untitled

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "untitled"

Transcription

1 Korean J Hematol Vol. 43, No. 1, March, 2008 Original Article 직접염기서열분석법을이용한한국인 Lewis 혈액형군의유전자분석 강원대학교의과대학내과학교실, 1 진단검사의학교실, 2 경원대학교가천바이오나노연구원, 3 고려대학교의과대학진단검사의학교실, 4 ( 주 ) 대한임상의학센터, 5 강원대학교의과학연구소 송서영ㆍ안성수 2 ㆍ유숙원 1,4,5 ㆍ김장수 3 ㆍ서인범 1,4,5 Evaluation of the Genotypes of the Lewis Blood Group in a Korean Population Using Direct Sequencing Seo Young Song, M.D., Seong Soo An, M.D., Ph.D. 2, Sook Won Ryu, M.D. 1,4,5, Jang Soo Kim, M.D. 3 and In Bum Suh, M.D. 1,4,5 Departments of Internal Medicine and 1 Laboratory Medicine, College of Medicine, Kangwon National University, Chuncheon, 2 Gachon Bionano Research Institute, Kyungwon University, Seongnam, 3 Department of Laboratory Medicine, College of Medicine, Korea University, Seoul, 4 Korea Clinical Medicine Center, 5 Institute of Medical Science, Kangwon National University, Chuncheon, Korea Background: The FUT2 and FUT3 genes determine the Lewis phenotype of red blood cells (RBCs). Recently, the Lewis genes, the secretor genes, and several mutations that cause Lewis negative and nonsecretor phenotypes have been identified. The purpose of this study was to analyze the gene frequency of FUT2 and FUT3 in a Korean population by comparing the use of the direct sequencing method to the use of the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method for mutation detection in the FUT2 and FUT3 genes. Methods: RBCs and peripheral blood leukocytes were obtained from 225 apparently healthy volunteers to determine the phenotype and genotype of the FUT2 and FUT3 genes. Lewis phenotypes were determined on K 3 EDTA-stablized fresh blood samples using the column agglutination method. Lewis blood group genotyping was performed by use of the direct sequencing method. For the detection of T59G, C357T, and A385T mutations, the PCR-RFLP method was performed. Results: The frequencies of the Lewis blood group phenotype were 12.4% for Le(a+b ), 70.7% for Le(a b+), 11.1% for Le(a b ) and 5.8% for Le(a+b+), respectively. Direct Sequencing of the FUT2 gene identified 92.2% C357T, 56.9% A385T, 0.4% G244A mutations and 1.8% del396. Direct Sequencing of the FUT3 gene identified 46.9% T59G, 30.4% G508A, 1.1% T202C, 1.1% C314T, 0.7% A1029G, 3.0% T1067A and 13.3% G1242A mutations. The PCR-RFLP method results were discordant in nine cases (1 case for C357T, 4 cases for A385T and 2 cases for T59G) as compared to the direct sequencing method results. Conclusion: We have determined the frequencies of FUT2 and FUT3 gene mutations in a Korean population. The use of the direct sequencing method was more accurate than the use of the PCR-RFLP method for the determination of the genotype of the FUT2 and FUT3 genes. (Korean J Hematol 2008;43:34-42.) Key Words: FUT2 gene, FUT3 gene, Lewis blood group, Phenotype, Genotype, Direct sequencing, PCR-RFLP 접수 :2007 년 10 월 24 일, 수정 :2008 년 2 월 28 일승인 :2008 년 3 월 5 일교신저자 : 서인범, 강원도춘천시효자 2 동 , 강원대학교의과대학진단검사의학교실 Tel: , Fax: bloodmd@kangwon.ac.kr 이논문은 2003 년도정부재원 ( 교육인적자원부학술연구조성사업비 ) 으로한국학술진흥재단의지원을받아연구되었음 (KRF E00119). 34 Correspondence to:in Bum Suh, M.D. Department of Laboratory Medicine, College of Medicine, Kangwon National University 192-1, Hyoja 2-dong, Chuncheon , Korea Tel: , Fax: bloodmd@kangwon.ac.kr

