untitled
|
|
- 수향 길
- 5 years ago
- Views:
Transcription
1 전남의대학술지제 46 권제 3 호 Chonnam Medical Journal Vol. 46, No. 3, pp DOI: /cmj 시스플라틴유발신손상에서신장세뇨관세포자멸사및항산화제의신손상보호효과 전남대학교의과대학내과학교실, 1 생리학교실 배은희ㆍ이종은 1 ㆍ마성권ㆍ김수완 * Effects of Antioxidants in Cisplatin-Induced Renal Tubular Apoptosis Eun Hui Bae, JongUn Lee 1, Seong Kwon Ma and Soo Wan Kim* Departments of Internal Medicine and 1 Physiology, Chonnam National University Medical School, Gwangju, Korea The present study was designed to evaluate the possible renoprotective effects of alpha-lipoic acid (α- LA) in cisplatin-induced nephropathy and its role in inflammation and apoptosis in the kidney. Male Sprague-Dawley rats, weighing 180~200 g, were used. One group of rats was injected with cisplatin (6 mg/kg intraperitoneally). Another group of rats was injected with cisplatin and co-treated with α-la. Rats that received an injection of vehicle only served as controls. Four days later, the mrna expression of Bax and Bcl-2 was determined by real-time PCR. The protein expression of ED-1, cyclooxygenase-2 (COX2), heat shock protein 72 (HSP72), Bax, and Bcl-2 was determined in the kidney by immunoblotting. Apoptosis was determined by TUNEL staining. Cisplatin-treated rats had decreased creatinine clearance and increased plasma creatinine levels compared with controls. α-la treatment lowered plasma creatinine levels and increased creatinine clearance. In cisplatin-treated rats, the mrna expression of Bcl-2 was decreased, which was attenuated by α-la treatment. The protein expression of ED-1, COX 2, HSP72, cleaved caspase-3, and Bax in the kidney was increased compared with controls, whereas that of Bcl-2 was decreased, and these changes were counteracted by α-la treatment. TUNEL-positive cells were increased, in association with an increased protein expression of Bax and cleaved caspase-3 in the kidney of cisplatin-induced nephropathy, which was counteracted by α-la treatment. These findings suggest that α-la is effective in preventing the progression of cisplatin-induced nephropathy, the mechanism of which is associated with anti-inflammation and anti-apoptotic effects. Key Words: Oxidative stress; Cisplatin; Apoptosis; Inflammation 접수일 : 2010 년 11 월 7 일, 게재결정 : 2010 년 11 월 16 일 * 교신저자 : 김수완, , 전남대학교의과대학내과학교실, Phone: , FAX: , skimw@chonnam.ac.kr 156
