한발현의증가를보였으며 HOXA10 sirna를처리한군에있어서는 TGF-β1을첨가하더라도 prolactin mrna의발현양의증가를관찰할수없었다. 또한자궁내막세포의분화인자로알려져있는 COX-2의발현역시 HOXA10 sirna를처리한군에있어서 mrna 발현양이유의하게감소하였으며 TGF-β1을처리하여도발현의증가를관찰할수없었다. Wnt4의경우 HOXA10 sirna를이용하여 HOXA10의발현을억제한경우대조군에비하여유의하게 mrna의발현양이감소하였으며이러한발현양의감소는 TGF-β1을처리하여도증가됨을관찰할수없었다. PPARγ의발현은 HOXA10 sirna의처리와관계없이 TGF-β1에의하여감소하는것을관찰할수있었다. 결론 : Progesterone에의하여자궁내막상피세포에서분비되는것으로알려져있는 TGF-β1에의한자궁내막기질세포의분화 ( 탈락막화 ) 는 HOXA10 및 Wnt에의하여조절되는것으로생각된다. 중심단어 : HOXA, Wnt, 탈락막화, 자궁내막

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

歯 PDF

歯 PDF * * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

Wnt and other signalings

Wnt and other signalings Wnt and other signalings 발생은진화적으로하등동물부터인간까지보전되어있는여러가지 signaling에의해적절한때, 적절한장소에서이들의 target genes의발현을통하여조절되어지는것으로알려져있다. 대표적으로발생동안에중요하다고알려진신호로는 Wnt singaling과 TGF-βs, activins 그리고 BMPs와같이크게세가지 families로나뉠수있는

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

Kaes010.hwp

Kaes010.hwp 갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

Jksvs019(8-15).hwp

Jksvs019(8-15).hwp Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 3~30 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 01. 08 2016. 01. 09 2016. 02. 25 ABSTRACT

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 273~299 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 11 2016. 06. 24 2016. 06. 26 ABSTRACT e-

More information

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세 본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

Microsoft Word doc

Microsoft Word doc KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 93~116 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 12 2016. 06. 20 2016. 06. 26 ABSTRACT e-

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -

농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 - 농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

최근연구소식 Molecular and Cellular Biology News 최근의연구동향을이해할수있도록몇편의논문을요약하여하나의주제로소개합니다. TGF-β 신호전달경로의새로운조절기전 Watanabe Y, Itoh S, Goto T, Ohnishi E, Inamitsu

최근연구소식 Molecular and Cellular Biology News 최근의연구동향을이해할수있도록몇편의논문을요약하여하나의주제로소개합니다. TGF-β 신호전달경로의새로운조절기전 Watanabe Y, Itoh S, Goto T, Ohnishi E, Inamitsu 최근연구동향을이해할수있도록몇편논문을요약하여하나주제로소개합니다 GF- 신호전달경로새로운조절기전 Watanabe Y Itoh S Goto Ohnishi E Inamitsu M Itoh F Satoh K Wiercinska E Yang W Shi L anaka A Nakano N Mommaas AM Shibuya H en Dijke P Kato M 2010) MEPAI

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120: Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

Wnt signaling 과 adipogenesis

Wnt signaling 과 adipogenesis Wnt signaling 과 adipogenesis 지방 조직(adipose tissue)을 이루는 지방세포(adipocyte)는 지방(fat)을 포함하고 있는 세 포로써 체내 지방 대사를 조절 하는 것 뿐 아니라 여러가지 분비물질들을 통하여 식욕 조절 등의 기능을 하는 것이 잘 알려져 있으며 당 대사에도 관여하여 전반적인 에너지 항상성 유 지를 담당하고 또한

More information

Jkbcs032.hwp

Jkbcs032.hwp Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

化學科

化學科 Department of Life Sciences 1 2 3 학과명 전공분야 생명과학세미나 1, 2 생명과학세미나 3, 4 생명과학최신동향 1, 2 과목명학점 ( 시간 ) 코드이수구분 각 1(1) 각 1(1) 각 1(1) LIS901, 902 LIS903, 904 LIS911, 912 기초공통기초공통기초공통 생명과학과 생화학 생화학 1, 2( 영강 ) 고급생화학