2 송서영외 : 한국인 Lewis 혈액형군의유전자분석 35 서 Lewis 혈액형군은 Le a 와 Le b 항원을갖고있으며타액과혈장에도존재하고혈장으로부터항원을흡수하여그표현형을획득하며적혈구외의조직에도발현하는특징을갖고있다. 1) Lewis 항원은 19p13.31 염색체에존재하는 FUT2와 FUT3 유전자에의해형성된 α(1,3/1,4)fucosyltransferase (Lewis 효소 ) 와 α(1,2)fucosyltransferase (Secretory 효소 ) 의작용에의해생성된다. 2) Lewis 혈액형군의표현형은 FUT2와 FUT3 유전자의조합에의해결정되는데, Le b 항원은 FUT2 유전자에암호화된 Secretory 효소와 FUT3 유전자에암호화된 Lewis 효소의작용에의해생성되며, Le a 항원은단지 Lewis 효소의작용에의해서만생성된다. Secretory 효소는 ABO(H) 혈액형군및 Lewis 혈액형군의항원을타액, 혈장및체액등에분비하는역할을한다. 3,4) FUT2 유전자와 FUT3 유전자가모두발현되는경우에는 Le a 항원과 Le b 항원을모두생성하지만 Le a 항원보다 Le b 항원이적혈구표면에더선택적으로흡착되기때문에 Le(a b+) 로표현되고, FUT3 유전자만발현되고 FUT2 유전자의발현이없는경우에는 Le a 항원만이생성되어 Le(a+b ) 의적혈구표현형을갖게된다. FUT3 유전자가발현되지않으면 FUT2 유전자에관계없이 Le(a b ) 의표현형이된다. 2) 최근 FUT2와 FUT3 유전자의염기서열이알려지고추가적변이부위가밝혀지면서 5-8) 중합효소연쇄반응- 제한효소절편다형성분석법 (polymerase chain reactionrestriction fragment length polymorphism, PCRRFLP) 을이용한 Lewis 혈액형군의유전형검사방법이이용되고있다. 유전자변이를검출하기위한방법으로직접염기서열분석법및 PCR-RFLP법외에 single strand conformation polymorphism (SSCP), 9) heteroduplex analysis (HA), 10) protein trucation [A1] test (PTT), 11) denaturing gradient gel electrophoresis (DGGE) 등 12) 이소개되고있는데, SSCP법과 HA는민감도가떨어지며 RFLP법은해당하는제한효소가존재해야하며, PTT, DGGE법등은민감도가높지만비용이많이들고시간및노동력이많이소모되는단점을가지고있다. 서구및동양인에서 FUT2 유전자는 C302T, C357T, C379T, A385T, G428T, C480T 변이그리고 FUT3 유전자는 T59G, T202C, C314T, G484A, G508A 변이등 5-7) 다양하게알려져있으나국내에서는일부유전자에대 론 한결과만보고되고있다. 13) 본연구에서는 Lewis 혈액형의표현형을검사하고, Lewis 혈액형을결정짓는 FUT2 및 FUT3 유전자전체를직접염기서열분석법을이용하여각유전자형의분포및빈도를알아보고자하였다. 대상및방법 1. 대상검체건강검진환자중직접항글로불린검사가음성인 225명 ( 남자 124명, 여자 101명 ) 을대상으로하였고, 평균연령은 44.6±13.7세였다. 대상군의 ABO 혈액형분포는 A, B, O, AB형이각각 67명 (36.4%), 48명 (26.0%), 53명 (28.8%), 16명 (8.7%) 이었다. 2. 방법 1) Lewis 혈액형의표현형검사대상군 225명에대하여적혈구 Lewis 혈액형의표현형검사는단클론성항체를이용한젤카드법 (DiaMed R - ID card, Diamed AG, Swiss) 을이용하여검사하였다. EDTA가포함되어있는시험관에채혈한전혈을이용하여냉장보관후 2일이내에검사를시행하였고각검사시마다양성및음성대조군을같이검사하였다. 표현형이 Le(a+b+) 로나온경우에는직접항글로불린검사를시행하여면역글로블린에의한위양성여부를확인하였다. 검사방법은브로멜린용액 (DiaMed R - ID diluent 1, Diamed AG, Swiss) 0.5mL 에전혈 50μL 를혼합하고실온에서 10분간배양하여만든 5% 적혈구부유액 10μL 를각각항-Le a [A3] 혈청과항-Le b [A4] 혈청이들어있는미세관 (DiaMed R -ID card, Diamed AG, Swiss) 에첨가한후, 10분간 ID-Centrifuge R (Diamed AG, Swiss) 를이용하여원침하고결과를판정하였다. 2) Lewis 혈액형의유전자형검사 (1) 중합효소연쇄반응및직접염기서열분석 : DNA 분리를위해 K 3 EDTA 시험관에들어있는말초혈액에서단핵구세포층을분리하여 70 o C에보관후사용하였다. DNA 추출분리는 QIAamp DNA blood mini kit (Qiagen, USA) 를이용하였다. 시발체 (primer) 는 tk1/ tk2 (FUT2) 및 sn1/sn2 (FUT3) 로 PCR을시행하였다 (Table 1). FUT2 유전자에대한 PCR 반응은 94 o C 1분, 65 o C 2분, 72 o C 2분의조건을 30회반복시행하였으며반응액은분리한 DNA 1μL, 시발체 0.2μM, dntp 200 μm, Tris-HCl 10mM (ph 8.8), KCl 50mM, MgCl 2

3 36 Korean J Hematol Vol. 43, No. 1, March, mM, gelatin 0.1mg/mL, Taq polymerase 5U을첨가하여최종반응액이 50μL가되게하였다. FUT3 유전자에대한 PCR 반응은 Gene Amp PCR System 9600 thermal cycler (Perkin Elmer, USA) 를이용하여처음 1회는 94 o C 3분, 62 o C 2분, 72 o C 3분실시후, 94 o C 60초, 62 o C 90초, 72 o C 90초의조건을 30회반복시행하였으며반응액은분리한 DNA 1μL, 시발체 0.2μM, dntp 200μM, Tris-HCl 10mM (ph 8.3), KCl 50mM, MgCl 2 1.5mM, gelatin 0.1mg/mL, Taq polymerase 5U을첨가하여전체양을 50μL 로하였다. 직접염기서열분석은 PCR 산물 (FUT2 1,153bp, FUT3 1,615bp) 과새로고안한시발체 11개및 ABI PRISM R BigDye TM Terminator Cycle Sequencing Ready Reaction Kits (Applied Biosystems, USA) 와 ABI Prism 3100 Sequencer (Applied Biosystems, USA) 를이용하여직접염기서열분석을시행하였다 (Table 2). 직접염기서열분석은 PCR 산물 (20ng/μL) 3μL, 시발체 (3.2pmo/μL) 1 μl, dntp (10mM/μL) 1μL, BigDye TM Terminator (Applied Biosystems, USA) 3μL 및증류수 2μL 로총반응액 10μL 를 95 o C 3분과 95 o C 2분, 50 o C 15초, 72 o C 1분의조건을 25회반복시행하였다. (2) 제한효소절편다형성분석법 : 직접염기서열분석을시행한후, FUT2 및 FUT3 유전자중단일염기변이가높게나타나는부위를대상으로제한효소를탐색 Table 1. Primers and PCR conditions in FUT2 and FUT3 gene Gene Name Primers (5' 3') Annealing temperature ( o C) Fragment sizes (bp) FUT2 tk1 GGGCCTCCATCTCCCAGCTAAC 65 1,153 tk2 TGCTTCTCATGCCCGGGCACTC FUT3 sn1 TAAGCAGGAGATTGTCATCAATGACC 60 1,615 sn2 GTGCAGAGAGATCATCACGGCACG Table 2. Primers for nested PCR and direct sequencing in FUT2 and FUT3 gene Gene Name Primers (5' 3') Locations (U17894, AY870341) Locations (Sec2, Le) FUT2 f GGGCCTCCATCTCCCAGCTAAC f CCTTCATCCCGGCCCAGAT ~264 2r AACGACTGGATGGAGGAGGAA f CGCTACAGCTCCCTCATCTT r TGCTTCTCATGCCCGGGCACTC 1,146 1,167 1,050 1,071 FUT3 f TAAGCAGGAGATTGTCATCAATGACC 8,382 8, f ACTGCCGACCGCAAGGTGTACC 8,725 8, r GCAGCGCTGGATCTGGTTCAA 8,832 8, f TGGTGCCTGGGCTGCCGGGA 9,542 9,561 1,097 1,116 2r TCTCTCTTACCTGGGACCTCACACGCTGGG 9,619 9,639 1,174 1,194 r GTGCAGAGAGATCATCACGGCACG 9,973 9,996 1,518 1,551 Table 3. PCR primers of the nested PCR reaction for the RFLP analysis of FUT2 and FUT3 gene Gene Primer name Primer sequences (5' 3') Annealing temperature ( o C) Product sizes (bp) FUT2 tk3 CAGGATCCCCTGGCAGAACTACCACA*TT*AA tk4 AGCAGGGGTAGCCGGTGAAGCGGACGTACT tk5 AACGACTGGATGGAGGAGGAATACCGCA*G*C tk6 AGGTCCAGGAGCAGGGGTAGCCGGTGAAG FUT3 sn3 CCATGGCGCCGCTGTCTGGCCGCC*C sn4 AGTGGCATCGTCTCGGGACACACG *Artificially changed bases to create restriction enzyme site.