2 배은희외 3 인 : Effects of Antioxidant on Cisplatin Induced Nephropathy 157 서론시스플라틴은무기플래티넘 (inorganic platinum) 복합체로고형종양의치료에효과적인약제로광범위하게사용되어지고있다. 1-3 하지만시스플라틴은신장에서고농도로농축되어근위세뇨관세포의괴사를유발하고, 원위세관의세포자멸사를유발하는것으로알려져있다. 4 시스플라틴유발신독성은사구체여과율감소, 신장세뇨관괴사및세포자멸사를특징으로한다. 5 시스플라틴유발신독성의발생기전으로는약제자체의신세뇨관독성과신장혈관수축에의한혈역학적인변화에의한다고알려져있으며혈관수축의발생은산화질소와같은혈관확장인자와 endothelin 등의혈관수축인자의불균형에의할것으로생각된다. 6 그러므로이러한혈관수축 / 확장과관련된기전을차단하는물질의투여에의해시스플라틴유발신독성의발생을억제한다는동물실험을기초로하여임상적으로도시스플라틴유발신독성예방에사용하여연구되었으나실제로이러한예방효과가입증되지못하였다. 7 이러한 in vitro, in vivo 연구결과의불일치는시스플라틴유발신독성의병인기전이서로다른여러가지기전이복합되어작용하기때문으로생각되며이러한병인기전을완벽히규명하지못하였기때문이다. 신장세뇨관세포의염증반응과세포자멸사는시스플라틴유발신독성에서신장손상및이로인한사구체여과율감소의주요원인기전이다. 7 세포자멸사는크게내인성 ( 미토콘드리아매개성 ), 외인성 ( 수용체매개성 ) 및 caspase 비의존형기전으로나타난다. 그중내인성기전은미토콘드리아에서 cytochrome C가유리되는데이것은세포자멸사를촉진하는단백질인 Bax와억제하는단백질인 Bcl-2에의해서조절된다. 유리된 cytochrome C는 caspase 9을활성화하고이것이 caspase 3을활성화하여세포자멸사를초래한다. 8 Alpha-lipoic acid (α-la) 는 thiol 계항산화제화합물로서당뇨병으로인한혈관내피세포장애와신경내혈류를개선, 산화스트레스감소를통해당뇨병성말초신경병을개선시킨다고보고되고있다. 9 또한핵내전사인자 (NF-κB) 발현을억제하여경동맥손상흰쥐모델에서신생혈관증식을억제하였고, 10 패혈증흰쥐모델에서도내피세포에서 fractalkine 발현을억제하여염증반응을완화시키는효과가있는것으로보고되고있다. 11 기존의연구에의하면시스플라틴흰쥐에항산화제로잘알려진 N-acetyl cystein을투여한경우강력한신혈관수축물질로알려진 isoprostane 증가가감약되어신독성을예방함이보고되었다. 12 이처럼신독성모델에서항산화제치료가예방효 과의가능성이있음이제시되고있고, α-la가최근동물및임상에서다양한질환에효과가보고되고있으나시스플라틴유발신독성에서 α-la의치료효과및이의원인기전은확립되어있지않다. 본연구는시스플라틴신독성에서항산화제치료후신독성의회복여부와신장세뇨관세포자멸사가회복되는지를알아보고자하였다. 대상및방법 1. 실험동물실험동물은체중 g의 Sprgue-Dawley 숫쥐를사용하였다. 전체실험과정은전남대학교의과대학실험동물사용윤리규정에관한지침을준수하였다. 시스플라틴신독성을유발하기위하여복강내로시스플라틴 6 mg/kg를주사하였다. 항산화제 (α-la) 는 50 mg/kg로연속 4일간하루 1번복강내주사하였다. 정상대조군은생리식염수를복강내로주사하였다. 시스플라틴주입후 4일째에실험에이용하였다. 실험시작 3일전실험쥐들을대사상자 (metabolic cage) 에 3일간적응시킨후실험을시작하였다. 실험군 (n=7) 은 24 시간동안먹이섭취를박탈하였으나, 물의섭취는제한하지않았다. 대조군 (n=7) 은같은시간동안먹이와물을자유롭게공급한후실험에사용하였다. 2. 신기능측정동물을대사상자에넣고유지하면서매일소변을채집하였으며, 요량, 크레아티닌을측정하였다. 실험당일날 pentobarbital (50 mg/kg, i.p.) 마취하에개복후 5 ml 주사기를이용하여대정맥에서혈액을채취하여혈청크레아티닌을측정하였다. 크레아티닌농도는 Jaffe법 (Olympus 5431, Olympus Optical Co. Ltd., Tokyo, Japan) 으로측정하였다. 3. Real-time polymerase chain reaction (PCR) 신장피질조직에 Trizol reagent (Invitrogen, Carlsbad, CA, USA) 를첨가하여균질화하였다. 여기에 chloroform을첨가하여 RNA를추출하고, isopropanol을첨가하여침전시켰다. RNA 침전물은 75% ethanol로세척한후증류수로희석하였다. 분리된 RNA의농도는 260 mm에서측정된 optical density 값을이용하여정량화하였다. cdna는총 RNA 5 μg을 oligo (dt) priming과 superscript reverse transcriptase
3 158 전남의대학술지제 46 권제 3 호 2010 II (Invitrogen, Carlsbad, CA, USA) 를이용하여역전사시켜서만들었으며, Smart Cycler II system (Cepheid, Sunnyvale, CA, USA) 을이용하여증폭시키고, SYBR Green으로확인하였다. 각각의 PCR 반응은 10 μm forward primer, 10 μm reverse primer, 2 SYBR Green Premix Ex Taq (Takara Bio Inc., Shiga, Japan), 0.5 μl cdna와멸균증류수를포함하는최종 20 μl의혼합물로시행하였으며, PCR Rotor-Gene TM 3000 Detecter System (Corbette Research, Mortlake, New South Wales, Australia) 를사용하였다. 실험에사용한 primer 는 Bax (sense: AGGATGGCTGGGGAGACACCTG, antisense: CATGGGCTGGACACTGGACTTC) 와 Bcl-2 (sense: CGGGAGATCGTGATGAGGTACATC, antisense: AC AACATCGCTCTGTGGATGACTG) 이다. PCR 반응후에는얻어진결과는 Corbett Research Software을이용하여분석하였다 단백분리및 Western blot 분석신장조직을 250 mmol/l sucrose, 1 mmol/l EDTA, 0.1 mm phenylmethylsulfonyl fluoride (PMSF) 와 10 mm Tris-HCl buffer가함유된 ph 7.6 용액에넣고 3,000 rpm으로균질화하였다. 