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 SI-1304 부처명 기획예산처 연구관리전문기관 산업기술연구회 연구사업명 정부출연 일반사업 연구과제명 생명통합정보시스템 활용 독창적 신약개발협동연구사업 기 여 율 1/1 주관기관 한국화학연구원 연구기간 2013.01.01

이 발명을 지원한 국가연구개발사업 과제고유번호 SI-1304 부처명 기획예산처 연구관리전문기관 산업기술연구회 연구사업명 정부출연 일반사업 연구과제명 생명통합정보시스템 활용 독창적 신약개발협동연구사업 기 여 율 1/1 주관기관 한국화학연구원 연구기간 2013.01.01 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) A61K 31/519 (2006.01) A61K 31/4162 (2006.01) A61P 19/00 (2006.01) A61P 19/10 (2006.01) (21) 출원번호 10-2013-0039066 (22) 출원일자 2013년04월10일 심사청구일자 2013년04월10일

More information

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w 497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

V V V α Azam, M. Z. M. & Park, Dong-Ho (2012). The relationship between Digit Ratio(2D:4D) and Physical Fitness in Children. Journal of Korean Society of Living Environmental System, 19(1), 101-110.

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

<30372EC0CCC0AFC1F82E687770>

<30372EC0CCC0AFC1F82E687770> 산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

Rhinology Korean J Otorhinolaryngol-Head Neck Surg 2017;60(5): / pissn / eissn

Rhinology Korean J Otorhinolaryngol-Head Neck Surg 2017;60(5): / pissn / eissn Rhinology Korean J Otorhinolaryngol-Head Neck Surg 217;6(5):222-31 / pissn 292-5859 / eissn 292-6529 https://doi.org/1.3342/kjorl-hns.216.17594 Asian Sand Dust Up-Regulates Expression in Human Upper Airway

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

<30352EB0A3BAB4B8AE2E687770>

<30352EB0A3BAB4B8AE2E687770> The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

19(1) 02.fm

19(1) 02.fm Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor

More information

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분 세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------

More information

Treatment and Role of Hormaonal Replaement Therapy

Treatment and Role of Hormaonal Replaement Therapy Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

16_이주용_155~163.hwp

16_이주용_155~163.hwp 사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin

More information

歯5-2-13(전미희외).PDF

歯5-2-13(전미희외).PDF The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)

More information

KJOG Vol. 55, No. 12, 2012 내막증이 있는 경우. 골반유착으로 인한 해부학적 변화가 발생할 수 있 으며 이로 인해 난자의 배출 장애가 발생할 수 있다. 또한 복막액내의 interleukin-1, prostaglandin, macrophage, pro

KJOG Vol. 55, No. 12, 2012 내막증이 있는 경우. 골반유착으로 인한 해부학적 변화가 발생할 수 있 으며 이로 인해 난자의 배출 장애가 발생할 수 있다. 또한 복막액내의 interleukin-1, prostaglandin, macrophage, pro ORIGINAL ARTICLE Korean J Obstet Gynecol 2012;55(12):935-939 http://dx.doi.org/10.5468/kjog.2012.55.12.935 pissn 2233-5188 eissn 2233-5196 SERUM ANTI-MÜLLERIAN HORMONE LEVELS IN THE PATIENTS WITH OVARIAN

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770> C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul

More information

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)

전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -

More information

한국 출산력의 저하 요인에 관한 연구

한국 출산력의 저하 요인에 관한 연구 가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001

More information

대한한의학원전학회지26권4호-교정본(1125).hwp

대한한의학원전학회지26권4호-교정본(1125).hwp http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1

More information

Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.

More information

페링야간뇨소책자-내지-16

페링야간뇨소책자-내지-16 야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

278 경찰학연구제 12 권제 3 호 ( 통권제 31 호 )

278 경찰학연구제 12 권제 3 호 ( 통권제 31 호 ) 여성경찰관의직업윤리의식결정요인분석 * An Analysis of Determinantal Factors Influencing Professional Ethical Standards of South Korean Police Women 신문희 ** 이영민 *** Ⅰ. 서론 Ⅱ. 이론적배경 Ⅲ. 연구방법 Ⅳ. 연구결과 Ⅴ. 결론 Ⅰ. 서론 278 경찰학연구제 12

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

Effects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]

More information

550호(01-09)

550호(01-09) T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 8 11 13 24 25 27 29 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

44-4대지.07이영희532~

44-4대지.07이영희532~ A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,

More information

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006; ,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

Study on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information