4 송서영외 : 한국인 Lewis 혈액형군의유전자분석 37 하여선정하고, RFLP 분석을위한시발체를고안하여 2차 PCR 반응을시행한후, 제한효소처리후전기영동하여판독하였다. FUT2 유전자의 C357T, A385T 변이와 FUT3 유전자의 T59G 변이에대하여 PCR RFLP 를시행하였다. 2차 PCR 반응은 1차 PCR 산물 1μL, 결합반응온도및시발체외에나머지는 1차 PCR과동일하게 30회씩반응시켰다 (Table 3). 각각의 PCR을시행한후특이증폭띠를확인하고 PCR 산물 5μL 를 MspI, AseI, AluI 2.5단위와제조사가제공한반응완충액으로 37 o C에서 2시간소화시킨후, 그중일부를 4% Metaphor R agarose gel (FMC Bioproducts, USA) 에전기영동한후결과를판독하였다 (Table 4). 결과 1. Lewis 혈액형의표현형검사총 225명에대한 Lewis 표현형검사결과, Le(a b +) 70.7%, Le(a+b ) 12.4%, Le(a b ) 11.1%, Le(a +b+) 5.8% 였다. 그리고 Le(a+b+) 13명중 11명이 O형이었고 Le(a+b ) 는대부분이 A형과 B형이었으며, Le(a b+) 와 Le(a b ) 는 ABO 혈액형과관련이없었다 (Table 5). 2. Lewis 혈액형의유전자형검사 1) 직접염기서열분석직접염기서열분석결과, FUT2 유전자에서는네개의변이, 즉 C357T (92.2%), A385T (56.9%), G244A (0.4%) 및 del396 (1.8%) 변이를발견하였다. 이중 G244A와 del396변이는현재까지보고되지않은변이이다. 그리고 FUT3 유전자에서는 7개의변이를, 즉 T59G (46.9%), G508A (30.4%), T202C (1.1%), C314T (1.1%), A1029G (0.7%), T1067A (3.0%) 및 G1242A (13.3%) 변이를발견하였다 (Table 6). T202C와 C314T 변이는동양인에게서는발견되지않고주로구미인에게서발견되는변이이며, A1029G와 G1242A 변이는현재까지알려져있지않은단일염기변이이다. Lewis 표현형및유전자형검사결과는 98.2% (221/225) 일치하였고, 유전자분석으로 Le(a+b+) 와 Le(a+b ) 형은구별할수없었다 (Fig. 1, 2). 2) 제한효소절편다형성분석제한효소절편다형성분석결과 (Fig. 3, 4), FUT2 유전자에서 C357T 및 A385T의분포는각각 93.6% 및 58.7% 그리고 FUT3 유전자에서 T59G의분포는 47.2% 를보였으며, 직접염기서열분석결과와비교하면 C357T 3 예 (wild type C357T homozygote), A385T 4예 (A385T heterozygote A385T homozygote), T59G 2예 (wild Table 4. Restriction enzymes for the detection of FUT2 and FUT3 gene mutations Fragment sizes (bp) Primer Restriction Restriction Reaction Gene Mutations pairs enzyme site buffer Wild-type Mutated FUT2 tk3/4 C357T AseI AT/TAAT M tk5/6 A385T AluI AG/CT L FUT3 sn3/4 T59G MspI C/CGG M Abbreviations: M, medium concentrated reaction buffer included Tris-HCl 10mM (ph 7.5), MgCl 2 10mM, Dithiothreitol 1mM and NaCl 50mM; L, low concentrated reaction buffer included Tris-HCl 10mM (ph 7.5), MgCl 2 10mM and Dithiothreitol 1mM. Table 5. The distribution of ABO blood group and Lewis phenotype Blood group Le(a+b+) Le(a b+) Le(a+b ) Le(a b ) Total A (30.2%) B (26.7%) O (33.3%) AB (9.8%) Total (%) 13 (5.8%) 159 (70.7%) 28 (12.4%) 25 (11.1%) 225 (100%)