큰조직조각과핵질파편을 1,000 xg, 15분저속회전으로제거하였다. 단백표본은 12.5% polyacrylamide resolving gel과 5% polyacrylamide stacking gel로구성된불연속계에서전기영동하여크기에따라분리하였다. 분리된단백은 40 V로 3시간동안전기영동법으로 nitrocellulose 막으로이동시켰다. 막을 0.1% Tween-20을함유한 Tris-based saline buffer [TBST (Amresco, Solon, OH, USA), ph 7.4] 로세척한후비특이적결합을방지하기위해 5% 탈지분유 (NFM) 를포함한 TBST (NFM/TBST) 에서 1 시간동안반응시켰다. Nitrocellulose 막을다시 0.2% NFM/TBST 용액에넣고 1차항체 (ED-1& HSP 72): Santa Cruz Ciotechmology, Santa Cruz, CA, USA; COX2: Cayman Chemical Company, MI, USA, Bax and Bcl-2: Cell Signaling Techmology, Beverly, MA, USA) 를첨가하여밤동안 4 o C에서반응시켰다. 발광체를붙이기위해막을 2% NFM/TBST 용액에넣고 2차항체 [horseradish peroxidase-labeled goat anti-mouse IgG (1:1,000)] 를첨가하여 1시간동안반응시켰다. 고정된항체는 enhanced chemiluminescence [ECL (Amersham Pharmacia Biotech, Little Chalfont, UK)] 반응시켜 Image Reader (LAS-3000 Imaging System, Fuji Photo Film, Tokyo, Japan) 로분석하였다. 5. TUNEL stain 백서를실험당일에 pentobarbital (50 mg/kg, i.p.) 마취하에복부를중앙절개한뒤대동맥과하대정맥을노출시킨다. 신동맥상하대동맥을 clamp하고하대정맥을박리하고 phosphate buffered saline (PBS) 을대동맥을통하여역행성으로관류함으로써 5마리씩각군백서를고정한다. 신장을제거하고 formalin에두시간고정하고 paraffin에 embed한다. 조직을 xylene으로 5분씩 3번씻어내고 absolute ethanol로 5분간 2번 95% ethanol로 3분간 1번, 70% ethanol로 3분간 1번 PBS로 5분간 1번세척하였다. Proteinase K (proteinase K, Dako) 로실온에서 15분간전처치후에 3% hydrogen peroxide in PBS에 5분간씻어냈다. Equilibration buffer를슬라이드에투입하고 terminal deoxynucleotidyl transferase와함께 37 o C 에서 1시간배양하였다. 이후실온에서 anti-digoxigenin peroxide conjugate에 30분간처리한뒤 peroxidase substrate 를충분히슬라이드에공급하고 haematoxylin에 10분간대조염색을실시하였다. Apoptosis는 Apoptag plus peroxidase in situ apoptosis detection kit (Chemicon International, Temecula, USA) 를이용하여측정하였다. 6. 통계처리실험결과는평균 ± 표준오차로표시하였으며, 실험군간차이에대한통계적유의성분석은 ANOVA 또는비쌍체 t-검정법을사용하였다. 결과 1. 신장의기능시스플라틴단독투여군에서혈청크레아티닌의상승과사구체여과율의감소를보였으며, 이는 α-la 투여로호전되었다 (Fig. 1). 2. 염증계의단백발현변화세포염증반응시증가한다고알려져있는 ED-1, COX2, HSP72의단백발현이시스플라틴단독투여군에서현저히증가되었으며이는 α-la 투여로호전되었다 (Fig. 2). 3. 세포자멸사계의 real-time PCR발현변화세포자멸사를조장한다고알려진 Bax의 mrna의발현
4 배은희외 3 인 : Effects of Antioxidant on Cisplatin Induced Nephropathy 159 Fig. 1. Effects of alpha lipoic acid (α-la) on serum creatinine level and creatinine clearance. *p<0.05 compared with control. p<0.05 compared with cisplatin-treated rats. Fig. 2. Effects of alpha lipoic acid (α-la) on the protein expression of ED-1, COX2 and HSP70 in the kidney. *p<0.05 compared with control. p<0.05 compared with cisplatin-treated rats. 이시스플라틴단독투여군에서증가, α-la 투여로호전되는경향을보였으나통계학적의의는없었다. 그러나 Bcl-2의 mrna의발현은시스플라틴단독투여군에서감소, α-la 투여로호전되었다 (Fig. 3). 4. 세포자멸사계의단백발현변화 Bax와 cleaved caspase 3 단백발현이시스플라틴단독투여군에서증가, α-la 투여로호전되었다. 세포자멸사를 억제한다고알려진 Bcl-2의단백발현은시스플라틴단독투여군에서감소하는경향을보였으나통계적으로의의는없었고, α-la 투여로호전되었다 (Fig. 4). 5. TUNEL 염색시스플라틴단독투여군의신피질에서 TUNEL 양성세포가증가된것을관찰할수있었으며, α-la 투여는이러한 TUNEL 염색반응정도를감약시켰다 (Fig. 5).
5 160 전남의대학술지제 46 권제 3 호 2010 Fig. 3. Effects of alpha lipoic acid (α-la) on mrna expression of Bax and Bcl-2 in the kidney. *p<0.05 compared with control. p<0.05 compared with cisplatin-treated rats. Fig. 4. Effects of alpha lipoic acid (α-la) on the protein expression of Bax, Bcl-2 and cleaved caspase 3 in the kidney. *p<0.05 compared with control. p<0.05 compared with cisplatin-treated rats. 고찰시스플라틴유발신독성에서신기능장애및사구체여과율감소의병인으로산화스트레스의증가, 14 염증반응활성화 15 및이로인한신장세뇨관세포손상및세포자멸사가 16 중요한역할을함이알려져있다. 시스플라틴유발신독성에서는다양한염증유발성싸이토카인및케모카인들이유도된다. 이러한염증반응은신조직손상및신기능저하를 일으키는것으로알려져있는데, 시스플라틴유발신독성에서는특히 tumor necrosis factor (TNF)-α가염증반응을일으키는주요매개물로연구되고있다. 17 대부분의연구들에서 TNF-α의활성화를억제시키는경우시스플라틴유발신독성이감소하는것으로나타났다. 18,19 그러나시스플라틴유발신독성에서 TNF-α가유도되는기전및이에따른염증반응의증가에의해신독성이일어나는기저기전에대해서는아직까지연구가진행되고있다. 또한 cisplatin
6 배은희외 3 인 : Effects of Antioxidant on Cisplatin Induced Nephropathy 161 Fig. 5. Apoptosis evaluated by TUNEL staining in the kidney sections from different groups of rats. The dark brown dots represent TUNELpositive nuclei. G: glomerulus. 유발신독성에서 TNF-α 외에다른염증관련싸이토카인들의역할은아직규명되지않았다. 최근들어시스플라틴유발신독성의진행에다른면역성신증의경우와마찬가지로대식세포의침윤및이로인한염증반응이중요한병리기전인것으로보고되고있다. 20 신조직내로유입된대식세포는 TNF-α와같은염증성 chemokine과 cytokine의합성을촉진하고, 단백분해효소를분비하여세뇨관세포들을활성화시킨다. 활성화된세포들이다시염증성매개체를분비하여그결과신손상이더욱악화된다. 본연구에서도대식세포의표지자인 ED-1이 cisplatin에서증가, α-la 투여로호전되었다. 또한염증표지자인 COX2, HSP72의단백발현이시스플라틴단독투여군에서현저히증가되었으며, 이는 α-la 투여로호전되었다. 신손상염증반응에중요한역할을한다고잘알려진 COX2 뿐만아니라, HSP도여러스트레스한상황에서유도되며고혈압을포함한다양한질환의병태생리에관여하는것으로알려져있다. 21 HSP는 HSP25, HSP32, HSP 72에대한연구가많이진행되고있는데, HSP70은다양한스트레스상황에서방어역할은하는것으로알려져있다. 또한, HSP70을과발현시킨신세포에시스플라틴처리했을때신세포손상이억제된다는기존보고 22 가있어본연구에서시스플라틴군에서증가한 HSP72은신손상을보호하기위해증가했을것으로생각된다. 이러한사실은 α-la가시스플라틴에의해유발된신장세뇨관염증반응을완화시키고이로인한신장손상을차단할수있음을시사한다. 세포자멸사는염증반응과같은병적인원인에의해발생하기도하고정상적인세포의성장과정에서일어날수도있다. 세포자멸사가발생하면세포질의크기가축소되고핵의염색질의응축이일어나 apoptic body를생성하게된다. 세 포자멸사는 DNA fragmentation이나 TUNEL 염색으로확인할수있는데, 많은연구자들에서세포자멸사가시스플라틴신독성의원인이된다는것이밝혀졌다. 5,7 본연구에서시스플라틴유발신독성흰쥐신장세뇨관에서 TUNEL 양성세포가유의하게증가하였으며, α-la 치료는이러한 TUNEL 염색반응정도를감약시켰다. 따라서시스플라틴유발신독성병인에신장세뇨관세포자멸사가관여하며, α-la에의한신기능개선효과는세포자멸사감소에기인할것으로보인다. Bcl-2 계열의유전자들은여러가지자극에의해세포자멸사를조절하는단백질을만드는데, 이단백질중 Bcl-2와 Bcl-xl은세포자멸사를억제하고 Bax는세포자멸사를조장하는것으로알려져있다. 23 따라서이런단백질의발현여부에따라신장세뇨관세포들이자멸하거나살아남게된다. Bcl-2는세포내의여러기관에존재하는 26 kda의막단백질로서여러종류의유해자극으로부터세포의손상을방지하는역할을한다고알려져있다. 24,25 비록정확한기전은모르지만 Bcl-2는 endoplasmic reticulum (ER) 에서비정상적인칼슘유리를방해하여세포자멸사를억제하는것으로알려져있다. 26 Bax는 21 kda의막단백질로서 ER에서칼슘을배출시켜 ER의칼슘을고갈시키고미토콘드리아의칼슘섭취를조장시켜세포자멸사를조장한다. 27 본연구에서시스플라틴유발신독성에서 Bax 단백발현은유의하게증가하였으며, Bcl-2 발현은감소하였다. 시스플라틴유발신손상이발생하면 cytochrome-c가유리되고이것이 apoptosis activating factor (apaf-1) 와 procaspase 9과결합하여 apoptosome을형성한다. 이것이 caspase 9을활성화시키고활성화된 caspase 9가 caspase 3를활성화시킨다. 7 본연구에서또한 α-la 치료는시스플라틴유발신독성에서 Bax