5 38 Korean J Hematol Vol. 43, No. 1, March, 2008 Table 6. The frequencies of FUT2 and FUT3 base substitutions in Korean Gene name Nucleotide substitution Allele frequency (%)* Type Frequency (%) FUT2 C357T 415 (92.2) W 7 (3.1) H 21 (9.3) M 197 (87.6) A385T 256 (56.9) W 58 (25.8) H 78 (34.7) M 89 (39.6) G244A 2 (0.4) W 223 (99.1) H 2 (0.9) M 0 (0) del396 4 (1.8) FUT3 T59G 211 (46.9) W 69 (30.7) H 101 (44.9) M 55 (24.4) G508A 137 (30.4) W 113 (50.2) H 87 (38.7) M 25 (11.1) T202C 5 (1.1) W 220 (97.8) H 5 (2.2) M 0 (0) C314T 5 (1.1) W 220 (97.8) H 5 (2.2) M 0 (0) T1067A 14 (3.1) W 211 (93.8) H 12 (5.3) M 1 (0.4) A1029G 3 (0.7) W 222 (98.7) H 3 (1.3) M 0 (0) G1242A 60 (13.3) W 167 (74.2) H 56 (24.9) M 2 (0.9) *Total number is 450 alleles, Total number is 225 cases. Abbreviations: W, wild-type; H, mutant heterozygotes; M, mutant homozygotes. Fig. 1. Chromatograms of direct sequencing for FUT2 gene mutations. (A) C357T heterozygote mutant. (B) G385A heterozygote mutant. (C) G244A wild type. (D) del396 mutant.

6 송서영외 : 한국인 Lewis 혈액형군의유전자분석 39 Fig. 2. Chromatograms of direct sequencing for FUT3 gene mutations. (A) T1067A heterozygote mutant. (B) T202C heterozygote mutant. (C) G1242A heterozygote mutant. (D) C314T heterozygote mutant. Fig. 4. Electrophoresis pattern for the detection of FUT3 gene mutation (T59G) using MspI restriction enzyme. Lane M-20bp DNA ladder; lane 6-wild type; lane 1,3,4,5,8-heterozygote mutants; lane 7-homozygotic mutants. Table 7. Comparison of direct sequencing and PCR-RFLP for the detection of FUT2 and FUT3 gene mutation Fig. 3. (A) Electrophoresis pattern for the detection of FUT2 gene mutation (C357T) using AseI restriction enzyme. Lane M-20bp DNA ladder; lane 1,3-wild type; lane 2,4,5,6,7,8heterozygote mutants. (B) Electrophoresis pattern for the detection of FUT2 gene mutation (A385T) using AluI restriction enzyme. Lane M-20bp DNA ladder; lane 1,4-wild type; lane 2,3,5,6,7,8-heterozygote mutants. type T59G homozygote, T59G heterozygote wild type) 에서위양성결과를보였다 (Table 7). 고 Lewis 항원은 19p13.3에위치하는 FUT2(Se) 와 FUT3 (Le) 유전자에의해발현되며 FUT2 유전자는 α(1,2)- 찰 FUT2 FUT3 C357T A385T T59G 92.2% 56.9% 46.9% Direct sequencing (415/450) (256/450) (211/450) 93.6% 57.8% 47.2% PCR-RFLP (421/450) (260/450) (212/450) fucosyltransferase를, 그리고 FUT3 유전자는당전이효소 α(1,3/1,4)-fucosyltransferase를생성한다. Le b 항원은 FUT2와 FUT3에의해생성된당전이효소의작용에의해만들어지며 Le a 항원은단지 FUT3에의해생성된당전이효소의작용에의해만들어진다. 2) 일반적으로 Lewis 혈액형군의표현형검사는단클론성항체