7 162 전남의대학술지제 46 권제 3 호 2010 발현증가및 Bcl-2 발현감소를회복시켰으며, caspase 3발현증가역시회복시켰다. 이러한효과는시스플라틴유발신독성에서보이는세포자멸사회복의중요한원인기전으로보인다. 이상의결과시스플라틴유발신손상은항산화제인 α- LA에의해회복되었으며그원인기전에는항염증반응및세포자멸사억제효과에기인하는것으로보인다. 알 이논문은전남대학교병원임상의학연구소학술연구비 (CRI ) 에의하여연구되었음. 림 References 1. Einhorn LH, Williams SD. The role of cis-platinum in solid-tumor therapy. N Engl J Med 1979;300: Einhorn LH, Donohue J. Cis-diamminedichloroplatinum, vinblastine, and bleomycin combination chemotherapy in disseminated testicular cancer. Ann Intern Med 1977;87: Rozencweig M, von Hoff DD, Slavik M, Muggia FM. Cisdiamminedichloroplatinum (II). A new anticancer drug. Ann Intern Med 1977;86: Arany I, Safirstein RL. Cisplatin nephrotoxicity. Semin Nephrol 2003; 23: Kim SW, Lee JU, Nah MY, Kang DG, Ahn KY, Lee HS, et al. Cisplatin decreases the abundance of aquaporin water channels in rat kidney. J Am Soc Nephrol 2001;12: Li Q, Bowmer CJ, Yates MS. Effect of arginine on cisplatin-induced acute renal failure in the rat. Biochem Pharmacol 1994;47: Pabla N, Dong Z. Cisplatin nephrotoxicity: mechanisms and renoprotective strategies. Kidney Int 2008;73: Pabla N, Dong Z. Cisplatin nephrotoxicity: mechanisms and renoprotective strategies. Kidney Int 2008;73: El Midaoui A, de Champlain J. Prevention of hypertension, insulin resistance, and oxidative stress by alpha-lipoic acid. Hypertension 2002;39: Lee KM, Park KG, Kim YD, Lee HJ, Kim HT, Cho WH, et al. Alpha-lipoic acid inhibits fractalkine expression and prevents neointimal hyperplasia after balloon injury in rat carotid artery. Atherosclerosis 2006;189: Sung MJ, Kim W, Ahn SY, Cho CH, Koh GY, Moon SO, et al. Protective effect of alpha-lipoic acid in lipopolysaccharide-induced endothelial fractalkine expression. Circ Res 2005;97: Salahudeen A, Poovala V, Parry W, Pande R, Kanji V, Ansari N, et al. Cisplatin induces N-acetyl cysteine suppressible F2-isoprostane production and injury in renal tubular epithelial cells. J Am Soc Nephrol 1998;9: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25: Davis CA, Nick HS, Agarwal A. Manganese superoxide dismutase attenuates Cisplatin-induced renal injury: importance of superoxide. J Am Soc Nephrol 2001;12: Faubel S, Lewis EC, Reznikov L, Ljubanovic D, Hoke TS, Somerset H, et al. Cisplatin-induced acute renal failure is associated with an increase in the cytokines interleukin (IL)-1beta, IL-18, IL-6, and neutrophil infiltration in the kidney. J Pharmacol Exp Ther 2007;322: Kaushal GP, Kaushal V, Hong X, Shah SV. Role and regulation of activation of caspases in cisplatin-induced injury to renal tubular epithelial cells. Kidney Int 2001;60: Wang J, Wei Q, Wang CY, Hill WD, Hess DC, Dong Z. Minocycline up-regulates Bcl-2 and protects against cell death in mitochondria. J Biol Chem 2004;279: Bhatt K, Feng L, Pabla N, Liu K, Smith S, Dong Z. Effects of targeted Bcl-2 expression in mitochondria or endoplasmic reticulum on renal tubular cell apoptosis. Am J Physiol Renal Physiol 2008;294: F He H, Lam M, McCormick TS, Distelhorst CW. Maintenance of calcium homeostasis in the endoplasmic reticulum by Bcl-2. J Cell Biol 1997;138: Lithgow T, van Driel R, Bertram JF, Strasser A. The protein product of the oncogene bcl-2 is a component of the nuclear envelope, the endoplasmic reticulum, and the outer mitochondrial membrane. Cell Growth Differ 1994;5: Hamet P, Malo D, Tremblay J. Increased transcription of a major stress gene in spontaneously hypertensive mice. Hypertension 1990;15: Komatsuda A, Wakui H, Oyama Y, Imai H, Miura AB, Itoh H, et al. Overexpression of the human 72 kda heat shock protein in renal tubular cells confers resistance against oxidative injury and cisplatin toxicity. Nephrol Dial Transplant 1999;14: Ramesh G, Reeves WB. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 2002;110: Ramesh G, Brian Reeves W. Cisplatin increases TNF-alpha mrna stability in kidney proximal tubule cells. Ren Fail 2006;28: Zhang B, Ramesh G, Norbury CC, Reeves WB. Cisplatin-induced nephrotoxicity is mediated by tumor necrosis factor-alpha produced by renal parenchymal cells. Kidney Int 2007;72: Yamate J, Tatsumi M, Nakatsuji S, Kuwamura M, Kotani T, Sakuma S. Immunohistochemical observations on the kinetics of macrophages and myofibroblasts in rat renal interstitial fibrosis induced by cisdiamminedichloroplatinum. J Comp Pathol 1995;112: Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998;281:
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information2000 년도산학협동연구비 Korean Circulation J 2002;32 12 : 생쥐의 Adriamycin 유발심근증모델에서 IGF-1 의 심근보호효과 박철수 윤호중 조은주 오용석 백상홍 이정화강진형 정욱성 채장성 김재형 최규보 홍순조 Cardi
2000 년도산학협동연구비 Korean Circulation J 2002;3212:1116-1123 생쥐의 Adriamycin 유발심근증모델에서 IGF-1 의 심근보호효과 박철수 윤호중 조은주 오용석 백상홍 이정화강진형 정욱성 채장성 김재형 최규보 홍순조 Cardioprotective Effect of IGF-1 in Mouse with Adriamycin
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationuntitled
Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationAging Tissue Bank κ κ κ κ (9 월호에계속...) 2
소식지 주소 : 부산광역시금정구장전동산30번지부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.agingbank.or.kr http://aging.pharm.pusan.ac.kr/ Content 6 월호 알기쉬운노화의기초지식
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information(Microsoft PowerPoint - S13-3_\261\350\273\363\307\366 [\310\243\310\257 \270\360\265\345])