7 40 Korean J Hematol Vol. 43, No. 1, March, 2008 를이용한혈구응집반응을이용하는데, 적혈구의 Lewis 표현형은나이, 임신, 3) 알코올성췌장염, 간질환등 4) 여러생리적인조건에따라변화하는것으로알려져있으며검사에이용한시약의종류및비특이적인항 -Lewis 항체등에의해잘못검사될수있다 ) 특히임신중 Le(a b+) 인산모들에서 Le b 가소실되어 Le (a b ) 처럼나타나는데이는임신중증가되는지단백에 Le b 가결합되기때문으로생각되며이때항- Le b 가나타나기도한다. 3) 항-Lewis 항체는대부분실온에서잘반응하나그중 37 o C에서도응집이관찰되는경우도있고, 보체를부착시킴으로써항글로불린검사에양성을보이기도하며용혈성수혈부작용 8) 을일으키기도하므로 Lewis 혈액형군을정확하게검사할수있는검사법이필요할것으로생각한다. Ameno 등 19) 은몇종류의상품화된항-Lewis 항체를이용한검사에서같은환자에서다른표현형으로검사될수있으므로혈청학적검사로는 Lewis 혈액형을정확히결정하기어렵다고보고한바있다. 1987년부터 Lewis 혈액형군의표현형에단클론성항체를이용하면서적혈구 Lewis 표현형검사의예민도와특이도가증가하였으며유세포분석기 (flowcytometry), 효소면역측정법, 면역형광법등을이용한표현형검사도소개되고있다. 4-6) 최근 FUT2와 FUT3 유전자의염기서열이알려지고추가적변이부위가밝혀지면서 PCRRFLP를이용한 Lewis 혈액형군의유전형검사방법에대하여논의되고있다. 20,21) FUT2 유전자와 FUT3 유전자는최근 Kukowska- Latallo 등, 22) Rouquier 등 2) 과 Kelly 등 23) 에의해분리되었으며이들은 α(1,3/1,4)fucosyltransferase 와 α(1,2) fucosyltransferase를비활성화시키는 G428A 변이와 T59G 변이를보고하였다. Kudo 등 24) 은일본인의 FUT2 유전자중 A385T 변이와 C357T 변이를추가로발견하였고 PCR-RFLP법을이용하여 FUT2 유전자에서세가지의대립유전자를발견하고각각을 Se1, Se2 그리고 sej로명명하였다. 이들은일본인에서 FUT2 유전자의비활성화를일으키는 A385T 변이는 C357T 변이와항상같이일어난다고하였다. 서구및동양인에서 FUT2 유전자는 C302T, C357T, C379T, A385T, G428T, C480T 변이그리고 FUT3 유전자는 T59G, T202C, C314T, G484A, G508A 변이등다양하게알려져있으나 5-7,25) 국내에서는일부유전자에대한결과만보고되고있다. 13) 본연구에서는직접염기서열분석결과, FUT2 유전자에서 C357T (92.2%), A385T (56.9%) 와추가로 G244A (0.4%) 및 del396 (1.8%) 변이를발견하였고, FUT3 유전자에서 T59G (46.9%), G508A (30.4%) 와 T1067A (3.1%) 변이그리고구미인에만알려진 T202C (1.0%), C314T (1.0%) 와추가로현재까지보고가안된 A1029G (0.7%) 와 G1242A (13.3%) 변이를발견하였다. Lewis 표현형및유전자형검사결과는 98.2% (221/225) 일치하였고, 유전자분석으로 Lewis (a+b+) 와 Lewis(a+b ) 형은구별할수없었다. PCR-RFLP법으로 FUT2 및 FUT3 유전자중, T59G, C357T 및 A385T 변이에대하여분석한결과, PCR- RFLP법은직접염기서열분석법과비교하여 C357T 3 예, A385T 4예, T59G 2예에서차이를보였다. PCR- RFLP법에서차이를보인것은제한효소의작용이불완전하거나잘라진산물의전기영동시판독의실수인것으로생각한다. 본연구결과한국인에서 FUT2 및 FUT3 유전자에서의단일염기변화의분포를알수있었으며, Lewis 혈액형과관련된 FUT2 및 FUT3 유전자분석결과, 현재까지알려져있지않은단일염기변이 4개와추가로동양인에서알려져있지않은단일염기변이 2개를발견하였다. 본연구결과는 Lewis 혈액형군의표현형및유전자에관한분석및 Lewis 혈액형군관련질환의연구에활용될수있을것으로생각한다. 요약배경 : Lewis 혈액형군의표현형은 FUT2 및 FUT3 유전자에의해결정된다. 본연구에서는직접염기서열분석 (direct sequencing) 을시행하여 Lewis 혈액형을결정짓는 FUT2 및 FUT3 유전자의분포를분석하고 PCR- RFLP (restriction fragment length polymorphism) 법과비교하고자하였다. 방법 : 정상인 225명을대상으로적혈구에서 Lewis 혈액형군의표현형을검사하였고, 단핵구층을이용하여 FUT2 및 FUT3 유전자를분석하였다. Lewis 혈액형군의표현형검사는젤카드법을이용하여검사하였고, 유전자검사는직접염기서열분석을시행하였으며, FUT2 유전자의 C357T, A385T 변이와 FUT3 유전자의 T59G 변이에대하여 PCR-RFLP를시행하였다. 결과 : Lewis 표현형검사결과, Le(a b+) 70.7%, Le (a+b ) 12.4%, Le(a b ) 11.1%, Le(a+b+) 5.8% 였고, 직접염기서열분석결과, FUT2 유전자에서 C357T (92.2%), A385T (56.9%) 와현재까지보고되지않은새로운 G244A (0.4%) 및 del396 (1.8%) 변이를발견하였

8 송서영외 : 한국인 Lewis 혈액형군의유전자분석 41 고, FUT3 유전자에서 T59G (46.9%), G508A (30.4%), T1067A (3.0%) 와구미인에만알려진 T202C (1.1%), C314T (1.1%) 와현재까지보고되지않은 A1029G (0.7%) 및 G1242A (13.3%) 변이를발견하였다. PCR- RFLP 및직접염기서열분석법을비교한결과, PCR RFLP법은 C357T 1예, A385T 4예, T59G 2예에서불일치하였으며그외에는직접염기서열분석결과와일치하였다. 결론 : 한국인에서 FUT2 및 FUT3 유전자에서의단일염기변화의분포를알수있었다. 또한 FUT2 및 FUT3 유전자분석법중에서직접염기서열분석법이기존의 PCR-RFLP법에비해정확함을알수있었다. 참고문헌 1) McCurley RS, Recinos A 3rd, Olsen AS, et al. Physical maps of human alpha(1,3)fucosyltransferase genes FUT3-FUT6 on chromosomes 19p13.3 and 11q21. Genomics 1995;26: ) Rouquier S, Lowe JB, Kelly RJ, Fertitta AL, Lennon GG, Giorgi D. Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H locus-related DNA restriction fragments. Isolation of a candidate for the human Secretor blood group locus. J Biol Chem 1995;270: ) Hammer L, Månsson S, Rohr T, et al. lewis phenotype of erythrocytes and Le b -active actine glycolipid in serum of pregnant women. Vox Sang 1981;40: ) Stigendal L, Olsson R, Rydberg L, Samuelsson BE. Blood group Lewis phenotype on erythrocytes and in saliva in alcoholic pancreatitis and chronic liver disease. J Clin Pathol 1984;37: ) Liu TC, Chang JG, Lin SF, et al. Lewis (FUT3) genotypes in Taiwanese, Thai, and Filipino populations. Ann Hematol 2000;79: ) Larson G, Svensson L, Hynsjӧ L, Elmgren A, Rydberg L. Typing for the human lewis blood group system by quantitative fluorescence-activated flow cytometry: large differences in antigen presentation on erythrocytes between A(1), A(2), B, O phenotypes. Vox Sang 1999;77: ) Chang JG, Yang TY, Liu TC, et al. Molecular analysis of secretor type alpha(1,2)-fucosyltransferase gene mutations in the Chinese and Thai populations. Transfusion 1999;39: ) Costache M, Cailleau A, Fernandez-Mateos P, Oriol R, Mollicone R. Advances in molecular genetics of alpha-2- and alpha-3/4-fucosyltransferases. Transfus Clin Biol 1997;4: ) Serpa J, Almeida R, Oliveira C, et al. Lewis enzyme (alpha1-3/4 fucosyltransferase) polymorphisms do not explain the Lewis phenotype in the gastric mucosa of a Portuguese population. J Hum Genet 2003; 48: ) Ogilvie EM, Fife MS, Thompson SD, et al. The -174G allele of the interleukin-6 gene confers susceptibility to systemic arthritis in children: a multicenter study using simplex and multiplex juvenile idiopathic arthritis families. Arthritis Rheum 2003; 48: ) Buono P, Pasanisi F, Nardelli C, et al. Six novel mutations in the proopiomelanocortin and melanocortin receptor 4 genes in severely obese adults living in southern Italy. Clin Chem 2005;51: ) Andersson B, Ying JH, Lewis DE, Gibbs RA. Rapid characterization of HIV-1 sequence diversity using denaturing gradient gel electrophoresis and direct automated DNA sequencing of PCR products. PCR Methods Appl 1993;2: ) Suh IB, Kim YK. Relationship of Helicobacter pylori IgG seroprevalence with Lewis (a,b) blood group phenotype/genotype. Korean J Blood Transfus 2001; 12: ) Napierala D, Garcia-Rojas X, Sam K, et al. Mutations and promoter SNPs in RUNX2, a transcriptional regulator of bone formation. Mol Genet Metab 2005; 86: ) Cowles JW, Cox A, McMican A, Blumberg N. Comparison of monoclonal antisera with conventional antisera for Lewis blood group antigen determination. Vox Sang 1987;52: ) Young WW Jr, Johnson HS, Tamura Y, et al. Characterization of monoclonal antibodies specific for the Lewis a human blood group determinant. J Biol Chem 1983;25:258: )Rouger P, Noizat-Pienne F, Le Pennec PY. Advances in the use of monoclonal antibodies for blood group testing. Transfus Clin Biol 1997;4: ) Good AH, Yau O, Lamontagne LR, Oriol R. Serological and chemical specificities of twelve monoclonal anti-le a and anti-le b antibodies. Vox Sang 1992;62: ) Ameno S, Ameno K, Kinoshita H, Tanaka N, Ijiri I. Lewis genotyping by the PCR-RFLP method in a Japanese population and its evaluation in forensic analysis. Int J Legal Med 1997;110:232-4.

9 42 Korean J Hematol Vol. 43, No. 1, March, ) Nishihara S, Narimatsu H, Iwaski H, et al. Molecular genetic analysis of the human Lewis histo-blood group system. J Biol Chem 1994;269: ) Yazawa S, Oh-kawara H, Nakajima T, Hosomi O, Akamatsu S, Kishi K. Histo-blood group Lewis genotyping from human hairs and blood. Jpn J Hum Genet 1996;41: ) Kukowska-Latallo JF, Larsen RD, Nair RP, Lowe JB. A cloned human cdna determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group alpha(1,3/1,4)fucosyltransferase. Genes Dev 1990;4: ) Kelly RJ, Rouquier S, Giorgi D, Lennon GG, Lowe JB. Sequence and expression of a candidate for the human secretor blood group alpha(1,2)fucosyltransferase gene (FUT2). Homozygosity for an enzymeinactivating nonsense mutation commonly correlates with the non-secrector phenotype. J Biol Chem 1995;270: ) Kudo T, Iwasaki H, Nishihara S, et al. Molecular genetic analysis of the human Lewis histo-bood group system. II. Secrector gene inactivation by a novel single missense mutation A385T in Japanese nonsecretor individuals. J Biol Chem 1996;271: )Liu Y, Koda Y, Soejima M, Uchida N, Kimura H. PCR analysis of Lewis-negative gene mutations and the distribution of Lewis alleles in a Japanese population. J Forensic Sci 1996;41:

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

untitled

untitled 대한수혈학회지:제21권 제2호, 2010 유전자 검사로 확인된 A 1 B weak 형 환자 1예 조치현ㆍ유병준ㆍ윤승규ㆍ최계령ㆍ최재열ㆍ김장수ㆍ임채승ㆍ김영기ㆍ이갑노 고려대학교 의과대학 진단검사의학교실 Using Genotyping to Identify an A 1 B weak Blood Group Chi-Hyun Cho, Byong-Joon Yoo, Seung-Gyu

More information

혈액은행 자동화장비 IH-1000소개와 Autovue Innova와의 결과비교

혈액은행 자동화장비 IH-1000소개와 Autovue Innova와의 결과비교 혈액은행자동화장비도입을 위한 IH-1000 평가 혈액은행파트 김화영 1. 배경 (Background) 2. 목적 (Purpose) 3. IH-1000 소개 4. 실험방법 5. 실험결과 6. 결론 7. 검사단가및보험수가 1. 배경 ABO-RhD grouping과항체선별검사는혈액은행에서가장중요하고필수적인검사이고사소핚 Error로도 Acute hemolytic transfusion

More information

50(2)-04.fm

50(2)-04.fm 2006, Vol. 50, No. 2 Printed in the Republic of Korea RFLP 와 DHPLC 를이용한베체트병환자에서 Interleukin-6 유전자다형성의분석 Áû xá Á Á * w w yw» w (2005. 12. 26 ) Analysis of Interleukin-6 Gene Polymorphisms in Behcet s Disease

More information

untitled

untitled 대한수혈학회지 : 제 27 권제 2 호, 2016 The Korean Journal of Blood Transfusion Vol. 27, No. 2, 169-173, August 2016 http://dx.doi.org/10.17945/kjbt.2016.27.2.169 pissn 1226-9336 eissn 2383-6881 Case Report RHD (c.1227g>a)

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

Click to add title

Click to add title Genetic and Conventional Tests of PNH 2010. 8. 25. 원자력병원진단검사의학과 장윤환 Agenda 1. Mutation analysis of the PIGA gene 2. Cytogenetic study 3. Ham test and sucrose hemolysis test 4. Gel microtyping system (Gel

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

대한진단검사의학회지제 26 권제 5 호 2006 Korean J Lab Med 2006;26:374-9 원저 수혈의학 한국인에서 8 가지 ABO 대립유전자의빈도분석 송상훈 1 장호은 2 유광철 2 이현정 2 박경운 1,2 송정한 1,2 한규섭 1 서울대학교의과대학검사의