Cardiovascular Disease in Metabolic Syndrome 김상현 보라매병원내과 서울대학교의과대학내과학교실 Contents Metabolic syndrome and Cardiovascular system CVD Mortality Coronary artery disease Heart failure Atrial fibrillation Management
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationTreatment and Role of Hormaonal Replaement Therapy
Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal
More informationNo Slide Title
Antioxidant effect of Estrogen on Bovine aortic endothelial cells 가톨릭대학교의과대학서울성모병원산부인과김미란 Journal of Steroid Biochemistry and Molecular Biology 117 (2009) 74-80 Background Objectives Materials & Methods
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationPowerPoint 프레젠테이션
Apr. 30. 2016. GBCC in JeJu Island Sensitization of breast cancer cells to chemotherapeutic drugs by metabolic regulation InChul Park, Ph. D. Korea Institute of Radiological & Medical Sciences (KIRAMS)
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information077~088 해계 유침과 전침이
loperamide 77 DOI : 10.3831/KPI.2009.12.4.077 loperamide Received : 09. 10. 21 Accepted : 09. 11. 04 The Effect of Acupuncture and Electro-acupuncture at ST41 on Intestinal Hypomotility Induced with Loperamide
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information<30322EBABBB9AE2E687770>
대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서
More informationuntitled
- 345 - - 346 - - 347 - - 348 - - 349 - - 350 - - 351 - - 352 - - 353 - - 354 - - 355 - - 356 - - 357 - - 358 - - 359 - - 360 - - 361 - 샘플발광억제율 샘플함량단위활성혈액샘플희석율표준품 실측샘플발광억제 샘플희석배율 비교활성 단위활성 혈액혈액 - 362 -
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 31(1): 52-57 (2016) http://dx.doi.org/10.7841/ksbbj.2016.31.1.52 ISSN 1225-7117 / eissn 2288-8268 연구논문 돌연변이 p53 단백질의 Silencing 에의한사람유방암세포의 in
More informationuntitled
NA-1700 ,, (compulsive use) (craving). (tolerance), ( ). , (,, ) ( ). (,, ) heroine MDMA alcohol morphine amphetamine cocaine caffeine nicotine LSD marijuana diazepam Methamphetamine ( ).. methamphetamine
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information<BFF8C0FA D B8B6BCBAB1C72E687770>
대한내과학회지 : 제 78 권제 4 호 2010 원저 09-290 신혈관성고혈압흰쥐신장에서 Na, K-ATPase 단백발현감소 전남대학교의과대학 1 내과학교실, 2 생리학교실 마성권 1 오윤화 2 김인진 2 배은희 1 이종은 2 김수완 1 Decreased expression of Na,K-ATPase in the kidneys of rats with two-kidney,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More informationChapter 11 Rate of Reaction
Chapter 11 Rate of Reaction 11 11.1 ? Rate Law Kinetics : 11 11.2 CO(g) + NO 2 (g) CO 2 (g) + NO(g) E a =134 kj CO(g) + NO 2 (g) H = -226 kj CO 2 (g) + NO(g) 11 11.3 N 2 O 5 (g) 2NO 2 (g) + 1/2 O 2 (g)
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationMay 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr
May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information<494352503131335FC1F8B9E6B1B3C0B02E687770>