대한진단검사의학회지제 26 권제 5 호 2006 Korean J Lab Med 2006;26:374-9 원저 수혈의학 한국인에서 8 가지 ABO 대립유전자의빈도분석 송상훈 1 장호은 2 유광철 2 이현정 2 박경운 1,2 송정한 1,2 한규섭 1 서울대학교의과대학검사의 대한진단검사의학회지제 26 권제 5 호 2006 Korean J Lab Med 2006;26:374-9 원저 수혈의학 한국인에서 8 가지 ABO 대립유전자의빈도분석 송상훈 1 장호은 2 유광철 2 이현정 2 박경운 1,2 송정한 1,2 한규섭 1 서울대학교의과대학검사의학교실 1, 분당서울대학교병원진단검사의학과 2 Analysis for Eight ABO Alleles

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

( )Kjbt020.hwp

( )Kjbt020.hwp 대한수혈학회지 : 제 18 권제 3 호, 2007 RHCE 유전자의인트론 2 삽입부위에대한염기서열특이 - 중합효소연쇄반응을이용한 RhC/c 혈액형의판정 박철민 1 ㆍ허세란 2 ㆍ진선경 2 ㆍ장호은 2 ㆍ박경운 1,2 ㆍ송정한 1,2 ㆍ한규섭 1 = Abstract = 서울대학교의과대학검사의학교실 1, 분당서울대학교병원진단검사의학과 2 Determination

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

2001_34_한규섭.hwp

2001_34_한규섭.hwp 임상병리와정도관리 : 제 23 권제 2 호 2001 J. Clin, Pathol. & Quality Control 2001:22:???-??? 1 O 형부와 A 형모사이에서태어난 cis-ab 형자녀 1 예 송은영 전동석 * 서동희 ** 한규섭 서울대학교의과대학임상병리과학교실, 계명대학교의과대학임상병리과학교실 *, 대한적십자사혈액수혈연구원 ** A Case of

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

(079-088)Kjbt015.hwp

(079-088)Kjbt015.hwp 대한수혈학회지:제18권 제2호, 2007 다중 단일염기 시발체 확장반응을 이용한 ABO 유전자형 검사 현정원 1 장호은 2 허세란 2 송상훈 1 박경운 1,2 송정한 1,2 한규섭 1 = Abstract = 서울대학교 의과대학 검사의학교실 1, 분당서울대학교병원 진단검사의학과 2 ABO Genotyping using a Multiplex Single-base

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

untitled

untitled 대한수혈학회지 : 제 22 권제 1 호, 2011 장호은 1 ㆍ이경 1 ㆍ홍윤지 2 ㆍ김택수 2 ㆍ송상훈 1,2 ㆍ박경운 1,2 ㆍ송정한 1,2 ㆍ한규섭 2 = Abstract = 분당서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 Three Cases of Anti-K and the KEL Gene Frequency in the Korean

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보 Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

2014_........pdf

2014_........pdf 1, 1, 2, 1 (1, 2 ) Jin Suk Suh 1, Jong In Kim 1, Ryeong Jae Park 2, Sang Bum Park 1 (1 Korea Forest Research Institute, 2 Korea Traditional Dye Institute) Introduction (2011-2013), (VOCs)., (7 ),,. Materials

More information

황지웅

황지웅 Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

29(2)-04(임시근).fm

29(2)-04(임시근).fm Printed in the Republic of Korea ANALYTICAL SCIENCE & TECHNOLOGY Vol. 29, No. 2, 79-84, 2016 http://dx.doi.org/10.5806/ast.2016.29.2.79 Note ( 단신 ) Performance of MiniPCR TM mini8, a portable thermal cycler

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

원저 Lab Med Online Vol. 7, No. 4: , October 혈액은행 ABO-RhD 혈액형검사와비예기항체선별검사를위한혈액은행자동화장비 IH-500 과 VISI

원저 Lab Med Online Vol. 7, No. 4: , October 혈액은행 ABO-RhD 혈액형검사와비예기항체선별검사를위한혈액은행자동화장비 IH-500 과 VISI 원저 Lab Med Online Vol. 7, No. 4: 170-175, October 2017 https://doi.org/10.3343/lmo.2017.7.4.170 혈액은행 ABO-RhD 혈액형검사와비예기항체선별검사를위한혈액은행자동화장비 과 의평가 Evaluation of the Automated Blood Bank Systems and for ABO-RhD

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

< C0CCB1E2BFED2DC0CCB8EDBDC D E687770>

< C0CCB1E2BFED2DC0CCB8EDBDC D E687770> 원저 J Korean Neurol Assoc / Volume 24 / February, 200 젊은나이에산발성파킨슨병이생긴한국인환자의 Parkin 유전자변이 연세대학교의과대학신경과학교실, 영동세브란스병원신경과 Kee Ook Lee, M.D., Chul Hyoung Lyoo, M.D., Myung Sik Lee, M.D., Ph.D. Department of

More information

01-15(3)-12(최장경).fm

01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

Genomics and Nursing Practice

Genomics and Nursing Practice 약물유전체학 Pharmacogenomics Kangwon National Univ School of Medicine Hee Jae Lee PhD A : 안녕? 어떻게지내? B : 응, 난요즘혈압이조절이안돼. A : 그래? 난네가고혈압인줄몰랐다. 괜찮니? B : 그리오래되지않았어. 한반개월정도. 우리아버지가혈압이높으셨거든. 형이랑누나들도혈압이높은것같아. A

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

2113

2113 대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:239-43 DOI 10.3343/kjlm.2008.28.3.239 원저 진단유전학 In-House PCR법을이용한 HLA-B27 형별검사의유용성검토 ; PCR 검사키트와 In-House PCR의일치율비교 조선영 이광길 박수연 이희주 경희의료원진단검사의학과 Utility