ICRP 간행물 113 진단 및 중재 절차를 위한 방사선방호 교육훈련 Education and Training in Radiological Protection for Diagnostic and Interventional Procedures 대한방사선방어학회 이 번역본 발간은 2011년도 원자력안전위원회 방사선안전기술 개 발사업 과제 지원(한국동위원소협회로 부터
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More information<BCF6C1A42DB3EBC8ADC1B6C1F7C0BAC7E0BCD2BDC4C1F62033BFF92E687770>
소식지 주소 : 부산광역시금정구장전동산 30 번지부산대학교약학대학약학연구동 435 호 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.agingbank.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More informationfm
大韓獸醫學會誌 (2014) 第 54 卷第 4 號 Korean J Vet Res(2014) 54(4) : 225~231 http://dx.doi.org/10.14405/kjvr.2014.54.4.225 < 원례보저 > Cisplatin 유도급성신부전에서 Klotho 단백질의발현 박소라 김태원 김영중 김현태 류시윤 정주영 * 충남대학교수의과대학 ( 접수 : 2014년
More information00....
Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /
More information11 (JLS_140100).hwp
Journal of Life Science 2014 Vol. 24. No. 7. 777~783 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2014.24.7.777 세포는대사과정에서활성산소종 을생성한다 는세포의주요구성물질인단백질 지 질및 등에산화적손상을초래하여세포의손상
More informationDisclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,.
PanGen Biotech Inc. INVESTOR RELATIONS 2015 Disclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,. Pangen BIOTECH INVESTOR RELATIONS 2015 Prologue Chapter 01. Chapter 02., Chapter 03.,
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More information<B0C7C3E0C1F6B8EDBFF82DB3BBC1F E30342E DC3D6C1BE2E706466>
Ministry of Trade, Industry and Energy Public Procurement Service Excellent Product NSF International Internationnal Standards Worldwide American Water Works Association U.S. Department of Defense ISO9001
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More informationChapter 14
5 주 Gycoysis 5.1 Gycoysis의일반적특징 Gycoysis - Gucose가 degradation 과정을거쳐두개의 pyruvate를형성하는과정. - 이때발생하는 free energy는 ATP와 NADH로보존됨. - Gucose 2 Pyruvate - ADP phosphoryation을통하여, ATP 형성 - NAD + 로 hydride ion
More information전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information1611-01제호
발 행 인 : 안 성 모 편 집 인 : 이 원 균 대한치과의사협회 발행 홈페이지:www.kda.or.kr 주2회발행(월 목) 2008년 1월 21일 (월) 1966년 12월 15일 창간 The Korean Dental Association News 제1611호 구강보건정책관 설치 추진위 출범 알 림 범치과계 단체장 참여 첫 회의 치과 의료계 전담부서인 보건
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More informationMicrosoft PowerPoint - 김미영
암세포의위험한여행 한국과학기술원 김미영 강의개요 전이란무엇인가? 전이는어떤과정을통해진행될까? 전이예측방법은어떤것들이있을까? Cancer ( 악성종양 ) US South Korea 질병사망률질병사망률 1. 심장병 26% 1. Cancer 26.7% 2. Cancer 23% 2. 뇌출혈 12.7% 3. 뇌출혈 5.6% 3. 심장병 7.9% >20,000 환자가악성종양에의해매일사망함
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More informationÆ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More information