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

노영남

노영남 Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding

More information

untitled

untitled 354 Jae-Jung Kim. Frequency and Distribution of Unexpected Antibody ORIGINAL ARTICLE Korean J Clin Lab Sci. 2018;50(3):354-358 https://doi.org/10.15324/kjcls.2018.50.3.354 pissn 1738-3544 eissn 2288-1662

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

DMD 보인자진단을위한다형분석 237 위한계치보다높게나타난다. 그러나 CPK치는채혈하는시간에따라다양한결과를보이며, 정상인과보인자의 CPK 수치가중복될수있다. 따라서 CPK 수치는보인자여부에대한상대적가능성만을제공한다 [2, 3]. DNA 분석법에의한보인자진단은 cdna

DMD 보인자진단을위한다형분석 237 위한계치보다높게나타난다. 그러나 CPK치는채혈하는시간에따라다양한결과를보이며, 정상인과보인자의 CPK 수치가중복될수있다. 따라서 CPK 수치는보인자여부에대한상대적가능성만을제공한다 [2, 3]. DNA 분석법에의한보인자진단은 cdna 대한임상병리학회지 : 제 20 권제 2 호 2000 Korean J Clin Pathol 2000; 20: 236-41 분자유전학 듀센형근이영양증보인자진단을위한유전자다형분석 최종락 송경순 박숙자 * 연세대학교의과대학임상병리과학교실, 부산일신기독병원 * Genetic Polymorphism Analysis for the Detection of Duchenne

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

untitled

untitled 대한수혈학회지 : 제 20 권제 2 호, 2009 박병민 1 ㆍ송윤경 1 ㆍ김택수 2 ㆍ이건호 3 ㆍ최지선 2 ㆍ성문우 1 ㆍ이도훈 1 ㆍ공선영 1 = Abstract = 국립암센터진단검사의학과 1, 서울대학교병원진단검사의학과 2, 국립암센터정보전산팀 3 The Frequency and Distribution of Unexpected Red Cell Antibodies

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

<BAF1B8B8C3DFB0E8C7D0BCFAB9D7BFACBCF62D323031322831302E3231292E687770>

<BAF1B8B8C3DFB0E8C7D0BCFAB9D7BFACBCF62D323031322831302E3231292E687770> 대한비만학회 제5회 연수강좌 저칼로리 레시피를 활용한 저칼로리 식단 작성하기 김 우 정 강남세브란스병원 영양팀 비만인구는 전 세계적으로 급속히 증가되고 있으 며, 00년에는 005년 유병률의 배인 세계인구의 약 60% 정도가 과체중 또는 비만일 것으로 예측되기 도 한다. 00년 국민건강영양조사 결과에 따르면 우 리나라의 성인 비만 유병률은 998년 6. %에서

More information

35 1 Journal of the Korean Society of Health Information and Health Statistics Volume 35, Number 1, 2010, pp ) 1) 2) 1) 1) Cadherin-1 (CDH1) po

35 1 Journal of the Korean Society of Health Information and Health Statistics Volume 35, Number 1, 2010, pp ) 1) 2) 1) 1) Cadherin-1 (CDH1) po 35 1 Journal of the Korean Society of Health Information and Health Statistics Volume 35, Number 1, 2010, pp. 1 15 1) 1) 2) 1) 1) Cadherin-1 (CDH1) polymorphism and the risk of colorectal cancer: A meta-analysis

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

슬라이드 1

슬라이드 1 유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant

More information

대한한의학원전학회지26권4호-교정본(1125).hwp

대한한의학원전학회지26권4호-교정본(1125).hwp http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

untitled

untitled 대한수혈학회지 : 제 19 권제 1 호, 2008 항 -E, 항 -M, 항 -Jk b, 항 -Le a 복합항체가검출된환자에서의용혈성수혈부작용경험 1 예 이종한ㆍ이상국ㆍ배인철ㆍ백은정ㆍ김신영ㆍ김현옥 = Abstract = 연세대학교의과대학진단검사의학교실 A Case of Hemolytic Transfusion Reaction in a Patient with Anti-E,

More information

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770> C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul

More information

untitled

untitled 대한수혈학회지 : 제 27 권제 1 호, 2016 The Korean Journal of Blood Transfusion Vol. 27, No. 1, 79-83, April 2016 http://dx.doi.org/10.17945/kjbt.2016.27.1.79 pissn 1226-9336 eissn 2383-6881 Case Report 효소반응단계에서소실되는항

More information

02Á¶ÇýÁø

02Á¶ÇýÁø Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

슬라이드 1

슬라이드 1 Recent update on clinical genetic and genomic testing 2016. 9. 12 짂단검사의학과김명싞 짂단검사의학 인체로부터채취되는각종검체로어떤물질을검사 질병의선별및조기발견, 짂단및경과관찰, 치료및예후판정에기여 질병의기전과병인론을연구 검사를처방하는의사들의자문에응하여유효핚임상적성과를얻게하는전문짂료과목 Divisions in

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15

목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 체외진단용의료기기 ( 인플루엔자바이러스및 A형간염바이러스 ) 의허가 심사가이드라인 2015. 2. 의료기기심사부체외진단기기과 - 1 - 목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 Ⅵ. 기술문서등의심사를위한제출자료 37 Ⅶ. 성능시험에대한상세사항 44 Ⅷ. 참고문헌

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

( ) 권석운.hwp

( ) 권석운.hwp 임상검사와정도관리 : 제 32 권제 1 호 2010 J Lab Med Qual Assur 2010; 32:95-101 95 혈액은행검사신빙도조사결과보고 (2009) 권석운 1 김대원 2 한규섭 3 김현옥 4 서장수 5 차영주 6 전동석 7 양동욱 8 박현준 9 임영애 10 권계철 11 이선호 1 강성하 12 황유성 13 대한임상검사정도관리협회혈액은행분과위원회울산의대

More information

Àå¾Ö¿Í°í¿ë ³»Áö

Àå¾Ö¿Í°í¿ë ³»Áö Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment

More information